ID: 1135715287

View in Genome Browser
Species Human (GRCh38)
Location 16:24759581-24759603
Sequence CTGTGGCTCCCTCTATCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 405}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135715287_1135715290 -10 Left 1135715287 16:24759581-24759603 CCTGGAGATAGAGGGAGCCACAG 0: 1
1: 0
2: 2
3: 53
4: 405
Right 1135715290 16:24759594-24759616 GGAGCCACAGGGCTTCATGCTGG 0: 1
1: 0
2: 2
3: 36
4: 266
1135715287_1135715296 28 Left 1135715287 16:24759581-24759603 CCTGGAGATAGAGGGAGCCACAG 0: 1
1: 0
2: 2
3: 53
4: 405
Right 1135715296 16:24759632-24759654 TGTTTGGATTTGGAATGTCATGG 0: 1
1: 0
2: 1
3: 25
4: 318
1135715287_1135715292 5 Left 1135715287 16:24759581-24759603 CCTGGAGATAGAGGGAGCCACAG 0: 1
1: 0
2: 2
3: 53
4: 405
Right 1135715292 16:24759609-24759631 CATGCTGGTTAAGCCAGCAAAGG 0: 1
1: 0
2: 1
3: 11
4: 141
1135715287_1135715293 12 Left 1135715287 16:24759581-24759603 CCTGGAGATAGAGGGAGCCACAG 0: 1
1: 0
2: 2
3: 53
4: 405
Right 1135715293 16:24759616-24759638 GTTAAGCCAGCAAAGGTGTTTGG 0: 1
1: 0
2: 0
3: 10
4: 117
1135715287_1135715295 18 Left 1135715287 16:24759581-24759603 CCTGGAGATAGAGGGAGCCACAG 0: 1
1: 0
2: 2
3: 53
4: 405
Right 1135715295 16:24759622-24759644 CCAGCAAAGGTGTTTGGATTTGG 0: 1
1: 0
2: 0
3: 14
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135715287 Original CRISPR CTGTGGCTCCCTCTATCTCC AGG (reversed) Intronic
900173536 1:1281893-1281915 CTGTGCCTCCCTGTGTCCCCGGG - Intronic
900555900 1:3280353-3280375 GTGTGGCTCCCTGTCTCACCTGG + Intronic
901627191 1:10631043-10631065 CTCTGGCTCCCTGTCTCCCCTGG + Intergenic
903133494 1:21294034-21294056 TTATGGCTCCCTCAGTCTCCAGG - Intronic
903260457 1:22129082-22129104 CTGTGCATCCCTGTATCTCAGGG + Intronic
903576383 1:24342093-24342115 CAGCGGCCCCCTCTGTCTCCAGG + Exonic
904355021 1:29933355-29933377 CTGTGGCTCCCTCCTTCCCTCGG - Intergenic
905523115 1:38615314-38615336 CTGTGGCTTCCTATATGGCCTGG - Intergenic
906469964 1:46120545-46120567 CGGAGGCTCCCTCTGTCGCCAGG - Intronic
910574452 1:88744444-88744466 CTGCGTCTCCCTCTGTCACCAGG + Intronic
912506547 1:110160780-110160802 TTTGGGCCCCCTCTATCTCCCGG - Intronic
912689636 1:111794679-111794701 CTGTGGCTTCCTCCTTGTCCGGG + Intronic
913061619 1:115213749-115213771 CTGTCTCTCACTCTGTCTCCAGG + Intergenic
913971115 1:143419251-143419273 CTGAGTCTCCCTCTGTCGCCAGG + Intergenic
914065493 1:144244863-144244885 CTGAGTCTCCCTCTGTCGCCAGG + Intergenic
914113658 1:144721491-144721513 CTGAGTCTCCCTCTGTCGCCAGG - Intergenic
914764987 1:150629743-150629765 TTGTGGCTCACTCTCTTTCCAGG - Intergenic
914887499 1:151597483-151597505 CTTTGGCTCTCTCTGCCTCCTGG + Intergenic
915120709 1:153628299-153628321 CAGAGGCGCCCTCTGTCTCCTGG - Intronic
915556114 1:156661674-156661696 CTGTGTCTGCCTCTGCCTCCAGG + Intergenic
916822284 1:168411215-168411237 CAGTGTCTCACTCTGTCTCCTGG + Intergenic
918011023 1:180586714-180586736 CCTTGACTCCCTCCATCTCCTGG + Intergenic
919764741 1:201119518-201119540 CTGTGGGTCCCTAGGTCTCCTGG + Intronic
919832830 1:201554092-201554114 CTGGAGCTGCCTTTATCTCCTGG + Intergenic
920295675 1:204954702-204954724 CTCTTGCTCCCTCCTTCTCCAGG + Intronic
920439840 1:205972572-205972594 CTGAGGCTTCCTCTCCCTCCCGG - Intergenic
920786775 1:209050031-209050053 CCTTGGCTCCCTGTCTCTCCTGG - Intergenic
921274610 1:213506646-213506668 CTGTCTCTTTCTCTATCTCCTGG - Intergenic
921322281 1:213953670-213953692 CTCTGTCTCTCTCTCTCTCCAGG + Intergenic
