ID: 1135691258

View in Genome Browser
Species Human (GRCh38)
Location 16:24539695-24539717
Sequence GCCCGCAAGCTGCTGGGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 286}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135691258_1135691265 10 Left 1135691258 16:24539695-24539717 CCGCTGCCCAGCAGCTTGCGGGC 0: 1
1: 0
2: 2
3: 22
4: 286
Right 1135691265 16:24539728-24539750 GGTTCCGGGCCTCAAGGCGACGG 0: 1
1: 0
2: 0
3: 0
4: 63
1135691258_1135691262 -5 Left 1135691258 16:24539695-24539717 CCGCTGCCCAGCAGCTTGCGGGC 0: 1
1: 0
2: 2
3: 22
4: 286
Right 1135691262 16:24539713-24539735 CGGGCGTGTTCTCGCGGTTCCGG 0: 1
1: 0
2: 0
3: 1
4: 20
1135691258_1135691263 -4 Left 1135691258 16:24539695-24539717 CCGCTGCCCAGCAGCTTGCGGGC 0: 1
1: 0
2: 2
3: 22
4: 286
Right 1135691263 16:24539714-24539736 GGGCGTGTTCTCGCGGTTCCGGG 0: 1
1: 0
2: 0
3: 0
4: 48
1135691258_1135691268 20 Left 1135691258 16:24539695-24539717 CCGCTGCCCAGCAGCTTGCGGGC 0: 1
1: 0
2: 2
3: 22
4: 286
Right 1135691268 16:24539738-24539760 CTCAAGGCGACGGAAACGAAAGG 0: 1
1: 0
2: 0
3: 3
4: 44
1135691258_1135691264 4 Left 1135691258 16:24539695-24539717 CCGCTGCCCAGCAGCTTGCGGGC 0: 1
1: 0
2: 2
3: 22
4: 286
Right 1135691264 16:24539722-24539744 TCTCGCGGTTCCGGGCCTCAAGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135691258 Original CRISPR GCCCGCAAGCTGCTGGGCAG CGG (reversed) Intronic
900156536 1:1205512-1205534 GCCCCCCAGCAGCTGGGCTGAGG + Intronic
900311476 1:2035514-2035536 GCCCCCCAGCTGGTGGGCTGTGG - Intergenic
900375724 1:2353749-2353771 GACAGCAGGGTGCTGGGCAGAGG - Intronic
901635933 1:10670114-10670136 GCCCCCGAGCTGCCTGGCAGTGG - Intronic
901844759 1:11974853-11974875 TCCCAGAGGCTGCTGGGCAGTGG - Exonic
902467553 1:16627348-16627370 GCCAGCAAGATGCTGGGCCGGGG + Intergenic
902507026 1:16945380-16945402 GCCAGCGAGATGCTGGGCTGGGG - Intronic
903009278 1:20318801-20318823 GCTAGCTAGCTGCTGGGCGGGGG - Intronic
904097734 1:27994645-27994667 CCCCGCAAGCTGAAGTGCAGTGG - Intronic
904946040 1:34199507-34199529 GCCCCCAAGCCGCTGGGCTAGGG + Intronic
904957340 1:34296103-34296125 GCACTCACGCTGCAGGGCAGAGG + Intergenic
905366060 1:37452192-37452214 GCCCGGAAGGTGCTGGGAATGGG + Intergenic
905366683 1:37455399-37455421 CCCTGCAGGCGGCTGGGCAGAGG - Intergenic
905954057 1:41977407-41977429 GCAAGCAAGCAGCTGGGGAGTGG - Intronic
906811729 1:48833974-48833996 GCCCCTAAGGTACTGGGCAGGGG - Intronic
910288825 1:85580918-85580940 GCCAACAAGCTGGTGTGCAGCGG - Exonic
910935045 1:92480629-92480651 ACCCGCCTGCTGCTGGGCGGCGG - Exonic
911072878 1:93846560-93846582 GACCGCACCCTTCTGGGCAGCGG + Intronic
912250084 1:108002360-108002382 TCACCCAAGCTGCTGTGCAGTGG + Intergenic
912812308 1:112803526-112803548 TCCCCCAAGCTGGAGGGCAGTGG + Intergenic
913252659 1:116924853-116924875 GCAGGCATGCTGCTGGGCTGGGG + Intronic
914313389 1:146487014-146487036 CCCCGAAAGCGACTGGGCAGGGG - Intergenic
