ID: 1135683830

View in Genome Browser
Species Human (GRCh38)
Location 16:24481580-24481602
Sequence GTACCAGGTTTCCTGTAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135683830_1135683832 -6 Left 1135683830 16:24481580-24481602 CCATTCTACAGGAAACCTGGTAC No data
Right 1135683832 16:24481597-24481619 TGGTACTCATATAAATTAAGAGG No data
1135683830_1135683833 19 Left 1135683830 16:24481580-24481602 CCATTCTACAGGAAACCTGGTAC No data
Right 1135683833 16:24481622-24481644 TGTCTAGTGTCACAAAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135683830 Original CRISPR GTACCAGGTTTCCTGTAGAA TGG (reversed) Intergenic
No off target data available for this crispr