ID: 1135698036

View in Genome Browser
Species Human (GRCh38)
Location 16:24607416-24607438
Sequence CGCCACCACCATGGCACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135698036_1135698043 24 Left 1135698036 16:24607416-24607438 CCTGCAGTGCCATGGTGGTGGCG No data
Right 1135698043 16:24607463-24607485 CACTCCCTTCTTTCTTTCTGAGG No data
1135698036_1135698044 25 Left 1135698036 16:24607416-24607438 CCTGCAGTGCCATGGTGGTGGCG No data
Right 1135698044 16:24607464-24607486 ACTCCCTTCTTTCTTTCTGAGGG No data
1135698036_1135698040 1 Left 1135698036 16:24607416-24607438 CCTGCAGTGCCATGGTGGTGGCG No data
Right 1135698040 16:24607440-24607462 CCGCACTGCTGCTTCTGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135698036 Original CRISPR CGCCACCACCATGGCACTGC AGG (reversed) Intergenic
No off target data available for this crispr