922038874 1:221876286-221876308 CTGAGTCTCCCTCTGTCACCAGG + Intergenic
923238854 1:232061146-232061168 CTGTTGCTCCCTCTCTCCCCAGG + Intergenic
923917204 1:238522545-238522567 CAGTGTCTCACTCTGTCTCCAGG + Intergenic
924321971 1:242859622-242859644 CTGAGTCTCACTCTGTCTCCCGG - Intergenic
1062887520 10:1029405-1029427 CGGAGTCTCCCTCTGTCTCCAGG + Intergenic
1062997621 10:1881746-1881768 CTGTTGCTCCCTCCAGCTCTTGG - Intergenic
1063153138 10:3354941-3354963 CTCTGGCTCCCTCTGCCTCCAGG + Intergenic
1063184027 10:3634205-3634227 GTAAGTCTCCCTCTATCTCCAGG - Intergenic
1063426121 10:5951424-5951446 CAGTGGCTCCCTCTTCCCCCTGG + Intronic
1063802114 10:9591972-9591994 CTCTGTCTCTCTCTCTCTCCTGG - Intergenic
1064079182 10:12294493-12294515 CTGAGTCTCGCTCTATCGCCAGG - Intergenic
1064500133 10:15962351-15962373 CAGAGTCTCCCTCTATCGCCAGG - Intergenic
1064877982 10:20017072-20017094 CTCTGCCTCTCTCTTTCTCCAGG - Intronic
1065085791 10:22174458-22174480 CTGTGTCTCCCTCTGTTGCCAGG - Intergenic
1066782223 10:38964168-38964190 CTGTGGCTCTCTCTACATCCTGG + Intergenic
1066951183 10:42118924-42118946 CTGTGGCTCTCTCTACATCCTGG - Intergenic
1066954896 10:42156461-42156483 CTGTGGCTCTCTCTACATCCCGG - Intergenic
1067324068 10:45249637-45249659 CGGAGTCTCCCTCTTTCTCCAGG + Intergenic
1067570699 10:47368937-47368959 CTGTCGCTTCCTCTCTCTGCAGG - Exonic
1067617641 10:47767432-47767454 CTGTGGCTCCCTCCTGCCCCTGG + Intergenic
1068976307 10:63013689-63013711 CTCTGTCTCCCTCTGTCTCCCGG - Intergenic
1069949911 10:72011599-72011621 CAGCTGCTCCCTCTGTCTCCGGG - Exonic
1070164273 10:73886174-73886196 CTGTGGCCCGCACCATCTCCAGG - Intergenic
1072220064 10:93319219-93319241 CTGAGGCTGCCACTGTCTCCTGG + Intronic
1073072838 10:100805742-100805764 CTGTGGATGCCTCTATGCCCTGG - Intronic
1075134796 10:119774234-119774256 CTGAGTCTCCCTCTGTCGCCAGG - Intronic
1076986167 11:237173-237195 CTCCGTCTCCCTCTATCGCCGGG - Intronic
1077282799 11:1753174-1753196 CTGGGGCTCCCTTCATCTCCAGG - Exonic
1078912596 11:15746898-15746920 CTGTTGCTCCCTCTCTTGCCAGG + Intergenic
1079935878 11:26615340-26615362 GTGTGGTTCCCTCTCTCCCCTGG + Intronic
1083209843 11:61176426-61176448 CTTTGGCTCCCTCCCTATCCGGG + Intergenic
1083764682 11:64836176-64836198 CTGTGGCCGCCTCTCTCTCCTGG + Exonic
1084179156 11:67437981-67438003 CTGTGACATCCTCTGTCTCCAGG + Exonic
1085659054 11:78345814-78345836 CGGTGTCTCCCACTATCTTCTGG - Intronic
1089841788 11:121424979-121425001 CTGTGTCTCCCTCTGTCACCCGG - Intergenic
1090214343 11:124947653-124947675 CTGTGCCTCCCACTAGCACCTGG - Intergenic
1090814986 11:130285027-130285049 CTGTGGCTCCTTCTATCTTGCGG + Intronic
1091937396 12:4444762-4444784 CAGCGGCTCCCTCTGTCCCCAGG - Intronic
1092891806 12:12975849-12975871 CTCTGGCTCCCTCTACTGCCCGG + Intronic
1092897076 12:13022333-13022355 CTGGGACTCCATATATCTCCTGG + Intergenic
1094372560 12:29753890-29753912 CTGAGTCTCCCTCTGTCACCAGG + Intronic
1094820473 12:34220250-34220272 CTGCGGCAGCCTCCATCTCCCGG + Intergenic
1095858875 12:46892361-46892383 CTTTGGCTCTCTCTTTCTCTGGG - Intergenic
1097002147 12:55885957-55885979 CAGAGTCTCCCTCTGTCTCCTGG - Intergenic
1097791569 12:63821086-63821108 CTGAGTCTCCCTCTGTCACCCGG - Intergenic
1098037341 12:66317724-66317746 ATGTAGCACCTTCTATCTCCAGG - Intronic
1098067938 12:66639597-66639619 CTGTGGTTCTTTCTAACTCCTGG - Intronic
1098101099 12:67018112-67018134 CCCTGGCTCCCTGTATCTCAGGG + Intergenic
