ID: 1135687923

View in Genome Browser
Species Human (GRCh38)
Location 16:24513271-24513293
Sequence CATTCTGGTGTGCCACAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135687920_1135687923 8 Left 1135687920 16:24513240-24513262 CCTGGTGAGCAGGAAGTGGAAGA No data
Right 1135687923 16:24513271-24513293 CATTCTGGTGTGCCACAGGATGG No data
1135687917_1135687923 22 Left 1135687917 16:24513226-24513248 CCATGTCAATCAGACCTGGTGAG No data
Right 1135687923 16:24513271-24513293 CATTCTGGTGTGCCACAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135687923 Original CRISPR CATTCTGGTGTGCCACAGGA TGG Intergenic
No off target data available for this crispr