914361351 1:146938767-146938789 GCAAGCAAGTTGCTGGGCGGCGG + Exonic
914491259 1:148151943-148151965 GCAAGCAAGTTGCTGGGCGGCGG - Exonic
914500961 1:148246367-148246389 CCCCGAAAGCGACTGGGCAGGGG + Intergenic
915652860 1:157331735-157331757 GCCTGGAAGCCCCTGGGCAGGGG + Intergenic
919786789 1:201263171-201263193 CCCCACCAGCTGCTGGGCTGTGG - Intergenic
920293218 1:204938828-204938850 GCCCTCAATCTTCTAGGCAGGGG - Intronic
921170644 1:212545160-212545182 TCCCACAAGCTGCAGTGCAGTGG - Intergenic
921444242 1:215226363-215226385 GTCCGCAAGCTGGAGCGCAGTGG + Intronic
922117263 1:222626154-222626176 GCGTGCAAGCTGCTGGGCTAGGG + Intronic
922725279 1:227920146-227920168 GCCCACAGGGTGCAGGGCAGGGG + Exonic
922858135 1:228792679-228792701 GCTTGCAAGTTGCTGGGCAGGGG + Intergenic
923234097 1:232015617-232015639 GACCGGAAGCTCCTGGGGAGTGG - Intronic
924432564 1:244009272-244009294 GCCCGCAGGCTGGAGTGCAGTGG - Intergenic
1062769221 10:86240-86262 GCCTGCAAGGGGCTGGGCTGAGG + Intergenic
1065325824 10:24550041-24550063 CCCCGCAAGCTGGAGTGCAGTGG + Intergenic
1069921459 10:71818164-71818186 GCCCTAGGGCTGCTGGGCAGGGG + Intronic
1070806130 10:79271809-79271831 GCCTGGAGCCTGCTGGGCAGAGG + Intronic
1071529439 10:86377513-86377535 GCCTGCACGCTGATGGGCGGTGG + Intergenic
1071957156 10:90771397-90771419 GCCTGCAACCTGGTGAGCAGTGG - Intronic
1073403285 10:103276360-103276382 GACCACAAGCTGCTGGAAAGGGG - Intergenic
1074134502 10:110615037-110615059 GCCCCCAAGCTGGAGGGCTGGGG + Intergenic
1075132018 10:119748395-119748417 GCCCACAACCTGGTGAGCAGGGG + Intronic
1076057971 10:127390993-127391015 GCCCACATGCGGCTGGGAAGCGG + Intronic
1076686581 10:132200883-132200905 GCCCACAGCCTTCTGGGCAGTGG - Exonic
1076724035 10:132405098-132405120 GCCCGCAGGAGGCTGGGCAGCGG + Exonic
1076797382 10:132804898-132804920 GCCCTCAGGCTGCAGGGGAGGGG + Intergenic
1076944710 10:133637992-133638014 GCCCGCAGAACGCTGGGCAGAGG + Intergenic
1077254201 11:1573174-1573196 GCTCCCAGGCTCCTGGGCAGGGG - Intergenic
1077343834 11:2037469-2037491 TCTCCCAAGCTCCTGGGCAGGGG - Intergenic
1077613597 11:3660000-3660022 GCCCTGCAGCTCCTGGGCAGCGG + Exonic
1077891156 11:6419071-6419093 GCCCGCGCGCTCCTGGGCGGGGG - Intronic
1078103092 11:8341361-8341383 GTCCGGAAGCTGCTGGGATGGGG - Intergenic
1081796776 11:45825997-45826019 GACAGAAAGCTGATGGGCAGTGG - Intergenic
1083813152 11:65116761-65116783 GCCCGCATCCTGCTGGGCGAGGG - Exonic
1083816438 11:65134826-65134848 CCCCGCGAGCAGCTGGGAAGGGG + Intergenic
1084219895 11:67671402-67671424 GCCCACCTGCTGCAGGGCAGGGG + Intronic
1084265847 11:68004721-68004743 GCCCCCATCCTGCTGGGCACTGG + Intronic
1084520089 11:69657600-69657622 AGCCCCAAGCTGCTGGGCTGAGG + Intronic
1087252974 11:95924113-95924135 GCCTGTAGGCTGCTGGGCAGCGG + Exonic
1088755435 11:112881732-112881754 TCGCGAAAGCTGCTGGGGAGGGG + Intergenic
1091295946 11:134474131-134474153 GCCTGGACTCTGCTGGGCAGTGG + Intergenic