1098527991 12:71508726-71508748 CTGAGTCTCACTCTATCACCAGG - Intronic
1098774122 12:74589501-74589523 CAGAGTCTCGCTCTATCTCCCGG - Intergenic
1101232635 12:102756802-102756824 CTCTGGCTCCCACTGCCTCCAGG - Intergenic
1101285429 12:103306994-103307016 TTGTGGCTTCTTCCATCTCCTGG - Intronic
1101346493 12:103890764-103890786 CTGTGTTGCCCTCCATCTCCAGG - Intergenic
1101499817 12:105292584-105292606 CAGGGCCTCTCTCTATCTCCCGG - Intronic
1102566580 12:113801225-113801247 CTGTGGCTCCCCCTGTGACCAGG + Intergenic
1103550105 12:121730623-121730645 CTGTGTCTCGCTCTGTCGCCAGG - Intronic
1103928940 12:124438838-124438860 CTCTGTCTCCCTCTGTCTCTGGG - Intronic
1103928958 12:124438954-124438976 CTCTGTCTCCCTCTGTCTCTGGG - Intronic
1103928965 12:124439000-124439022 CTCTGTCTCCCTCTGTCTCAGGG - Intronic
1103928972 12:124439046-124439068 CTCTGTCTCCCTCTGTCTCAGGG - Intronic
1103928978 12:124439090-124439112 CTGTCTCTCCCTCTGTCTCTGGG - Intronic
1103928995 12:124439198-124439220 CTCTGTCTCCCTCTGTCTCTGGG - Intronic
1103928999 12:124439222-124439244 CTCTGTCTCCCTCTGTCTCTGGG - Intronic
1103929012 12:124439314-124439336 CTGTCTCTCCCTCTGTCTCTGGG - Intronic
1103929016 12:124439340-124439362 CTCTGTCTCCCTCTCTCTCTGGG - Intronic
1103929021 12:124439364-124439386 CTCTGTCTCCCTCTGTCTCCGGG - Intronic
1103929025 12:124439388-124439410 CTCTGTCTCCCTCTGTCTCTGGG - Intronic
1104208281 12:126661641-126661663 CTCTTTCTCCCTCTCTCTCCTGG - Intergenic
1104255184 12:127129937-127129959 CTGTGTCTCACTCTGTCGCCAGG - Intergenic
1104573725 12:129947983-129948005 CTGTAGCTCCCTTAATCCCCAGG + Intergenic
1104656993 12:130580899-130580921 CTGGGTCTCACTCTGTCTCCCGG - Intronic
1104748006 12:131221903-131221925 GCGAGGCTCCCTCTATGTCCTGG - Intergenic
1105384920 13:19920786-19920808 CTGTGTCTCGCTCTGTCTCCAGG + Intergenic
1105520022 13:21123386-21123408 CTCTGTCTCCCTCTGTCACCCGG + Intergenic
1105704946 13:22962859-22962881 CCCTGGCTCCCTCTCTCTCCAGG - Intergenic
1105857905 13:24388043-24388065 CCCTAGCTCCCTCTCTCTCCAGG - Intergenic
1106550570 13:30767465-30767487 CTGTGGTTTCCTCCACCTCCTGG + Intergenic
1106906533 13:34415408-34415430 CTCTGGTTTCTTCTATCTCCTGG - Intergenic
1108075983 13:46680212-46680234 CTGTGGCTCCTTCTGTCTCCAGG - Intronic
1108099272 13:46936659-46936681 CTGGGACTCCCTCTATCCCAGGG - Intergenic
1108381931 13:49862906-49862928 CTGAGTCTCGCTCTATCGCCAGG + Intergenic
1109207917 13:59501856-59501878 CTGAGTCTCCCTCTGTCACCAGG - Intergenic
1109835949 13:67857810-67857832 ATGTGGCTGCCTCTGTCGCCAGG - Intergenic
1110440939 13:75524430-75524452 CGGAGTCTCCCTCTGTCTCCCGG - Intergenic
1110609585 13:77474230-77474252 CGGAGTCTCCCTCTATCGCCGGG + Intergenic
1110855872 13:80296200-80296222 CTGTGACTCCCTCTACCTAGAGG - Intergenic
1111221939 13:85216266-85216288 CAGAGTCTCCCTCTGTCTCCAGG - Intergenic
1111438458 13:88243951-88243973 TTGTGGCTCACTGGATCTCCAGG - Intergenic
1111896029 13:94142852-94142874 CTGAGGCTCTCTCTGTCACCAGG + Intronic
1112373789 13:98819804-98819826 CTGTTGATGTCTCTATCTCCTGG + Intronic
1112726479 13:102310590-102310612 CCTTGCCTCCCTCTATCTCCTGG - Intronic
1112818253 13:103299343-103299365 CTCTGGCTCTCTCTACTTCCTGG + Intergenic
1114533134 14:23407700-23407722 CTGGGGCTGCCTCCATCCCCGGG - Intronic
1115357058 14:32460253-32460275 CTCTGTCTCCCTCTCTATCCTGG - Intronic
1115707751 14:36015467-36015489 CTCTGGCTCACTCTCTCTCTGGG + Intergenic
1116378887 14:44239798-44239820 CTTTCTCTCCCTCTCTCTCCTGG + Intergenic
