ID: 1135712144

View in Genome Browser
Species Human (GRCh38)
Location 16:24726963-24726985
Sequence CAGCCCAGGAGGGCTCAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135712139_1135712144 1 Left 1135712139 16:24726939-24726961 CCTCATATAAAACACTCTACATT No data
Right 1135712144 16:24726963-24726985 CAGCCCAGGAGGGCTCAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135712144 Original CRISPR CAGCCCAGGAGGGCTCAGAT GGG Intergenic
No off target data available for this crispr