ID: 1135669351

View in Genome Browser
Species Human (GRCh38)
Location 16:24361885-24361907
Sequence CACGCCCAGCACAGCCTTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 333}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135669338_1135669351 28 Left 1135669338 16:24361834-24361856 CCGGCCAACAGGCGCACCACGCC 0: 1
1: 0
2: 2
3: 2
4: 78
Right 1135669351 16:24361885-24361907 CACGCCCAGCACAGCCTTGGGGG 0: 1
1: 0
2: 2
3: 29
4: 333
1135669343_1135669351 -7 Left 1135669343 16:24361869-24361891 CCTCTGACCTCTGCCCCACGCCC 0: 1
1: 1
2: 10
3: 79
4: 748
Right 1135669351 16:24361885-24361907 CACGCCCAGCACAGCCTTGGGGG 0: 1
1: 0
2: 2
3: 29
4: 333
1135669341_1135669351 7 Left 1135669341 16:24361855-24361877 CCCGTCTGAACTGACCTCTGACC 0: 1
1: 0
2: 2
3: 21
4: 167
Right 1135669351 16:24361885-24361907 CACGCCCAGCACAGCCTTGGGGG 0: 1
1: 0
2: 2
3: 29
4: 333
1135669342_1135669351 6 Left 1135669342 16:24361856-24361878 CCGTCTGAACTGACCTCTGACCT 0: 1
1: 0
2: 5
3: 20
4: 208
Right 1135669351 16:24361885-24361907 CACGCCCAGCACAGCCTTGGGGG 0: 1
1: 0
2: 2
3: 29
4: 333
1135669339_1135669351 24 Left 1135669339 16:24361838-24361860 CCAACAGGCGCACCACGCCCGTC 0: 1
1: 0
2: 0
3: 6
4: 50
Right 1135669351 16:24361885-24361907 CACGCCCAGCACAGCCTTGGGGG 0: 1
1: 0
2: 2
3: 29
4: 333
1135669340_1135669351 12 Left 1135669340 16:24361850-24361872 CCACGCCCGTCTGAACTGACCTC 0: 1
1: 0
2: 0
3: 8
4: 95
Right 1135669351 16:24361885-24361907 CACGCCCAGCACAGCCTTGGGGG 0: 1
1: 0
2: 2
3: 29
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135669351 Original CRISPR CACGCCCAGCACAGCCTTGG GGG Exonic
900165313 1:1242156-1242178 CACGGCCTGTCCAGCCTTGGGGG - Intergenic
900594002 1:3472259-3472281 CCAGCCAAGCCCAGCCTTGGTGG + Intronic
900948135 1:5842862-5842884 CACTCCCAGCGCAGGCTTTGGGG + Intergenic
901178211 1:7320627-7320649 CACACACAGCACAGCCCAGGGGG - Intronic
901417602 1:9128496-9128518 CTGGCCCAGGACAGCCTCGGGGG + Intronic
901813343 1:11779882-11779904 CAGGCCCAGCACAGCCCTGCAGG - Exonic
902287173 1:15414161-15414183 CCCGCCTAGCACAGCCTTGCAGG + Intronic
902991596 1:20191352-20191374 GATGCCCAGCACAGACTTGTGGG - Exonic
903806469 1:26009310-26009332 CACACCCAGCAGAGCCTCAGGGG - Intergenic
904427282 1:30437188-30437210 CCCTCCCATCACAGGCTTGGAGG + Intergenic
905183299 1:36179327-36179349 CACGCCCAGCACTGCCCTTCGGG - Intronic
905225849 1:36478727-36478749 CATGCCCTGCACTACCTTGGAGG + Intronic
905386089 1:37605405-37605427 CACGCTGAGCCCAGCCCTGGAGG + Intergenic
905868961 1:41392022-41392044 CTCCCTCAGCACAGCCCTGGTGG + Intergenic
906246985 1:44283185-44283207 CATGCCTAGCTCTGCCTTGGGGG + Intronic
907074275 1:51564553-51564575 CAGGCAGAGCAAAGCCTTGGAGG - Intergenic
907413572 1:54299029-54299051 AACCCCCAGCACACCCTGGGTGG - Intronic
907726548 1:57025551-57025573 CAAGCCCAGTACAGCATAGGTGG - Intronic
909192548 1:72572841-72572863 CCCTCCCATCACAGGCTTGGAGG + Intergenic
913045900 1:115073279-115073301 CACACACAGCACAGCCAGGGAGG + Intronic
913101676 1:115573515-115573537 CCCTCCCATCACAGGCTTGGAGG + Intergenic
914938317 1:152000095-152000117 CACAGCAAGCACAGCCTTGGTGG - Intergenic
916295296 1:163212571-163212593 CATGCCCAGCACAGTTATGGAGG - Intronic
920215891 1:204361424-204361446 CACACACACCACAGCATTGGAGG + Intronic
920216238 1:204363209-204363231 GAGACCCAGCACAGCCTTGGAGG + Intronic
920626737 1:207609700-207609722 CACACCCAGCAAAGTCTTGATGG - Intronic
