ID: 1135671409 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:24378637-24378659 |
| Sequence | CCAGGTGTCCCAAGGGCTAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1135671403_1135671409 | 11 | Left | 1135671403 | 16:24378603-24378625 | CCTGCTTAGAGATCAAGCAGCTT | No data | ||
| Right | 1135671409 | 16:24378637-24378659 | CCAGGTGTCCCAAGGGCTAAAGG | No data | ||||
| 1135671402_1135671409 | 25 | Left | 1135671402 | 16:24378589-24378611 | CCTACTAGTGCTCACCTGCTTAG | No data | ||
| Right | 1135671409 | 16:24378637-24378659 | CCAGGTGTCCCAAGGGCTAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1135671409 | Original CRISPR | CCAGGTGTCCCAAGGGCTAA AGG | Intergenic | ||
| No off target data available for this crispr | |||||