ID: 1135671409

View in Genome Browser
Species Human (GRCh38)
Location 16:24378637-24378659
Sequence CCAGGTGTCCCAAGGGCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135671403_1135671409 11 Left 1135671403 16:24378603-24378625 CCTGCTTAGAGATCAAGCAGCTT No data
Right 1135671409 16:24378637-24378659 CCAGGTGTCCCAAGGGCTAAAGG No data
1135671402_1135671409 25 Left 1135671402 16:24378589-24378611 CCTACTAGTGCTCACCTGCTTAG No data
Right 1135671409 16:24378637-24378659 CCAGGTGTCCCAAGGGCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135671409 Original CRISPR CCAGGTGTCCCAAGGGCTAA AGG Intergenic
No off target data available for this crispr