920859851 1:209696877-209696899 CATACCCAGCACAGCCTGGCAGG + Intronic
922237536 1:223733363-223733385 CAGGCCCAGCCCATCCTGGGGGG - Intronic
922793421 1:228323580-228323602 CACACGGAGCTCAGCCTTGGTGG - Exonic
924767595 1:247047915-247047937 CCCTCCCATCACAGGCTTGGAGG - Intronic
1063134532 10:3205188-3205210 CACTCCCAACACTGTCTTGGGGG - Intergenic
1064210084 10:13354261-13354283 CATACACAGAACAGCCTTGGGGG + Intergenic
1064450273 10:15435766-15435788 CAAGTCCAGCACTGCCTTGTTGG - Intergenic
1064491268 10:15860038-15860060 CACGCCCTGCCTTGCCTTGGTGG - Intronic
1066350258 10:34630750-34630772 TCCTCCTAGCACAGCCTTGGAGG - Intronic
1067518254 10:46973822-46973844 TACGCCCAGCAAAGCTATGGGGG - Intronic
1067643995 10:48078006-48078028 TACGCCCAGCAAAGCTATGGGGG + Intergenic
1067877415 10:50018536-50018558 CAGGCCCACCACAGCCTCTGGGG - Intergenic
1069262407 10:66414977-66414999 CACCTGCACCACAGCCTTGGTGG - Intronic
1070132633 10:73665796-73665818 CAGGCCCACCACAGCCTCTGGGG + Intergenic
1070846377 10:79525349-79525371 AAGGCCCAGCAGAGCCATGGTGG + Intergenic
1070927414 10:80234929-80234951 AAGGCCCAGCAGAGCCATGGTGG - Intergenic
1071609049 10:87018279-87018301 CAGGCCCACCGCAGCCTCGGGGG - Intergenic
1072035838 10:91561924-91561946 CCCTCCCATCACAGCCCTGGAGG - Intergenic
1072197025 10:93125044-93125066 CATGAACAGCACAGCCTTTGTGG - Intergenic
1075794610 10:125110144-125110166 CACTCCTAGCAGAGCCTTGAGGG - Intronic
1076007024 10:126956025-126956047 CCATCCCAGCACAGCCTTGGAGG - Intronic
1076357254 10:129862080-129862102 CAGGGCCAGGACAGCCCTGGAGG + Intronic
1080153329 11:29078505-29078527 CCCTCCCATCACAGCCCTGGAGG + Intergenic
1080442220 11:32305310-32305332 CATGCCCAGCAAGGCCTTTGAGG + Intergenic
1080693878 11:34584121-34584143 CATGCCCATCACAGCCTTGCCGG + Intergenic
1083425364 11:62581622-62581644 CAGTCCCAGCACAGCCTGGGAGG - Exonic
1083637737 11:64129507-64129529 CACCCCCAGCACAGCCTCCTGGG + Intronic
1083969925 11:66068692-66068714 CAGCCCCAGGACAGCCGTGGGGG + Exonic
1084215783 11:67646176-67646198 CAAGCACAGCACAGGCCTGGGGG - Intronic
1085754988 11:79194903-79194925 CCCTCCCATCACAGCCCTGGAGG + Intronic
1086084932 11:82944426-82944448 CCCTCCCATCACAGTCTTGGAGG - Intronic
1087126057 11:94626577-94626599 CCCTCCTAGCACAGTCTTGGAGG - Intergenic
1089042637 11:115467620-115467642 CATGCTCAACACAGCCTTTGAGG - Intronic
1089477848 11:118780072-118780094 CACTCACTGCACAGCCTGGGGGG + Intronic
1089491839 11:118888807-118888829 CACTCTCAGCCCAGCTTTGGGGG - Intronic
1090251780 11:125256548-125256570 CAACCCCAGCACTGGCTTGGTGG - Intronic
1090968075 11:131615796-131615818 CAGGCTCAGCACAGCCTTAGGGG - Intronic
1091020492 11:132095381-132095403 CAGTCCCTGCAGAGCCTTGGCGG - Intronic
1091237609 11:134032634-134032656 CAGGCCCAGCACAGCCTCCTCGG + Intergenic
1091350670 11:134891761-134891783 CCCTCCCATCACAGACTTGGAGG + Intergenic
1091545770 12:1500515-1500537 CTCCCCGAGCACAGCCTTTGTGG + Intergenic
1091912429 12:4243116-4243138 CAGGCCCAGCACAGGCTGGCAGG + Intergenic
1092618230 12:10234772-10234794 CACTCCCATCACAGGCCTGGAGG - Intergenic
1092674606 12:10901528-10901550 AACTCCCTGCTCAGCCTTGGGGG - Intronic
1095307078 12:40651279-40651301 CAAGCCAGGCACAGCCTGGGTGG - Intergenic
1096195035 12:49644312-49644334 CACCCCCAGCACACCATTGTTGG + Exonic
1096782587 12:53999741-53999763 CGCGCCCAGCTCGGCCCTGGGGG + Intronic
1097302801 12:58036042-58036064 CCCTCCCATCACAGGCTTGGAGG - Intergenic
