ID: 1135687917

View in Genome Browser
Species Human (GRCh38)
Location 16:24513226-24513248
Sequence CTCACCAGGTCTGATTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135687917_1135687922 18 Left 1135687917 16:24513226-24513248 CCATGTCAATCAGACCTGGTGAG No data
Right 1135687922 16:24513267-24513289 TGAACATTCTGGTGTGCCACAGG No data
1135687917_1135687923 22 Left 1135687917 16:24513226-24513248 CCATGTCAATCAGACCTGGTGAG No data
Right 1135687923 16:24513271-24513293 CATTCTGGTGTGCCACAGGATGG No data
1135687917_1135687921 7 Left 1135687917 16:24513226-24513248 CCATGTCAATCAGACCTGGTGAG No data
Right 1135687921 16:24513256-24513278 TGGAAGATATCTGAACATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135687917 Original CRISPR CTCACCAGGTCTGATTGACA TGG (reversed) Intergenic
No off target data available for this crispr