1116811447 14:49543566-49543588 CTCTCTCTCCCTCTTTCTCCTGG + Intergenic
1117206324 14:53447538-53447560 CTGTGTCTCGCTCTGTCACCAGG + Intergenic
1118974653 14:70666220-70666242 CTGTGGCTCCCTGTGGCTCAGGG + Intronic
1119084737 14:71729555-71729577 CTGTGGCTCTCTCTTCCCCCAGG + Intronic
1119526111 14:75323709-75323731 CTGTTCCTCACTCTATCCCCAGG + Intergenic
1120203925 14:81567582-81567604 CATTGGCTCACTCTATCTCCTGG + Intergenic
1120264485 14:82231996-82232018 CTCTGGCTTGCTCTGTCTCCTGG + Intergenic
1121025181 14:90610411-90610433 CTGTGTCTCCCTCTCTCTTTGGG - Intronic
1121463473 14:94099531-94099553 CTGTGCCTCCTTCTAGCTTCTGG - Intronic
1121575937 14:94987853-94987875 TTGTGGTTCCCTCTTTCTCTAGG + Intergenic
1121995870 14:98602501-98602523 CTGTGGCTTCCTCTATTCCATGG - Intergenic
1122121836 14:99558593-99558615 CAGAGTCTCGCTCTATCTCCAGG - Intronic
1122490890 14:102115222-102115244 TTTTGGCTCACTCTACCTCCCGG - Intronic
1123021183 14:105398638-105398660 CTGTCCCTCCTTCTGTCTCCGGG + Intronic
1123108845 14:105855863-105855885 CTTCGGCTCCCTCTCTGTCCCGG + Intergenic
1124358414 15:29016229-29016251 CTGAGTCTCACTCTGTCTCCAGG - Intronic
1125572942 15:40734845-40734867 CTGGGAATCCATCTATCTCCAGG - Intergenic
1125724567 15:41861725-41861747 CTGTGCCTGCCTGTAGCTCCAGG + Exonic
1127282837 15:57506403-57506425 GTGAGGCTCCTTTTATCTCCTGG + Intronic
1127797012 15:62447443-62447465 CTGAGGCTCAGTCTTTCTCCTGG + Intronic
1128387374 15:67159675-67159697 CTGTAACTCCCTCTGTCCCCAGG + Intronic
1128412258 15:67411280-67411302 CTCTGGCTGCCTCTGACTCCTGG - Intronic
1128859551 15:71055045-71055067 CGGAGTCTCCCTCTATCGCCAGG + Intergenic
1129497201 15:75995352-75995374 CTCTTGCTCCCTCTCTCACCAGG - Intronic
1130013508 15:80170399-80170421 CTGGAGCTCCCTGTCTCTCCTGG + Intronic
1130213367 15:81946375-81946397 CTGTGGCTCACTCTCACCCCAGG - Intergenic
1130226464 15:82062305-82062327 CGGGGGCTCCATCTATCTCCTGG - Intergenic
1130509734 15:84579430-84579452 CTTTGGCTCTCTCTTTCTCTGGG + Intergenic
1131178957 15:90227566-90227588 CGCTGGCTCCCTCGATGTCCTGG - Exonic
1131245052 15:90784356-90784378 CTGAGTCTCACTCTATCTCCAGG + Intronic
1131477238 15:92750581-92750603 CTGATGCTCTCTCTTTCTCCAGG + Intronic
1132980674 16:2737392-2737414 CTGGGCCTCCCTCTAACTCTCGG + Intergenic
1135161554 16:20101214-20101236 CTGTGGATCCTTCTATCCCATGG - Intergenic
1135563774 16:23496276-23496298 CAGAGTCTCCCTCTGTCTCCTGG - Intronic
1135577520 16:23597231-23597253 CTCTGGCTCTCTCTTTCTCTGGG + Intergenic
1135715287 16:24759581-24759603 CTGTGGCTCCCTCTATCTCCAGG - Intronic
1136608551 16:31352701-31352723 CTTTGTCTCCCCCTTTCTCCAGG + Intergenic
1136939342 16:34507017-34507039 CTGTGGCTCTCTCTACATCCTGG - Intergenic
1136960479 16:34841544-34841566 CTGTGGCTCTCTCTACATCCTGG + Intergenic
1137084939 16:36108196-36108218 CTGTGGCTCTCTCTACATCCCGG - Intergenic
1137219562 16:46434506-46434528 CTGTGGCTCTCTCTAATTCCCGG - Intergenic
1137320542 16:47376935-47376957 CAGAGTCTCCCTCTGTCTCCAGG - Intronic
1138449883 16:57087458-57087480 CTGAGGGTCTCTCTCTCTCCAGG - Intergenic
1139151442 16:64386880-64386902 CTGTGTCTCACTCTGTCGCCAGG + Intergenic
1139208719 16:65055093-65055115 CCATGACTCCCTGTATCTCCAGG - Intronic
1140034348 16:71361103-71361125 CTCTGGCTCCCTCCTGCTCCGGG + Intronic
1140061447 16:71573652-71573674 CTGTGTCTCACTCTGTCACCCGG + Intronic
1140105131 16:71952758-71952780 CTGTGGCAGCCTCAAACTCCCGG - Intronic