1097693452 12:62755606-62755628 CATGCCCATCACAGACATGGGGG - Intronic
1099663529 12:85596801-85596823 CTCACCCATCACAGGCTTGGAGG - Intergenic
1103593005 12:122005575-122005597 CACACCCAGCCCAGCCTGGCAGG + Intergenic
1103738375 12:123075391-123075413 CCTGCCCAGCACAGCCTGGGTGG + Intronic
1104013673 12:124948945-124948967 CATGCACAGAGCAGCCTTGGTGG - Intronic
1104966117 12:132509485-132509507 CACGCCCGGCCCAGCCCTGCCGG + Intronic
1105813322 13:24012662-24012684 CCCGCCCACCACACACTTGGGGG - Intronic
1106106563 13:26738426-26738448 CCCTCCCATCACAGGCTTGGAGG + Intergenic
1107824447 13:44315501-44315523 CAAGCCCAGCCCACCATTGGTGG - Intergenic
1108431707 13:50360147-50360169 CAAGGGCAGCACAGCCTTGAAGG + Intronic
1109098198 13:58144668-58144690 CCCTCCCATCACAGGCTTGGAGG + Intergenic
1111323738 13:86664193-86664215 CCCTCCCAACACAGGCTTGGAGG - Intergenic
1114740904 14:25096272-25096294 CACCCCCAGCCAGGCCTTGGAGG + Intergenic
1115006522 14:28492121-28492143 CGAGCCCAGCAGAGCCATGGTGG - Intergenic
1116448382 14:45038339-45038361 AAAGCCAAGCACAGCCTGGGAGG - Intronic
1116756768 14:48958030-48958052 TACACCCAGCAAAGCCATGGGGG + Intergenic
1117466742 14:56001490-56001512 CACCCACAGCACAGCTCTGGGGG - Intergenic
1117854233 14:60010481-60010503 CACTCCCATCACAGGCCTGGAGG - Intronic
1117910914 14:60637667-60637689 GAGGCCCAGCCCAGCCTTTGCGG - Intergenic
1118840347 14:69505197-69505219 CATGCCCAGAACAGCCTTCATGG - Intronic
1119345708 14:73922134-73922156 AATTCCCAGCCCAGCCTTGGTGG + Exonic
1119400204 14:74357874-74357896 CATGCCCAGCACCTCCCTGGGGG - Exonic
1119450190 14:74702552-74702574 CACTCCCATCACAGACCTGGAGG - Intronic
1119500924 14:75126904-75126926 CTCGCCCAGCACCGACATGGCGG + Exonic
1120415817 14:84216838-84216860 AACACCCAGCAAAGCCTTGGGGG + Intergenic
1120620179 14:86753162-86753184 CACTCCCATCACAGGCATGGAGG - Intergenic
1121446868 14:93984244-93984266 CACTCCCAGCACAGACTTGCTGG + Intergenic
1121504130 14:94463270-94463292 GACATCCAGCACAGCCTTGTGGG + Exonic
1121547621 14:94773280-94773302 CACGCACAGCTCAGCATGGGAGG + Intergenic
1121615423 14:95310740-95310762 CATGCCCAGAACAGCCTTTTTGG - Intronic
1122285437 14:100649021-100649043 TGTGCCCAGCACAGCCATGGGGG + Intergenic
1122353832 14:101112041-101112063 CAGCCCCAGCTCAGCCTGGGTGG - Intergenic
1122490361 14:102111224-102111246 CCCTCCCATCACAGGCTTGGAGG + Intronic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1123113039 14:105881918-105881940 CAGGCCCAGCACTGCAGTGGAGG + Intergenic
1124003807 15:25780421-25780443 CACTCCCGGCACAGACCTGGCGG + Intronic
1124747217 15:32348709-32348731 AAAGCCCAGCACACCCCTGGAGG + Intergenic
1126514963 15:49524188-49524210 CCCTCCCATCACAGGCTTGGAGG + Intronic
1128036271 15:64529265-64529287 CACGCCCATCACAAACATGGGGG + Intronic
1129060526 15:72857048-72857070 TGCACCCAGCCCAGCCTTGGAGG - Intergenic
1129446785 15:75624718-75624740 CCCGCCAAGAACAGCCTTGAAGG - Exonic
1129488854 15:75904076-75904098 CACCCGCAGCAACGCCTTGGCGG - Exonic
1135669351 16:24361885-24361907 CACGCCCAGCACAGCCTTGGGGG + Exonic
1136424333 16:30159151-30159173 CACACCCAGCACAGACGGGGTGG - Intergenic
1136612716 16:31377028-31377050 GTCTCCCAGGACAGCCTTGGGGG - Exonic
1137746561 16:50824745-50824767 CAGGACCAGCACAGCCTGGGGGG - Intergenic
1137822711 16:51461103-51461125 CATGTCCAGCATAGCGTTGGAGG - Intergenic
1137984229 16:53094257-53094279 CCCGCCCAGCCCAGACTAGGCGG - Intronic
1138522406 16:57578451-57578473 CCCCCTCAGCACAGCCTGGGTGG - Intronic