1202826820 11_KI270721v1_random:92658-92680 TCTCCCAAGCTCCTGGGCAGGGG - Intergenic
1094164173 12:27425342-27425364 GCCCTCAAACCACTGGGCAGAGG + Intergenic
1094221621 12:28000050-28000072 GCCTGCATGCAGCTGGTCAGAGG - Intergenic
1096560332 12:52431433-52431455 CCAAGCAAGATGCTGGGCAGAGG + Intronic
1096609858 12:52794018-52794040 GCCCCCTGACTGCTGGGCAGTGG - Intronic
1096748314 12:53743047-53743069 GCCTGCAAGCACCTTGGCAGTGG - Intergenic
1098620957 12:72597626-72597648 GCACCCAAGCTGCAGTGCAGTGG - Intronic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1104101827 12:125619735-125619757 GACCACAGGCTGCTGGACAGGGG + Intronic
1104749755 12:131230871-131230893 TGACGCGAGCTGCTGGGCAGGGG - Intergenic
1104962752 12:132495930-132495952 GCCAGCAAGCCACTGGGCAGGGG - Intronic
1107184192 13:37497827-37497849 GCCCCCAAGCTGGAGTGCAGTGG - Intergenic
1113850711 13:113416068-113416090 GCTCAGAAGCTGCTGGGGAGGGG - Intergenic
1114217868 14:20670486-20670508 TCCCCCAAGCTGAAGGGCAGTGG - Intergenic
1115851640 14:37594605-37594627 TCCCGCTCGCTGCTGGGAAGAGG + Intronic
1117072544 14:52069385-52069407 GCCCGCAAGGTTTGGGGCAGCGG + Intergenic
1118760846 14:68879464-68879486 GCCCGCAAGCCCCAGGGCACTGG + Intronic
1119770720 14:77219305-77219327 GCCCAGAAGCTGCTGGGCGCTGG + Intronic
1122086840 14:99313501-99313523 GCCTGCAATGTGCTGGGCATTGG - Intergenic
1122491320 14:102117756-102117778 GCCCGCAACGTGGTGAGCAGTGG - Intronic
1122503762 14:102218875-102218897 TCCCGCACGCTGCTGAGCACAGG + Intronic
1122863018 14:104591079-104591101 GCCTGCAGTGTGCTGGGCAGGGG - Intronic
1202918084 14_KI270723v1_random:3328-3350 GCCCGCAGAACGCTGGGCAGAGG + Intergenic
1202926541 14_KI270724v1_random:31258-31280 GCCCGCAGAACGCTGGGCAGAGG - Intergenic
1123834803 15:24178292-24178314 TCCCCCAGGCTGCAGGGCAGTGG - Intergenic
1124663433 15:31569956-31569978 GCCTGCAAGCTGCGGTGCACTGG + Intronic
1131173155 15:90192381-90192403 GCCTGCATGCAGCTGGGCAGAGG + Intronic
1131476662 15:92745764-92745786 TCCCCCAGGCTGCTGTGCAGTGG - Intronic
1132458328 16:36486-36508 GCCTGCAAGGGGCTGGGCTGAGG + Intergenic
1132584926 16:701953-701975 GCCTGGGAGCTGCTGGGGAGAGG + Intronic
1132913289 16:2326946-2326968 GCCCCCAGGCTGGAGGGCAGTGG - Intronic
1135194854 16:20386138-20386160 CCCCTCACGTTGCTGGGCAGTGG + Intronic
1135651039 16:24206824-24206846 TCCAGCATGCTGCTCGGCAGAGG + Intronic
1135691258 16:24539695-24539717 GCCCGCAAGCTGCTGGGCAGCGG - Intronic
1136267770 16:29131215-29131237 GGCAGCCAACTGCTGGGCAGGGG - Intergenic
1136611793 16:31371073-31371095 GCCCGCGATCCGCTGGCCAGAGG - Exonic
1137004042 16:35255774-35255796 GCCCGCAAAACTCTGGGCAGAGG + Intergenic
1137013224 16:35344666-35344688 GCCCGCAGAACGCTGGGCAGAGG + Intergenic
1138508210 16:57489653-57489675 TCCCCCAAGCTGGTGTGCAGTGG + Intergenic
1138955532 16:61966496-61966518 GTCCGCAGGCTGGAGGGCAGTGG - Intronic
1139313259 16:66044827-66044849 GCCCGGAAGAGGCTGGGGAGGGG + Intergenic
