ID: 1135686189

View in Genome Browser
Species Human (GRCh38)
Location 16:24500099-24500121
Sequence AGAGCTTGTAGGGGTAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135686185_1135686189 29 Left 1135686185 16:24500047-24500069 CCTGATCTCTAAATTAAAAAAAA No data
Right 1135686189 16:24500099-24500121 AGAGCTTGTAGGGGTAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135686189 Original CRISPR AGAGCTTGTAGGGGTAAAGC TGG Intergenic
No off target data available for this crispr