ID: 1135683831

View in Genome Browser
Species Human (GRCh38)
Location 16:24481595-24481617
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135683831_1135683835 25 Left 1135683831 16:24481595-24481617 CCTGGTACTCATATAAATTAAGA No data
Right 1135683835 16:24481643-24481665 GGATTTGCAACCAATCATCTTGG No data
1135683831_1135683833 4 Left 1135683831 16:24481595-24481617 CCTGGTACTCATATAAATTAAGA No data
Right 1135683833 16:24481622-24481644 TGTCTAGTGTCACAAAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135683831 Original CRISPR TCTTAATTTATATGAGTACC AGG (reversed) Intergenic