ID: 1135683833

View in Genome Browser
Species Human (GRCh38)
Location 16:24481622-24481644
Sequence TGTCTAGTGTCACAAAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135683830_1135683833 19 Left 1135683830 16:24481580-24481602 CCATTCTACAGGAAACCTGGTAC No data
Right 1135683833 16:24481622-24481644 TGTCTAGTGTCACAAAAGCCAGG No data
1135683828_1135683833 21 Left 1135683828 16:24481578-24481600 CCCCATTCTACAGGAAACCTGGT No data
Right 1135683833 16:24481622-24481644 TGTCTAGTGTCACAAAAGCCAGG No data
1135683831_1135683833 4 Left 1135683831 16:24481595-24481617 CCTGGTACTCATATAAATTAAGA No data
Right 1135683833 16:24481622-24481644 TGTCTAGTGTCACAAAAGCCAGG No data
1135683829_1135683833 20 Left 1135683829 16:24481579-24481601 CCCATTCTACAGGAAACCTGGTA No data
Right 1135683833 16:24481622-24481644 TGTCTAGTGTCACAAAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135683833 Original CRISPR TGTCTAGTGTCACAAAAGCC AGG Intergenic
No off target data available for this crispr