1139955080 16:70689334-70689356 ACCCTCAAGCTGCTGGGCCCCGG - Intronic
1140371527 16:74416221-74416243 TCGCGCAGGCTGCTGTGCAGTGG - Intronic
1141373818 16:83511420-83511442 TCCCCCAGGCTGCTGTGCAGTGG - Intronic
1141731425 16:85825499-85825521 GCCCCCACGTGGCTGGGCAGGGG - Intergenic
1141880024 16:86851645-86851667 GACCCCAAGTGGCTGGGCAGGGG + Intergenic
1142071076 16:88091563-88091585 GGCAGCCAACTGCTGGGCAGGGG - Intronic
1142178908 16:88657762-88657784 GGCCGCCAGCTCCAGGGCAGTGG - Intronic
1142205081 16:88779079-88779101 GCCCCCAAGCTGGAGTGCAGTGG + Intronic
1142251129 16:88992570-88992592 GCCCGAGAGATACTGGGCAGGGG + Intergenic
1142255830 16:89013477-89013499 GGGCTGAAGCTGCTGGGCAGGGG + Intergenic
1142751999 17:1994517-1994539 GCTCGCAAGCTGGTGGGAAGGGG - Intronic
1142985379 17:3691925-3691947 TCCCACCAGCTCCTGGGCAGGGG + Intronic
1144340996 17:14310242-14310264 GCGCGGAAGGTGCTGGGGAGGGG - Intronic
1144732666 17:17537494-17537516 CCCTGCAGGCTGCTGGGCACGGG - Intronic
1147134806 17:38428579-38428601 GGCCGGTAGCTGCTGGGGAGCGG + Intronic
1147134884 17:38428834-38428856 GGCCCCCAGCGGCTGGGCAGCGG + Intronic
1147182308 17:38694052-38694074 GCCAGGAAGCTGCTGGAGAGTGG + Intergenic
1147383776 17:40070429-40070451 GCCCCCATGCTGAGGGGCAGAGG - Intronic
1148108729 17:45132724-45132746 GCCCCCATGCTGCGGGGCTGGGG + Intronic
1150549037 17:66192101-66192123 GCCCCCGGGCTGCTGGGCGGCGG - Intergenic
1151216639 17:72581629-72581651 GCACCCAAGCTACTGGCCAGAGG + Intergenic
1151746336 17:76013825-76013847 CCCCAGAAGCTGCTGGGGAGGGG - Intronic
1151768077 17:76142252-76142274 GCTCTCCAGCTCCTGGGCAGAGG - Intergenic
1151821959 17:76501395-76501417 GCCTGCGAGCGGCTGGGCGGTGG + Exonic
1151905079 17:77042573-77042595 GGCCTCAAGCTGGTGCGCAGAGG - Intergenic
1151967599 17:77439538-77439560 TCCTGCAAGCTGCTGGCCACAGG - Intronic
1152388959 17:79991783-79991805 GCCTGCCATCTGCTGGGCACCGG + Intronic
1152962294 18:87042-87064 GCCTGCAAGGGGCTGGGCTGAGG + Intergenic
1153703717 18:7723616-7723638 GCCTACAAGCTGGTGGGCAGAGG - Intronic
1157492737 18:48135947-48135969 GCCGGCAGGCGGGTGGGCAGCGG - Intronic
1158548643 18:58416848-58416870 GCTCGGCAGCTGCTGGGGAGGGG - Intergenic
1158648716 18:59268754-59268776 GCCCTCCAGCTGCAGGGCTGAGG + Exonic
1158988858 18:62848500-62848522 TCGCTCAAGCTGCTGTGCAGTGG + Intronic
1160705785 19:529672-529694 GCCCCCAGGGTGCCGGGCAGAGG + Intergenic
1160759581 19:776373-776395 TCCCCCAGGCTGCAGGGCAGTGG - Intergenic
1161678548 19:5667216-5667238 GCCCGCAAGTCGCTGGGATGTGG + Intronic
1161934297 19:7361950-7361972 GCCCCCAAGCTGGAGTGCAGTGG - Intronic
1161945917 19:7436684-7436706 GCCAGGATGCTGCTGGGCAAAGG + Intronic
1161986308 19:7656614-7656636 TCACCCAAGCTGCAGGGCAGTGG - Intergenic
1162128311 19:8511125-8511147 GCCCGGAAGCTGATGGGGGGCGG - Intronic
1162202368 19:9029889-9029911 TCCCCCAAGCTGGTGTGCAGTGG - Intergenic
1162312082 19:9913734-9913756 GAGCGCGAGCTGCGGGGCAGGGG + Intronic