1139320680 16:66111360-66111382 CACACTCAGCAAAGCCATGGAGG + Intergenic
1139341463 16:66270505-66270527 CACCCCCAGCCCAGCCCTGGCGG - Intergenic
1139559618 16:67733924-67733946 CACTCCCAGAGCAGGCTTGGTGG - Intronic
1140763546 16:78133841-78133863 CAAGCTCAGCTCAGCCTTGCAGG - Intronic
1141919282 16:87125284-87125306 CACGCTCAGCACTGCATGGGTGG - Intronic
1142854623 17:2722885-2722907 CACCCCCAGCCCAGCCTAGAAGG - Intergenic
1146571734 17:33958679-33958701 CACTCCCATCACAGGCTGGGAGG - Intronic
1147653033 17:42072731-42072753 CCGGCCCAGGACAGCCTTGGCGG + Intergenic
1147834459 17:43320006-43320028 CCCTCCCATCACAGGCTTGGAGG - Intergenic
1148553104 17:48562474-48562496 GGAGCCCAGCACAGCTTTGGGGG - Intronic
1148568148 17:48646166-48646188 GACGCCCTGAGCAGCCTTGGGGG - Intergenic
1148738655 17:49879738-49879760 CTCCCCCTGCCCAGCCTTGGGGG - Intergenic
1149366673 17:55952328-55952350 CTCTCCCATCACAGGCTTGGAGG + Intergenic
1149386388 17:56146748-56146770 CCCTCCTATCACAGCCTTGGAGG - Intronic
1150204146 17:63388487-63388509 CATGCCAAGCAAAGCCTAGGTGG - Intronic
1150295666 17:64006045-64006067 CACGCCCTGCAGATACTTGGGGG + Intronic
1151501038 17:74488957-74488979 CCCTCCCATCACAGGCTTGGAGG - Intergenic
1152134277 17:78494773-78494795 CACCACCAGCACAGACTTGATGG + Exonic
1152206478 17:78977163-78977185 CACACCCAGAAGAGCCTCGGAGG + Exonic
1156350568 18:36298086-36298108 CGCGCCCAGCCCAGCCCAGGGGG - Intronic
1157294987 18:46435822-46435844 CCCACCCAGCACTGCCTTGCTGG - Intronic
1157335248 18:46733062-46733084 CAGGGCCAGCACAGCCCAGGGGG + Intronic
1159357719 18:67358644-67358666 CTCTCCCATCACAGCCCTGGGGG + Intergenic
1159410814 18:68072867-68072889 CCCTCCCATCACAGGCTTGGAGG + Intergenic
1160155623 18:76431957-76431979 CCCGCCCACCACTGCCCTGGCGG + Intronic
1160219005 18:76958821-76958843 AAGGCCCAGCACAGTCTGGGAGG - Intronic
1160256309 18:77250994-77251016 CACGCCCAGCAGCGCGTTGCGGG - Exonic
1160368513 18:78350174-78350196 CATGCCCTGGAGAGCCTTGGTGG + Intergenic
1160417441 18:78721101-78721123 CACGCCCAGCACTGCCTGTGGGG + Intergenic
1160429996 18:78804535-78804557 CAGGCCCAGCACTCACTTGGTGG + Intergenic
1160590990 18:79944587-79944609 CACACACAGCCCAGCCTTGGAGG - Intronic
1160717835 19:584443-584465 CTCGTGCTGCACAGCCTTGGAGG + Intergenic
1160748601 19:723067-723089 CACCCCCAGCCCCGCCTGGGAGG - Intronic
1160820990 19:1057960-1057982 CGTGCCCAGCACAGCCTATGTGG + Exonic
1161217417 19:3101356-3101378 CAGCCCCACCACAGCCGTGGGGG - Intronic
1161481541 19:4513261-4513283 GCCGGTCAGCACAGCCTTGGAGG + Exonic
1162068188 19:8138177-8138199 CACGCGCATCAGAGCCATGGGGG + Exonic
1162590451 19:11587902-11587924 CACGCCCTGCACAGGCCTAGTGG - Intronic
1163374750 19:16923160-16923182 CACTCCCAGCCCAGCCTTGGAGG - Intronic
1163836644 19:19579057-19579079 CACGCCCGGCCCAGACTGGGTGG - Intronic
1165529541 19:36386537-36386559 TAAGCCCAGCAAAGCCATGGGGG + Intronic
1165897882 19:39154467-39154489 CTGGCCCAGCTCAGCCCTGGAGG - Intronic
1166198265 19:41220367-41220389 CACGCCCTGCACTGCCTGGCAGG - Intronic
1167209199 19:48122538-48122560 CACTCCCAGCCCCGCCTTGCTGG + Intronic
1167870605 19:52366794-52366816 CACACCTAGCACAACATTGGAGG + Exonic
1168123989 19:54272783-54272805 AACTCCCAGCACAGCCCTGGTGG + Intronic
1168160002 19:54503778-54503800 CCCACCCAGCACTGCCTTTGGGG - Intronic
1168176323 19:54630508-54630530 CACACGCAGCTCAGCCTGGGCGG + Exonic
