ID: 1135693898 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:24569808-24569830 |
| Sequence | GGACCCCAAGAAAAAGTAGA TGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 191 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 13, 4: 177} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1135693895_1135693898 | 9 | Left | 1135693895 | 16:24569776-24569798 | CCAAAAAAGAAAATATTGTAAAA | 0: 1 1: 1 2: 17 3: 276 4: 2394 |
||
| Right | 1135693898 | 16:24569808-24569830 | GGACCCCAAGAAAAAGTAGATGG | 0: 1 1: 0 2: 0 3: 13 4: 177 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1135693898 | Original CRISPR | GGACCCCAAGAAAAAGTAGA TGG | Exonic | ||