1140718161 16:77745527-77745549 CGGTGTCTCGCTCTATCACCAGG - Intergenic
1140941811 16:79728587-79728609 CTGAGGCTCTCTCTGCCTCCAGG + Intergenic
1141300790 16:82813756-82813778 CTGAGGCTGCCTCCATCTACAGG + Intronic
1141722956 16:85767020-85767042 CTATGGCACCCTCAACCTCCCGG + Intergenic
1141739864 16:85883999-85884021 CTGTGCCTCCCGCTGTCCCCTGG + Intergenic
1141887240 16:86900876-86900898 CTGTGTCTCCATCTATGTCAAGG - Intergenic
1142013406 16:87729403-87729425 CAGTGGCTGTCTGTATCTCCGGG - Intronic
1142260300 16:89039662-89039684 CTGTGGCCACCCCTCTCTCCTGG - Intergenic
1143100418 17:4501523-4501545 CTGTGCCTCCCTCCCTCTCCTGG + Intronic
1143121527 17:4610650-4610672 CAGGGTCTCACTCTATCTCCAGG - Intergenic
1143929426 17:10406177-10406199 TTGTGACTCTCTCTTTCTCCAGG - Exonic
1144066667 17:11630405-11630427 CAGAGTCTCCCTCTATCGCCAGG - Intronic
1144516470 17:15920693-15920715 CGGAGTCTCCCTCTATCACCAGG - Intergenic
1144628803 17:16859157-16859179 CTGTGGGTCCCTCAACTTCCAGG - Intergenic
1144631886 17:16877775-16877797 ATGTGGCTCCATCTCTCTTCTGG - Intergenic
1144652599 17:17016935-17016957 CTGTGGGTCCCTCAACTTCCAGG + Intergenic
1145326665 17:21836309-21836331 CTGTGGCTCTCTCTACATCCCGG + Intergenic
1145689637 17:26725479-26725501 CTGTGGCTCTCTCTACATCCCGG + Intergenic
1145693502 17:26767753-26767775 TTGTGGCTCTCTCTACATCCCGG + Intergenic
1146520378 17:33521485-33521507 ATGTGGCTACTTCTGTCTCCAGG - Intronic
1147050410 17:37790137-37790159 CTGAGGCTGCCTCTAGTTCCAGG - Intergenic
1147945251 17:44077097-44077119 CTTTCTCTCCTTCTATCTCCAGG - Exonic
1148480363 17:47956021-47956043 CTGTGGCTCCCTTTATGCCAAGG - Intronic
1149714477 17:58774876-58774898 CTGAGTCTTCCTCTGTCTCCAGG + Intronic
1150153525 17:62830915-62830937 CAGAGTCTCGCTCTATCTCCAGG + Intergenic
1151294663 17:73175998-73176020 CTGTGTCTCCCTCTGTGTCCAGG - Intergenic
1152104995 17:78323666-78323688 CTCTGACTCCCTCTGACTCCTGG + Intergenic
1152451475 17:80383943-80383965 CTGTGGCTCCCTCCCTCTTTCGG + Intronic
1152460860 17:80441671-80441693 CCTTGGCTCCCTCCCTCTCCGGG + Intergenic
1152593221 17:81223622-81223644 CTGTGACTCCCCCTCTCTCCGGG + Intergenic
1203190851 17_KI270729v1_random:186906-186928 TTGTGGCTCTCTCTACATCCCGG + Intergenic
1153700092 18:7683990-7684012 CTGTGGCTCCCTCCCTCTTCAGG + Intronic
1153727858 18:7976141-7976163 CGGAGTCTCCCTCTGTCTCCCGG - Intronic
1153825063 18:8867488-8867510 CCGTTCCTCCCTCTAGCTCCTGG - Intergenic
1155504623 18:26521117-26521139 CTGAGGTTCCCCCCATCTCCAGG - Intronic
1156326645 18:36079647-36079669 TTATGGCTGCCTCTATCACCAGG - Intergenic
1157020542 18:43775932-43775954 GTGTGGCTCCCTGTTTCTCTTGG - Intergenic
1157948702 18:52010193-52010215 TTGTGGCTACCTCTTTCTCTTGG + Intergenic
1158763741 18:60422391-60422413 CTGAGTCTCACTCTATCGCCAGG + Intergenic
1161611686 19:5246657-5246679 CTCAGGCTCCCTCTGTCTCCTGG - Intronic
1164030131 19:21396440-21396462 CTCTGCCTCCCTCCACCTCCCGG + Intergenic
1164671580 19:30074994-30075016 CTGTGGTTCCATCTATCCCAGGG + Intergenic
1165471559 19:36007367-36007389 CTGTGGCACAGTCCATCTCCGGG + Intronic
1165733893 19:38163829-38163851 CTGTGGCTCCATCTTACTCCAGG - Intronic
1165775245 19:38400534-38400556 CTGTGGCTCCGTCTCACTCAGGG - Intergenic
1165781624 19:38437960-38437982 CTGGGTCTCACTCTGTCTCCTGG - Intronic
1165956745 19:39505854-39505876 CTGTGGCTCCATCTCACTCAGGG - Intronic
1166007296 19:39916380-39916402 CTGTGGCTTCCTCTCACTCAGGG + Intronic
