ID: 1135671757

View in Genome Browser
Species Human (GRCh38)
Location 16:24381629-24381651
Sequence ACTTAGAGAACATCTCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135671752_1135671757 28 Left 1135671752 16:24381578-24381600 CCCCAAATTCCTTGTTGGGAAAA No data
Right 1135671757 16:24381629-24381651 ACTTAGAGAACATCTCAGCAAGG No data
1135671755_1135671757 19 Left 1135671755 16:24381587-24381609 CCTTGTTGGGAAAAAGAGCTCGG No data
Right 1135671757 16:24381629-24381651 ACTTAGAGAACATCTCAGCAAGG No data
1135671753_1135671757 27 Left 1135671753 16:24381579-24381601 CCCAAATTCCTTGTTGGGAAAAA No data
Right 1135671757 16:24381629-24381651 ACTTAGAGAACATCTCAGCAAGG No data
1135671754_1135671757 26 Left 1135671754 16:24381580-24381602 CCAAATTCCTTGTTGGGAAAAAG No data
Right 1135671757 16:24381629-24381651 ACTTAGAGAACATCTCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135671757 Original CRISPR ACTTAGAGAACATCTCAGCA AGG Intergenic
No off target data available for this crispr