1168178377 19:54642751-54642773 AACTCCCAGCACAGCCCTGGTGG - Intronic
925181139 2:1817639-1817661 CAGGCCCAGCGCGGCCCTGGGGG + Intronic
925347292 2:3179901-3179923 CACTCCCAGCCCAGCCCTGTGGG + Intergenic
925634442 2:5929156-5929178 TATCCCCAGCACAGCCATGGTGG + Intergenic
926636201 2:15182159-15182181 CAGGCCCAGCACAACCTGAGAGG - Intronic
927433553 2:23047646-23047668 CACCACCCACACAGCCTTGGGGG + Intergenic
929211300 2:39359910-39359932 CCCTCCCATCACAGCCCTGGAGG - Intronic
929748905 2:44689503-44689525 CAAGCACAGCAGGGCCTTGGGGG + Intronic
929825212 2:45304630-45304652 AAGGCCCAGCACACCCTAGGAGG - Intergenic
930713320 2:54569886-54569908 CACACCCAGAACAGGTTTGGGGG - Intronic
931304727 2:61017436-61017458 CACTCCCAGAAAAGCCTCGGTGG + Intronic
932424582 2:71620939-71620961 CACGCCCAGAAGAGCCTTCTGGG - Intronic
934729832 2:96649541-96649563 CAAGCCCTGCACAGCCTGGTTGG - Intergenic
936732884 2:115405384-115405406 TACACCCAGCAAAGTCTTGGAGG - Intronic
939619761 2:144404292-144404314 CATGCCCAGGACAGACTTGTCGG + Intronic
940826300 2:158416248-158416270 CCCTCCCATCACAGCCCTGGAGG - Intronic
940878395 2:158921768-158921790 CAAGCCAAGCACAGCCTGCGGGG - Intergenic
944306272 2:198183492-198183514 CAGGCACAGCACAGCCGTGTGGG + Intronic
945328799 2:208515324-208515346 CCCTCCCATCACAGGCTTGGAGG - Intronic
947628196 2:231634514-231634536 CAAGCCCAGCTCAGGCTTGCAGG - Intergenic
947870610 2:233435834-233435856 CACGCACAGCACAGCGCTTGTGG - Exonic
948209208 2:236179696-236179718 CACGCCCAGCTCAGGCTTCAGGG - Intergenic
1170884077 20:20323131-20323153 CTCGCCTAGCTGAGCCTTGGCGG - Intronic
1171893227 20:30736017-30736039 CACTCCCAGCACACCTCTGGCGG + Intergenic
1174192673 20:48751312-48751334 CTCACCCAGCACAGCCAGGGAGG + Intronic
1174278324 20:49419857-49419879 CAGGCCCTGCAGAGCCTTGTGGG - Intronic
1174531471 20:51217831-51217853 CCCTCCCATCACAGGCTTGGAGG - Intergenic
1174985638 20:55448568-55448590 CACACTCAGCGCAGCCTTGTTGG - Intergenic
1175851033 20:62093095-62093117 CCTGCCCAGCAGAGCCCTGGGGG + Intergenic
1176546173 21:8201210-8201232 CCCCCCCACCACCGCCTTGGTGG + Intergenic
1176565124 21:8384256-8384278 CCCCCCCACCACCGCCTTGGTGG + Intergenic
1179170873 21:38971860-38971882 CACGGTCATCAGAGCCTTGGAGG - Intergenic
1179496967 21:41778205-41778227 CACGCCCGGCCCAGGGTTGGGGG + Intergenic
1180183196 21:46127085-46127107 CACGTCCAGCAGAGCCTGGACGG - Intronic
1180921594 22:19524293-19524315 GCCGCGCAGCACGGCCTTGGGGG - Exonic
1181000155 22:19984303-19984325 GACCCTCACCACAGCCTTGGTGG - Intronic
1181625229 22:24118544-24118566 CACGCCCTGCACAGCCTGCCTGG - Intronic
1182284192 22:29234325-29234347 GCTGCCCAGCAGAGCCTTGGGGG - Exonic
1182476351 22:30578684-30578706 CTGGCCCAGCCCAGCCTTTGGGG - Intronic
1183044404 22:35208173-35208195 AAAGCCCAGCAGAACCTTGGGGG - Intergenic
1184449126 22:44572601-44572623 CACACCCAGCTCAGCCTGGGAGG - Intergenic
1185003770 22:48263251-48263273 AGGACCCAGCACAGCCTTGGGGG - Intergenic
1185047205 22:48534491-48534513 CAGGTCCAGGACAGCCTGGGTGG + Intronic
1185076116 22:48683600-48683622 CACTGCCAGGACAGCCTAGGAGG + Intronic
1203251045 22_KI270733v1_random:117447-117469 CCCCCCCACCACCGCCTTGGTGG + Intergenic
949937857 3:9130935-9130957 CATGCACAGCCCAGCCTGGGAGG - Intronic
950574798 3:13825787-13825809 CTGGCCCAGCAAAGCCTTGATGG - Intronic
951575335 3:24107459-24107481 CAGGCCCTGTACAGCCTTGCAGG + Intergenic
952029063 3:29119675-29119697 CACTCCCATCACAGACCTGGAGG + Intergenic