1166408837 19:42542866-42542888 CTGTGGCTCCCACCATCTGTGGG - Intronic
1166523867 19:43498990-43499012 CTGAGGCTCCCCATATCCCCAGG - Intronic
1166656139 19:44613602-44613624 CTGCTTCTCCCTCCATCTCCCGG + Intergenic
1166811510 19:45517307-45517329 CTGTGTCTGCCTCTTCCTCCAGG + Intronic
1166826207 19:45610813-45610835 CAGAGTCTCCCTCTATCGCCCGG - Intronic
1167315619 19:48761322-48761344 CTCTGTCTCCCTCTCTCTCTGGG - Intergenic
1167413206 19:49356948-49356970 CTCTGTCTCCCTCTGTCTCTGGG + Intronic
1167467458 19:49657897-49657919 CTGTGTCTGCCCCTCTCTCCGGG - Intronic
1167485109 19:49758197-49758219 CTCTGTCTCCCTCTCTCTCTGGG + Intronic
1167679963 19:50913008-50913030 CTGTGTCTCTCTGTCTCTCCTGG + Intergenic
1167740612 19:51322935-51322957 CTCTGTCTCCCTCTGTCTCTGGG + Intronic
1167740668 19:51323240-51323262 CTGTGTCTCTCTCTCTCTCTGGG + Intronic
1167782302 19:51606820-51606842 CTGTAGCTGCCTTGATCTCCAGG - Intergenic
1202669080 1_KI270709v1_random:33345-33367 CTGTGGCTCTCTCTACATCCCGG + Intergenic
925302281 2:2825888-2825910 CTGTGGCTGCCCCTGCCTCCTGG - Intergenic
927028112 2:19091070-19091092 TTGTGGCCCCCTCTCTCTTCTGG - Intergenic
927567687 2:24127685-24127707 CTGAGTCTCACTCTATCACCCGG + Intronic
928132403 2:28662118-28662140 CTGCTGCTCCCTCCATCTCTGGG + Intergenic
928287842 2:30008919-30008941 CTGTGGCTCCCACTCCCCCCAGG + Intergenic
929600371 2:43200776-43200798 TCGTGGCTCCCTCAACCTCCTGG + Intergenic
929780532 2:44954209-44954231 CGGAGTCTCCCTCTGTCTCCAGG - Intergenic
930999298 2:57761523-57761545 CTTTGTGTCCCTCTGTCTCCAGG - Intergenic
931367373 2:61630565-61630587 CAGAGTCTCCCTCTGTCTCCAGG + Intergenic
932850393 2:75178921-75178943 CTCTATCTCCCTCTTTCTCCTGG + Intronic
933123054 2:78567275-78567297 CTGTGGCTAACTCTAACTTCAGG - Intergenic
933849365 2:86353126-86353148 CTGTGGCTTCTTCTGTTTCCTGG + Intergenic
934175811 2:89580188-89580210 CTGAGTCTCCCTCTGTCGCCAGG + Intergenic
934286123 2:91654551-91654573 CTGAGTCTCCCTCTGTCGCCAGG + Intergenic
934330873 2:92066999-92067021 CTGTGGCTCTCTCTACATCCCGG + Intergenic
936026453 2:109034524-109034546 CTGTGCCTCCCTCTGCCTGCTGG - Intergenic
937118023 2:119422987-119423009 CTGGGGCACCATCTGTCTCCTGG + Intergenic
937870398 2:126782113-126782135 CTTTGGGTGGCTCTATCTCCAGG + Intergenic
937912059 2:127080609-127080631 CTGTGGCTGCCTCTGCCGCCTGG - Intronic
938301896 2:130221140-130221162 TTGTGTCTCCCTCTGTCGCCAGG + Intergenic
938516684 2:132015869-132015891 CTGTGGCTCTCTCTACATCCCGG - Intergenic
938731279 2:134149936-134149958 CTCTGGCTCCCTCTCTCACTGGG - Intronic
940669313 2:156648569-156648591 CTGTAGATCCCCCTATCTGCAGG - Intergenic
941068909 2:160933797-160933819 CTGTGGCTCCCGCAGCCTCCAGG - Intergenic
943509817 2:188810527-188810549 CAGTGTCTCGCTCTGTCTCCAGG - Intergenic
944995172 2:205285651-205285673 CTGTCGCCCACTCTGTCTCCAGG + Intronic
947240316 2:227987445-227987467 CTCTTGCTCACTGTATCTCCAGG + Intronic
947636971 2:231685093-231685115 CTGTGGCTCCCACTGACACCAGG - Intergenic
949007186 2:241656336-241656358 CTGCTGCTCCCTCTGTCTCCAGG + Intronic
1168794767 20:604175-604197 CTGTGCCTCTCTCTAGGTCCAGG + Exonic
1170431157 20:16278174-16278196 CTGTGGCCCCCTGTCTCTCTCGG - Intronic
1171177195 20:23061410-23061432 CTGAGGCTCCATCTAGCTCTGGG + Intergenic
1172049775 20:32108342-32108364 CTGGGCCTCCCTCTCTCTCCAGG + Intergenic
1172764083 20:37341813-37341835 CCGTGGCTCCCACCACCTCCAGG + Intergenic
1172984235 20:38970017-38970039 CTGTGTCTCTTTCTTTCTCCTGG + Intronic
