ID: 1135671754

View in Genome Browser
Species Human (GRCh38)
Location 16:24381580-24381602
Sequence CTTTTTCCCAACAAGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135671754_1135671757 26 Left 1135671754 16:24381580-24381602 CCAAATTCCTTGTTGGGAAAAAG No data
Right 1135671757 16:24381629-24381651 ACTTAGAGAACATCTCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135671754 Original CRISPR CTTTTTCCCAACAAGGAATT TGG (reversed) Intergenic
No off target data available for this crispr