ID: 1135687922

View in Genome Browser
Species Human (GRCh38)
Location 16:24513267-24513289
Sequence TGAACATTCTGGTGTGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135687920_1135687922 4 Left 1135687920 16:24513240-24513262 CCTGGTGAGCAGGAAGTGGAAGA No data
Right 1135687922 16:24513267-24513289 TGAACATTCTGGTGTGCCACAGG No data
1135687917_1135687922 18 Left 1135687917 16:24513226-24513248 CCATGTCAATCAGACCTGGTGAG No data
Right 1135687922 16:24513267-24513289 TGAACATTCTGGTGTGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135687922 Original CRISPR TGAACATTCTGGTGTGCCAC AGG Intergenic
No off target data available for this crispr