953914588 3:46910120-46910142 CAAGCCCCTCACTGCCTTGGAGG - Intergenic
953980013 3:47408902-47408924 CTCTGCCAGCTCAGCCTTGGAGG - Exonic
954752264 3:52820253-52820275 ACCACCCAGCACAGCCTTTGAGG + Intronic
958042555 3:88244524-88244546 CCCTCCCATCACAGGCTTGGAGG + Intergenic
958724943 3:97893553-97893575 CAGGCCCATCACAGATTTGGGGG - Intronic
960132992 3:114077110-114077132 CAAGGCCAGGACAGCCTTGATGG - Intronic
960626564 3:119687063-119687085 CACTCTCATCACAGGCTTGGAGG - Intergenic
965607034 3:170507905-170507927 CATGCTCAGTACAGCCCTGGGGG - Intronic
965897476 3:173595005-173595027 CCCTCCCATCACAGGCTTGGAGG - Intronic
966733386 3:183168837-183168859 CTCTCCCATCACAGGCTTGGAGG - Intergenic
967088578 3:186115765-186115787 CAGGCCCAGCAGAGCCTCAGCGG - Intronic
968601768 4:1513036-1513058 CCCGCCCAGCACCGCCCAGGAGG + Intergenic
968625718 4:1625823-1625845 CACGCCAAGTGGAGCCTTGGGGG + Intronic
968658693 4:1789820-1789842 CCGGCCCAGCCCAGCCCTGGCGG - Intergenic
968871272 4:3243808-3243830 CTCGCCCATCACAGCCCTGCTGG - Exonic
969406528 4:6996709-6996731 CCCGCCCGGGACAGCCCTGGGGG - Intronic
970678322 4:18477575-18477597 CCCTCCCATCACAGGCTTGGAGG - Intergenic
971111536 4:23591602-23591624 CCCTCCCATCACAGGCTTGGAGG + Intergenic
973145731 4:46823165-46823187 CCCACCCAGCAGAACCTTGGAGG - Intronic
980458662 4:133076605-133076627 CCCTCCCATCACAGGCTTGGAGG - Intergenic
980646070 4:135643990-135644012 AACTCCCATCACAGGCTTGGAGG + Intergenic
980803420 4:137782678-137782700 CAAGCCCAGAACTGCCTTGGTGG + Intergenic
981378243 4:144040297-144040319 CACTCCCATCACAGGCCTGGAGG - Intergenic
982802677 4:159723393-159723415 CACTCCCAGCACCTGCTTGGGGG - Intergenic
983006350 4:162490198-162490220 CACTCCCATCACAGGCCTGGAGG + Intergenic
983068168 4:163235970-163235992 CTCTCCCATCACAGGCTTGGAGG - Intergenic
984058897 4:174966665-174966687 CATGACCAGCAGAGCCATGGAGG - Intronic
985731819 5:1553705-1553727 CAGGCCCACCAGAGCCTTGCAGG - Intergenic
985785697 5:1892826-1892848 CAAGCCCCGCACAGCCCTGTGGG + Intergenic
986113972 5:4750846-4750868 CCCTCCCATCACAGGCTTGGAGG - Intergenic
986280800 5:6320840-6320862 CTCTCCCTGCACAGACTTGGAGG - Intergenic
989282954 5:39665703-39665725 CACGCCTAGCCCACCCTCGGTGG + Intergenic
989719327 5:44505322-44505344 TATGCCCAGCAAAGCCATGGGGG + Intergenic
990092282 5:52066966-52066988 CATGCCCATTACACCCTTGGGGG - Intronic
995299800 5:110566261-110566283 CCCTCCCATCACAGTCTTGGAGG - Intronic
997346994 5:133199257-133199279 CAGGGCCAGCTCAGCCCTGGGGG - Exonic
998146846 5:139733978-139734000 CACGTCTAGCCCAGCCTAGGCGG + Intergenic
998397935 5:141831493-141831515 CAGGACCAGTGCAGCCTTGGAGG - Intergenic
998926104 5:147127969-147127991 CCCTCCCATCACAGGCTTGGAGG - Intergenic
999322558 5:150624604-150624626 CCCGCCCCGCCCAGCCCTGGGGG - Intronic
999504460 5:152180338-152180360 CTCTCCCATCACAGGCTTGGAGG - Intergenic
1003008364 6:2403210-2403232 CAGTCCCAGCACAGCGTTGCTGG + Intergenic
1005807407 6:29487645-29487667 GGAGACCAGCACAGCCTTGGGGG + Exonic
1006980556 6:38144500-38144522 TGCGCCCAGCACAGGCTAGGGGG + Intronic
1008152762 6:47975059-47975081 GAAGCCCAACCCAGCCTTGGAGG - Intronic
1008820881 6:55629615-55629637 CCCTCCCATCACAGGCTTGGAGG + Intergenic
1009588772 6:65638796-65638818 CAAGCCAAGCACAGCCTGGCAGG + Intronic
1010318622 6:74480158-74480180 CAGGCACGGCACAGCCTTGGGGG - Intergenic
1011418922 6:87152103-87152125 AGCGCCCAGCAGGGCCTTGGCGG + Intergenic