1173364109 20:42369585-42369607 CTCTGGCCCCCACTATCTCTGGG - Intronic
1173819744 20:46012405-46012427 CTCAGGCTCCCTCTCCCTCCAGG + Exonic
1174663298 20:52234411-52234433 GTGTGGCTCCCTCATTCTCCTGG - Intergenic
1175336883 20:58202253-58202275 CTCTGCCTCCCTCTACCTCCTGG - Intergenic
1175498239 20:59430148-59430170 CTGAGTCTCACTCTGTCTCCAGG + Intergenic
1175576900 20:60067195-60067217 CTGTGGCTCCCACCACCTGCAGG + Intronic
1175847857 20:62068001-62068023 CTGCGGCTCCCACTTTCCCCAGG - Intergenic
1176142139 20:63549417-63549439 CAGTGGCAGCCTCGATCTCCTGG + Intronic
1178349929 21:31865494-31865516 CTGTAGCAGCCTCTATCTCCTGG - Intergenic
1179078184 21:38143710-38143732 CTGAGGCTTCCTCTCTCTCAAGG + Intronic
1180221221 21:46359512-46359534 CAGTGTCTCACTCTATCGCCAGG + Intronic
1181304262 22:21905794-21905816 CTATTGCAACCTCTATCTCCTGG + Intergenic
1182155913 22:28072817-28072839 GTGTGTCCCACTCTATCTCCTGG - Intronic
1182593109 22:31397488-31397510 CTGAGTCTCCCTCTGTCGCCAGG + Intergenic
1182760828 22:32721174-32721196 CTTCGGCTCCTTTTATCTCCTGG + Intronic
1183201119 22:36386780-36386802 CTGCGGCACCCTCATTCTCCAGG - Intronic
1183307476 22:37090296-37090318 CTGTGGCTCCCTATGGCTGCAGG - Intronic
1184263861 22:43336124-43336146 CTGTGCCTCACTCAATCTTCAGG + Intronic
1184506130 22:44904375-44904397 CTCTGGCTTCATCTATCTTCTGG + Intronic
1184536574 22:45091666-45091688 CTGCGGATCCCTCCAGCTCCGGG + Intergenic
1185062381 22:48613808-48613830 ATGTGGCCCCCTCGAGCTCCTGG + Intronic
1185113954 22:48920570-48920592 CTGTCTCTCTCTCTTTCTCCTGG - Intergenic
1203325563 22_KI270738v1_random:12006-12028 CTGTGGCTCTCTCTACATCCCGG - Intergenic
949871945 3:8596559-8596581 CTGTGGGCCCTTTTATCTCCAGG + Intergenic
950712062 3:14819857-14819879 CTGTGGCTGTCTCTGCCTCCTGG - Exonic
951756737 3:26098903-26098925 CTGGGGTTCCCTCCATCTCTTGG + Intergenic
951792679 3:26503851-26503873 CTCTTTCTCCCTCTCTCTCCTGG - Intergenic
951884832 3:27514121-27514143 CTTTTCCTCCCTCTAGCTCCTGG + Intergenic
952011804 3:28908297-28908319 CTGTGGATCCATCCATCTGCAGG + Intergenic
952646150 3:35661721-35661743 CTGTGCCTCATTCTCTCTCCAGG - Intronic
952902840 3:38121228-38121250 CTGTGCCCTCCTCTATCTCCTGG - Intronic
953682783 3:45052096-45052118 CTGTGGCCTCCTCCTTCTCCAGG + Intergenic
954594659 3:51814238-51814260 CTGAGTCTCCCTCTGTCTCTGGG + Intergenic
954722963 3:52581661-52581683 CGGAGTCTCCCTCTGTCTCCAGG + Intronic
955258346 3:57358393-57358415 CTGTCTCTTCCTCTACCTCCGGG - Intronic
956163633 3:66380284-66380306 CAGTGGCACCCTCTGTTTCCCGG + Exonic
958675288 3:97261969-97261991 CTGTGGCTCTCCCTAGGTCCAGG - Intronic
958678618 3:97296762-97296784 CTTTGGCTCTCTTTATCTCAGGG + Intronic
959864197 3:111247209-111247231 GTGGGGCTCACTCTCTCTCCTGG + Intronic
960632165 3:119743190-119743212 CAGTGGCGCCCTCTGCCTCCTGG + Intronic
961867477 3:129964213-129964235 CTGTGGCTCCCACTGTTTCCTGG - Intergenic
964699924 3:159554624-159554646 CCGTGGCTCCAGCTTTCTCCAGG + Intronic
966582432 3:181582814-181582836 CGGTGTCTCCCTCTGTCGCCAGG - Intergenic
967137182 3:186522300-186522322 CTGAGCCTCGCTCTGTCTCCAGG + Intergenic
968084863 3:195869747-195869769 CTGGGGCCTCCTCCATCTCCCGG - Intronic
969600212 4:8171668-8171690 CGGTCTCTCCCTCTCTCTCCTGG - Intergenic
969612878 4:8236882-8236904 CTGGGGCTCCCTCTCTCTAGAGG - Intronic
971107587 4:23543524-23543546 CTGAGTCTTGCTCTATCTCCCGG - Intergenic
972802327 4:42490075-42490097 CTGTGGCTCCCTCCCTTGCCTGG - Intronic