1162483178 19:10941480-10941502 GCGCCCAAGCTGGAGGGCAGTGG + Intergenic
1162490017 19:10986389-10986411 GCCTACAAGATGCTGGCCAGGGG + Exonic
1163159092 19:15454224-15454246 GCTCGCAGGATGGTGGGCAGTGG + Exonic
1163498810 19:17663320-17663342 GCCTGCCATCTGCTGGGGAGTGG - Intronic
1163803989 19:19385380-19385402 GCCGGCAACTGGCTGGGCAGGGG - Intergenic
1164036587 19:21461181-21461203 TCCCACAAGCTGCAGTGCAGTGG + Intronic
1164936236 19:32216721-32216743 TCCCGCACGCTGGTGTGCAGTGG + Intergenic
1165959433 19:39522042-39522064 GCCCCCAGGCTGGAGGGCAGTGG + Intergenic
1166752734 19:45172425-45172447 ACCTGCTAGCTCCTGGGCAGAGG + Intronic
1167125518 19:47545762-47545784 GACCGCAGGCTGCTGGGGGGCGG + Exonic
1167791776 19:51687967-51687989 GCCCGCAAACTGCAGGGAGGGGG + Intergenic
1168536001 19:57171834-57171856 GCCTGCAACCTGCTGGGCGCAGG + Intergenic
1168670736 19:58239290-58239312 GGCTGCAATCTGGTGGGCAGAGG - Intronic
925342110 2:3145034-3145056 GTCCACTAGCTGCTGGGCACTGG - Intergenic
925552216 2:5088762-5088784 GCCCCCGAGATGCTGGGCACAGG - Intergenic
926053072 2:9757090-9757112 GCCAACAAGCTGCTGGGCCAGGG + Intergenic
926162349 2:10497964-10497986 GCCCGCCAGCTGTTTGGAAGAGG + Intergenic
926303285 2:11618887-11618909 CCCCGCAGGCTGCTGCTCAGCGG + Exonic
927207485 2:20619323-20619345 GCCCACACGGGGCTGGGCAGCGG + Intronic
930443183 2:51434860-51434882 GCCCTCAAGCTGGTGTGCAGTGG - Intergenic
930741237 2:54834880-54834902 TCCCTCTAGCTGCTGTGCAGAGG - Intronic
931259061 2:60600747-60600769 GTCTGCAGGCTGCTGAGCAGAGG - Intergenic
931369954 2:61653309-61653331 TCCCCCAAGCTGCAGTGCAGTGG + Intergenic
933120617 2:78532548-78532570 AACTGCAAGCTGGTGGGCAGTGG + Intergenic
933723284 2:85411579-85411601 GCCGGCTAGGTTCTGGGCAGAGG - Intronic
933793566 2:85902877-85902899 TCCCCCAGGCTGCAGGGCAGTGG + Intergenic
934681104 2:96284485-96284507 GACCTGAAGCTGCTGGGCAAAGG - Exonic
937263622 2:120602009-120602031 GCAGGGAGGCTGCTGGGCAGGGG - Intergenic
937349291 2:121150223-121150245 GCCCCCGAGCTTCTGTGCAGGGG + Intergenic
938934522 2:136116899-136116921 GCCCGCAAGCAGCGCTGCAGGGG + Intronic
938940792 2:136168005-136168027 GCCTGAAAGATGCTGGGCAGAGG + Intergenic
941043689 2:160649571-160649593 GCCCGCAACATGGTGGGCAAAGG - Intergenic
943767429 2:191678029-191678051 GCCCGCCTGGTGCTGGGGAGGGG - Intergenic
946339794 2:219059899-219059921 GCCGCCAACCTGCTGGGCTGTGG + Intronic
948748568 2:240113406-240113428 GCCCGGAGGCTGCTGGGCAAGGG + Intergenic
1169339358 20:4784388-4784410 GCCGGGAAGGTCCTGGGCAGGGG - Intronic
1171269619 20:23803731-23803753 TCCCCCAGGCTGCTGTGCAGTGG + Intergenic
1172567347 20:35940909-35940931 GCTCGGAAGCTGCTGGACAGAGG + Exonic
1173249786 20:41358383-41358405 GCCTGCAGGCAGCTGGGGAGAGG - Intronic
1173475576 20:43356773-43356795 GCCCAGAAGCTGGAGGGCAGAGG - Intergenic
1173792225 20:45834965-45834987 GCCCCCCACCTGATGGGCAGTGG + Exonic