1011696953 6:89921484-89921506 CAGTCCCAGCACAGCCTAGTGGG + Intergenic
1011895216 6:92216891-92216913 CCCCCCCATCACAGGCTTGGAGG + Intergenic
1012161370 6:95888997-95889019 CACTCCCATCACAGTCCTGGAGG - Intergenic
1012511603 6:100009132-100009154 CACCCCCAGCACATCCGTGCTGG + Intergenic
1012804592 6:103878407-103878429 CACACCCAAGACATCCTTGGTGG - Intergenic
1013150374 6:107440071-107440093 GACCACCAGCTCAGCCTTGGTGG - Intronic
1013829580 6:114255850-114255872 CCCTCCCAGCACAGGCCTGGAGG - Intronic
1014840702 6:126217666-126217688 CACACCCAGCACAGTCTCAGTGG - Intergenic
1016094682 6:140020701-140020723 CCCTCCCATCACAGCCCTGGAGG - Intergenic
1016177552 6:141099026-141099048 CCCTCCCACCACAGGCTTGGAGG + Intergenic
1016209031 6:141505670-141505692 CCCTCCCATCACAGGCTTGGAGG - Intergenic
1017617093 6:156257256-156257278 CACGGCCAGCACACACCTGGAGG + Intergenic
1018850930 6:167589587-167589609 CATGCCCAGCACAGGCTGTGGGG + Intergenic
1020028389 7:4915968-4915990 GCCGCCCAGCAAACCCTTGGCGG - Intronic
1027795720 7:82691174-82691196 CAAGCCAGGCACAGCCTGGGTGG - Intergenic
1028993902 7:97078486-97078508 CACGCCTGGCACAGAGTTGGTGG + Intergenic
1033223350 7:139543137-139543159 CACGCCCATGGCAGCCCTGGAGG + Intronic
1033492069 7:141853660-141853682 CCCTCCCATCACAGGCTTGGAGG - Intergenic
1035325281 7:158061974-158061996 CATGCCCAGCTCCGCCTTCGTGG - Intronic
1035386001 7:158473403-158473425 CACGCCCAGGACAGCCGGGAGGG + Intronic
1037480804 8:19303442-19303464 CAAGCCCAGAACAGCCTCAGGGG - Intergenic
1037963728 8:23117742-23117764 CACCCACAGCAGAGCCCTGGCGG + Intergenic
1039071336 8:33651900-33651922 CCCTCCCACCACAGGCTTGGAGG + Intergenic
1039563028 8:38528360-38528382 CACCCCCACAGCAGCCTTGGTGG + Exonic
1040286009 8:46100751-46100773 CCCACCCAGGACAGCCCTGGGGG + Intergenic
1040290351 8:46121032-46121054 CACACCCAGGACAGCTTTGGGGG + Intergenic
1040292318 8:46131813-46131835 AAGGCCCAGGACAGCCCTGGGGG + Intergenic
1040292365 8:46132031-46132053 CACACCCAGAACAGCTCTGGGGG + Intergenic
1040301178 8:46188795-46188817 CATGCCCAGGACAGACTTGTGGG + Intergenic
1040302565 8:46195577-46195599 TCTGCCCAGGACAGCCTTGGGGG - Intergenic
1040302831 8:46196824-46196846 TATGCCCAGGACAGCCCTGGAGG - Intergenic
1040304164 8:46203428-46203450 CCCGTCCAGTACAGCCCTGGGGG - Intergenic
1040304525 8:46205156-46205178 TCTGCCCAGCACAGCCTTGGGGG - Intergenic
1040304895 8:46206907-46206929 CCCACCCAGGACAGCCTTAGTGG - Intergenic
1040306205 8:46213119-46213141 CACGCCCAGGACAGCCCTGTGGG - Intergenic
1040308622 8:46225137-46225159 CACGCCCAGGACAGCCCTGGGGG - Intergenic
1040309317 8:46228571-46228593 CACGCCCGGGACAGTCCTGGGGG - Intergenic
1040310258 8:46233204-46233226 CCCGCCCCGGACAGCCATGGGGG - Intergenic
1040311057 8:46237077-46237099 CTTGCCCAGGACAGCCCTGGTGG - Intergenic
1040312349 8:46243302-46243324 CCTGCCCAGCGCAGCCCTGGGGG - Intergenic
1040312759 8:46245238-46245260 CCCGCCCGGGACAGCCCTGGGGG - Intergenic
1040313557 8:46249264-46249286 CATGCCCAGGACAGCCCTGGGGG - Intergenic
1040313792 8:46250366-46250388 CCCGCCCAGGTCAGACTTGGGGG - Intergenic
1040314427 8:46253501-46253523 CCCGCCCAGGACAGTCCTGGTGG - Intergenic
1040315044 8:46256540-46256562 CCCACCCAGGACAGCCCTGGGGG - Intergenic
1040315126 8:46256973-46256995 CCCGCCCGGGACAGCCCTGGGGG - Intergenic
1040315220 8:46257424-46257446 CAGGTCCAGGACAGCCCTGGGGG - Intergenic
1040316405 8:46263207-46263229 CTCGCCCAGGACAGCCCTGGGGG - Intergenic
