ID: 1135693898

View in Genome Browser
Species Human (GRCh38)
Location 16:24569808-24569830
Sequence GGACCCCAAGAAAAAGTAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135693895_1135693898 9 Left 1135693895 16:24569776-24569798 CCAAAAAAGAAAATATTGTAAAA 0: 1
1: 1
2: 17
3: 276
4: 2394
Right 1135693898 16:24569808-24569830 GGACCCCAAGAAAAAGTAGATGG 0: 1
1: 0
2: 0
3: 13
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135693898 Original CRISPR GGACCCCAAGAAAAAGTAGA TGG Exonic