1175311180 20:58012521-58012543 TACAGCAAGGTGCTGGGCAGGGG - Intergenic
1175826057 20:61937128-61937150 GCCAGCGCGGTGCTGGGCAGCGG - Exonic
1176139564 20:63539047-63539069 GCCCCCAGGCTGCTGTGCTGGGG + Intergenic
1176411854 21:6453530-6453552 ACCCCCAAGCAGGTGGGCAGAGG + Intergenic
1178468233 21:32868834-32868856 GCCTGCAGGCAGCTGGTCAGTGG + Intergenic
1179531336 21:42021753-42021775 GCCCGGACTTTGCTGGGCAGTGG + Intergenic
1179584219 21:42364836-42364858 CCATGGAAGCTGCTGGGCAGCGG - Intronic
1179687348 21:43061852-43061874 ACCCCCAAGCAGGTGGGCAGAGG + Intronic
1180122341 21:45762237-45762259 GGCCGCAAGGTGCTGGGCTGAGG - Intronic
1180676493 22:17590056-17590078 GCCAGTGAGCTGATGGGCAGGGG - Intronic
1182303476 22:29351961-29351983 GGCTGCAAGCTCCTGGGTAGAGG + Intronic
1182308228 22:29386266-29386288 GCCAGGAAGCTGCTGAGCTGGGG + Intronic
1182328058 22:29529331-29529353 GTCAGCAAGGAGCTGGGCAGAGG - Intronic
1182376954 22:29855665-29855687 GCCCGCCAGCTGCTGTGCCTGGG + Intergenic
1182472092 22:30554926-30554948 GCAGGCAAGCCGCTGGGCGGTGG + Exonic
1182618990 22:31608012-31608034 GCCCAGAAGGTGCTGGACAGGGG + Exonic
1183716672 22:39537297-39537319 TCCCCCAGGCTGCAGGGCAGTGG + Intergenic
1184291671 22:43500748-43500770 GCCCCCAGGCTGCAGGGTAGAGG + Intronic
1184512468 22:44941701-44941723 ACCCACTAGATGCTGGGCAGGGG + Intronic
1185077412 22:48690789-48690811 GCCCACAGCCTCCTGGGCAGAGG - Intronic
1185191274 22:49438082-49438104 GCCCGCAGGCTCCTGGTCAGAGG + Intronic
1185251457 22:49803916-49803938 GCACACACGCTGATGGGCAGTGG - Intronic
949969906 3:9396411-9396433 GGCCGCACCCTTCTGGGCAGGGG - Intergenic
950091875 3:10301462-10301484 ACCCACAAGCCTCTGGGCAGTGG - Intronic
950505764 3:13393561-13393583 GCCTGCCAGCTGCTGGCCACTGG + Intronic
950786476 3:15440681-15440703 GTGAGCATGCTGCTGGGCAGTGG - Exonic
954456988 3:50604992-50605014 GCCTGCCAGGTGCTGGGCATGGG - Intergenic
961075151 3:123975532-123975554 GCCAGCAACCTGCAGGGCAGGGG + Exonic
961308544 3:125976990-125977012 GCCAGCAACCTGCAGGGCAGGGG - Exonic
961602299 3:128071438-128071460 GTACCCAAGCTGGTGGGCAGGGG + Exonic
962448651 3:135492766-135492788 GCCGGCCAGCTCCTGGGCTGTGG - Intergenic
963609173 3:147443474-147443496 GCCTGCAATGTACTGGGCAGAGG - Intronic
968948456 4:3677835-3677857 GCTCGGGAGCTGCTGTGCAGTGG + Intergenic
971257915 4:25030843-25030865 GCCAGCATGCTGCTCGGCTGCGG - Exonic
971488005 4:27181067-27181089 TCCCCCAAGCTGGAGGGCAGTGG + Intergenic
974158420 4:58104095-58104117 GCCCACAAGATGCTTGGCACAGG + Intergenic
976281986 4:83334805-83334827 CCCCGCCAGCTGCCGCGCAGCGG + Exonic
976414574 4:84757893-84757915 GTTGGAAAGCTGCTGGGCAGTGG + Intronic
978734185 4:112066555-112066577 GCCTGCAATCAGCTGGGAAGTGG + Intergenic
982287762 4:153753153-153753175 GCCCGCATGCTGGTGGGCTTCGG - Intronic
984964312 4:185127654-185127676 GCGCGCGAGCCTCTGGGCAGTGG + Intergenic
985096764 4:186420543-186420565 TCCCTCCTGCTGCTGGGCAGGGG - Intergenic