1040323807 8:46331173-46331195 CCGGCCCAGGACAGCCATGGGGG - Intergenic
1040326280 8:46343220-46343242 CACGCCAGGGACAGCCCTGGGGG - Intergenic
1040331009 8:46385754-46385776 CCCACCCAGGACAGCCTTTGGGG - Intergenic
1040332258 8:46391644-46391666 CCTGCCCAGGACAGCCCTGGGGG - Intergenic
1040335509 8:46413965-46413987 CACACCCAGAACAGCCCTGGTGG - Intergenic
1040336486 8:46418657-46418679 CCCGCCCAGGACAGCCCTGAGGG - Intergenic
1040338920 8:46430108-46430130 CCCGCCCGGGACAGCCCTGGGGG - Intergenic
1040338971 8:46430325-46430347 CCCGCCCAGGACACCCCTGGGGG - Intergenic
1040341557 8:46443669-46443691 CCAGCCCAGGACAGCCCTGGGGG + Intergenic
1040342118 8:46446347-46446369 CCCACCCCGGACAGCCTTGGGGG + Intergenic
1044580376 8:93820184-93820206 CACACCATGCACAGCCATGGGGG - Intergenic
1045604804 8:103760479-103760501 CTCACCCAGCACTGCCATGGTGG - Intronic
1046170332 8:110497697-110497719 CCCTCCCATCACAGACTTGGAGG + Intergenic
1046606091 8:116373670-116373692 CCCTCCCAGCACAGACCTGGGGG - Intergenic
1046937166 8:119895591-119895613 CAGGCACAGAAGAGCCTTGGGGG + Intronic
1047254859 8:123207258-123207280 CAGGCCCATCACAGGCTTGGAGG - Exonic
1047746074 8:127845981-127846003 CAGGGCCAGCACAGCCTTCCTGG - Intergenic
1048571546 8:135661078-135661100 TACACCCAGCAAAGCCATGGAGG - Intergenic
1049480286 8:142819371-142819393 GAAGCCCAGCAGAGGCTTGGGGG - Intergenic
1050313944 9:4381948-4381970 CAGTCCCAGCACAGGCTGGGTGG + Intergenic
1051128674 9:13835003-13835025 CCCTCCCATCACAGCCTGGGAGG + Intergenic
1056335461 9:85564105-85564127 AAGGCCCAGCAAAGCCATGGGGG + Intronic
1056666863 9:88588154-88588176 CAGGCCAAACACAGCCTTGAGGG + Intergenic
1056776711 9:89518343-89518365 AACACACAGCACAGGCTTGGAGG + Intergenic
1057855232 9:98596401-98596423 CAGTCACAGCACAGCCTTGGGGG + Intronic
1059914043 9:119078506-119078528 CACGCCTTGTACATCCTTGGTGG + Intergenic
1061403594 9:130381867-130381889 CACCCCCAGCACTGCCATGAAGG + Intronic
1061553350 9:131350480-131350502 CACCCCAAGAGCAGCCTTGGAGG + Intergenic
1062450573 9:136614123-136614145 CAAGGCCAGCACAGCCCAGGAGG - Intergenic
1062609397 9:137367208-137367230 CCTGCCCAGCAGTGCCTTGGGGG + Intronic
1203467450 Un_GL000220v1:100714-100736 CCCCCCCACCACCGCCTTGGTGG + Intergenic
1186372920 X:8965569-8965591 CTCTCCCATCACAGGCTTGGAGG - Intergenic
1189871381 X:45386541-45386563 CACCCCCAACACACCCTGGGAGG - Intergenic
1190513334 X:51195910-51195932 CCCTCCCATCACAGGCTTGGAGG - Intergenic
1190598295 X:52067218-52067240 CCGGCCCAGCACAGCCTTCCTGG - Exonic
1190610529 X:52186855-52186877 CCGGCCCAGCACAGCCTTCCTGG + Exonic
1191089632 X:56606296-56606318 CACTCCAAGCAGAGCTTTGGAGG - Intergenic
1191177309 X:57517557-57517579 CACTCCCAGCAGATCTTTGGAGG - Intergenic
1191586571 X:62833775-62833797 TATGCCCAGCAAAGCCATGGGGG - Intergenic
1193250245 X:79281997-79282019 CTCTCCCATCACAGCCCTGGAGG - Intergenic
1193826902 X:86237606-86237628 CAAGCCCAGCACAGCCTGCCAGG - Intronic
1194244438 X:91493651-91493673 CCCTCCCATCACAGCCCTGGAGG - Intergenic
1195228600 X:102823404-102823426 CATGCCCAGCAAAGCCATAGGGG - Intergenic
1196605691 X:117654721-117654743 CCCTCCCATCACAGCCCTGGAGG - Intergenic
1199117443 X:144008901-144008923 CCCTCCCATCACAGCCCTGGAGG - Intergenic
1199393495 X:147307982-147308004 CACTCCCATCACAGACCTGGAGG - Intergenic
1199806542 X:151305861-151305883 CCCTCCCATCACAGGCTTGGAGG - Intergenic
1200563416 Y:4734948-4734970 CCCTCCCATCACAGCCCTGGAGG - Intergenic