987296236 5:16554362-16554384 GCTCCCAAGCTGCTGTGGAGAGG - Intronic
992473301 5:77077887-77077909 GCCCGCACGCTGGGGAGCAGGGG + Exonic
992487662 5:77211133-77211155 GCCCGCACCGAGCTGGGCAGCGG + Exonic
996916653 5:128720315-128720337 CCACCCAAGCTGCTGGACAGAGG - Intronic
997362659 5:133305191-133305213 GCCTGCAAGCCGCTGGAGAGGGG - Intronic
1003524346 6:6885698-6885720 ACCCGCAGGCTCCTGGGCAGAGG + Intergenic
1003865060 6:10355388-10355410 CTCGGCAGGCTGCTGGGCAGGGG - Intergenic
1005459052 6:26050340-26050362 TCACCCAGGCTGCTGGGCAGTGG - Intergenic
1005812390 6:29527709-29527731 GCTCACAGGCTGCTGGGCACAGG - Intergenic
1005849984 6:29813950-29813972 GCCCTCTTGCTGCAGGGCAGGGG + Intergenic
1005855011 6:29853765-29853787 GCCCTCTTGCTGCAGGGCAGGGG + Intergenic
1005923085 6:30417897-30417919 GCCCTCTTGCTGCAGGGCAGGGG - Intergenic
1006060238 6:31413667-31413689 GCCCTCTTGCTGCAGGGCAGGGG - Intronic
1006072680 6:31508537-31508559 GCCCTCTTGCTGCAGGGCAGGGG - Intronic
1006125460 6:31835012-31835034 GCCCGCCGGCTGCTGCGCAAAGG - Exonic
1006937879 6:37731092-37731114 TCCCCCAAGCTGGAGGGCAGTGG + Intergenic
1007019644 6:38506473-38506495 TCTCTCATGCTGCTGGGCAGTGG - Intronic
1008535565 6:52504168-52504190 GCCAGCAAGCTGGGAGGCAGGGG + Intronic
1009905716 6:69867677-69867699 GCCGGCAAGAGGGTGGGCAGAGG + Intronic
1013073034 6:106746212-106746234 GACCCCAAGCTGATGGGAAGAGG - Intergenic
1014581296 6:123140760-123140782 GCGCCCAAGCTGCAGTGCAGTGG + Intergenic
1017652636 6:156597356-156597378 GCCGGCAAGCTGGGGGACAGGGG - Intergenic
1017807432 6:157957932-157957954 GCACCCAAGCTGCAGTGCAGTGG + Intergenic
1018034070 6:159866832-159866854 GCCCCCAGGAAGCTGGGCAGAGG - Intergenic
1019608259 7:1921070-1921092 GGCTGCCATCTGCTGGGCAGGGG - Intronic
1019669553 7:2270104-2270126 CCCAGGGAGCTGCTGGGCAGAGG + Intronic
1019774683 7:2905642-2905664 CCCCTCAAGCTCCTGGGAAGTGG + Intergenic
1021240904 7:18199888-18199910 TCCCCCAAGCTGGAGGGCAGTGG - Intronic
1021873714 7:25029198-25029220 GCCCTCTAGCTGCTGGGCTGAGG + Intergenic
1025903502 7:65766359-65766381 TCCCCCAAGCTGGAGGGCAGTGG + Intergenic
1026935842 7:74254761-74254783 GTCCGGGCGCTGCTGGGCAGCGG + Intergenic
1027237299 7:76305590-76305612 TCCCCCAAGCTGGAGGGCAGTGG - Intergenic
1028444416 7:90904034-90904056 GCCAGCAGGCTGCAGGGCTGTGG - Intronic
1029419934 7:100467216-100467238 GCCCTCAAGGCACTGGGCAGGGG - Intronic
1032078804 7:128848595-128848617 GCCAGCAAGGTGCGGGCCAGCGG + Exonic
1033159168 7:138981475-138981497 GCCCGCGCGTTGCCGGGCAGCGG - Intergenic
1034172122 7:149070838-149070860 GCCCACCAGCTGCTGCACAGCGG - Exonic
1034480357 7:151315051-151315073 GCCCCCAAGCTGGAGCGCAGTGG - Intergenic
1037786295 8:21905335-21905357 TCCCCCAGGCTGCTGTGCAGTGG + Intergenic
1040460360 8:47641872-47641894 ACCTGCCAGCAGCTGGGCAGAGG + Intronic
1041154314 8:54968871-54968893 TCCCGCAGGCTGCAGTGCAGTGG - Intergenic
1041919860 8:63169060-63169082 GCCCGCAAGCTACGGGGCCAGGG - Intronic
1042785058 8:72537246-72537268 GCCGGCTAGCTGCGGGGCGGGGG + Intergenic
1043122401 8:76343897-76343919 TCCCACCAGCTGCAGGGCAGAGG + Intergenic
1044873876 8:96645428-96645450 GCCCGCGGGCGGCTGGGCCGAGG + Intronic
1045385635 8:101668623-101668645 GTCCCCAAGCTGCTGGTCCGGGG - Exonic
1049360300 8:142209607-142209629 GCCGGGAAGTTCCTGGGCAGTGG + Intergenic
1049437681 8:142595242-142595264 GACCACAAGCTCCAGGGCAGGGG + Intergenic
1049614486 8:143570168-143570190 GCTGGCCAGGTGCTGGGCAGGGG - Intronic
1049707520 8:144049771-144049793 CACCTCAAGCTGCTGGACAGCGG + Intergenic
1051287358 9:15510684-15510706 CCCCGCAACCTGCTGCCCAGCGG + Intronic
1053313790 9:37035686-37035708 GCCCGCAGGCTGCAGGGAGGAGG - Intergenic
1054328696 9:63730940-63730962 CCCCACAAGGGGCTGGGCAGTGG - Intergenic
1056752015 9:89358604-89358626 CACCGTGAGCTGCTGGGCAGTGG + Intronic
1057293204 9:93820141-93820163 GCCCCCAAGCTGGTGGGGAGAGG + Intergenic
1057296183 9:93843603-93843625 GCCCCCAGGCTGCAGTGCAGTGG - Intergenic
1057355036 9:94325522-94325544 GCCCCCAACCACCTGGGCAGAGG + Exonic
1057652715 9:96932112-96932134 GCCCCCAACCACCTGGGCAGAGG - Exonic
1058630612 9:106982718-106982740 GCCCGCAAAATGCTGGGCAGAGG - Intronic
1059343251 9:113611605-113611627 CCCAGCAGGCTGCTGGGCAGAGG + Intergenic
1059733022 9:117075315-117075337 GATCACAGGCTGCTGGGCAGAGG - Intronic
1059739629 9:117137082-117137104 GCCCATAAGATGCTGGGGAGTGG + Intronic
1060449705 9:123725635-123725657 GCCCTCCTGCTGCTGGGCAGAGG - Intronic
1060787094 9:126459508-126459530 GCCCGCGTGCTGCTGGGGTGAGG - Intronic
1061872545 9:133528527-133528549 GCCTGCCATCTGCTGGGCAGAGG - Intronic
1062059235 9:134486116-134486138 GCCCGGCTGCTCCTGGGCAGGGG + Intergenic
1062179633 9:135184336-135184358 GCCCGGAGGCTGCTGGGCAGTGG - Intergenic
1062376709 9:136265086-136265108 GCCCCCATGCTGTGGGGCAGAGG - Intergenic
1062426871 9:136510180-136510202 GTCCTCAAGCTCCAGGGCAGGGG + Intronic
1062442466 9:136576948-136576970 TCCCCCAAGCTGCAGTGCAGTGG + Intergenic
1062478926 9:136742603-136742625 CCCCGCAAGTTGCAGGGCAAAGG - Intronic
1062612501 9:137381453-137381475 CACCACAGGCTGCTGGGCAGTGG + Intronic
1062735848 9:138137075-138137097 GCCTGCAAGGGGCTGGGCTGAGG - Intergenic
1203441839 Un_GL000219v1:16209-16231 GCCCGCAGAACGCTGGGCAGAGG + Intergenic
1203512647 Un_KI270741v1:135118-135140 GCCCGCAGAACGCTGGGCAGAGG + Intergenic
1186813938 X:13217078-13217100 GCCCAGAAGATGCTGGGAAGTGG + Intergenic
1189682202 X:43528192-43528214 GCCTGCAAGCTGCTCTGCATAGG - Intergenic
1192159721 X:68775432-68775454 GCCCGTCAGCTGCTAGGCAATGG - Intergenic
1195915082 X:109927986-109928008 GGCCCCAGGCTGCTGGGGAGGGG - Intergenic
1197527339 X:127578544-127578566 GCATGCTAGCTGCTGGGGAGGGG - Intergenic
1197733154 X:129828942-129828964 GCTGGCAAGCTGCTGTGTAGTGG - Intronic
1200418045 Y:2934184-2934206 GCCCACAGGCTGCAGTGCAGTGG + Intergenic