973338588 4:48981493-48981515 CAGTGGCTCCCTCCGCCTCCTGG - Intergenic
973812309 4:54583442-54583464 ATATAGCTCTCTCTATCTCCAGG - Intergenic
974071946 4:57131900-57131922 CTGTGGCTCCCTAAATCTCGAGG - Intergenic
976470028 4:85417912-85417934 CGGAGCCTCGCTCTATCTCCAGG + Intergenic
976640808 4:87335946-87335968 CGGAGTCTCCCTCTGTCTCCGGG + Intergenic
976848509 4:89517524-89517546 ATGTGGCTTCCCCCATCTCCAGG - Intergenic
977434201 4:96972482-96972504 CTGTGGATCCCACTCTCTACAGG + Intergenic
977556849 4:98495505-98495527 CGGAGGCTCTCTCTGTCTCCCGG - Intronic
978220355 4:106265504-106265526 CTCTGGATCTCTCTCTCTCCTGG - Intronic
978431776 4:108640278-108640300 CTGTGTCTCACTCTGTCGCCAGG - Intergenic
979621345 4:122801720-122801742 CGGTGTCTCCCTCTGTCGCCAGG - Intergenic
981075688 4:140589071-140589093 CTTTGGCTCTCTCTTTCTCTTGG + Intergenic
981315498 4:143336555-143336577 CTGCGGCTCCCTCTGTGACCCGG + Intergenic
981865514 4:149413371-149413393 CTGAGGTTCCCATTATCTCCTGG - Intergenic
981916989 4:150045182-150045204 CTGTGCCTCCCTCTTGCTCCAGG + Intergenic
981973853 4:150699231-150699253 CTCTGTCTCCCTCTTTCCCCAGG - Intronic
982520292 4:156408179-156408201 CTGAGTCTCACTCTGTCTCCAGG + Intergenic
982567562 4:157005295-157005317 CTCTGGCTCCGTTTTTCTCCAGG - Intergenic
986001405 5:3633684-3633706 CTGTGGCTCTCTCTGGCTACAGG + Intergenic
987440931 5:17955672-17955694 CTGTTGTTCCCTCTCTCACCAGG + Intergenic
987604295 5:20112686-20112708 CGGAGTCTCCCTCTATCGCCAGG - Intronic
987649611 5:20724066-20724088 CTGTGGATCATTCAATCTCCAGG - Intergenic
987785052 5:22488820-22488842 CTCTTGCACCCTCTATCTACTGG + Intronic
988745954 5:34137467-34137489 CTGTGGATCATTCAATCTCCAGG + Intergenic
990373131 5:55141362-55141384 CTCTGGCTTTCTCTTTCTCCAGG + Intronic
990463210 5:56048309-56048331 CTGCGGCTCCCTCTCTCACAAGG + Intergenic
991118466 5:62982377-62982399 TTCTGGCTCCCTTTTTCTCCTGG + Intergenic
994687262 5:102970829-102970851 CTGAGTCTCACTCTGTCTCCCGG + Intronic
995246750 5:109944114-109944136 CTGTGGCTCCCTCTCTCTCTTGG + Intergenic
995565793 5:113432108-113432130 CGGAGTCTCGCTCTATCTCCAGG - Intronic
998001997 5:138632853-138632875 CTGAGTCTCGCTCTATCACCCGG + Intronic
998611951 5:143699019-143699041 CTGTGGATACCTCTATCCACTGG + Intergenic
998928454 5:147154175-147154197 CTGTGGCTCTTGCAATCTCCTGG - Intergenic
1001154033 5:169257569-169257591 CGGTGTCTCCCTCTGTCACCCGG + Intronic
1002278262 5:178116693-178116715 CGGTGGCTACCTCTAGCTCAGGG + Intronic
1002444482 5:179280659-179280681 CAGTGTCTTCCTCTCTCTCCGGG + Intronic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1002620301 5:180483483-180483505 CTGTGGCCCCCTCCATCTCTGGG + Intergenic
1003513954 6:6803291-6803313 CTGTGACTCCCTTTAATTCCTGG - Intergenic
1003601961 6:7525973-7525995 CTTTGGCTCCCACTATCCACAGG - Intergenic
1004051153 6:12080961-12080983 CTGCAGCTCCCTCTATCTCTGGG + Intronic
1004133071 6:12939702-12939724 CTCTGGCCCCCCCTAGCTCCTGG - Intronic
1004275535 6:14232331-14232353 GTGTGGCTGCCTAAATCTCCAGG - Intergenic
1004638376 6:17490308-17490330 CTGTGGCTATCTCTTTCTGCAGG + Intronic
1005217454 6:23547864-23547886 CTGGGACTCCCTCTTTGTCCAGG - Intergenic
1005544110 6:26845686-26845708 CTGTGGATCATTCAATCTCCAGG + Intergenic
1006631504 6:35433424-35433446 CAGTGTCTCCCTCTATGCCCAGG - Intergenic
1006638060 6:35474450-35474472 CTGTGGGTCCCTCAACTTCCTGG + Exonic
1007483151 6:42163162-42163184 CTGTGGCTACCTGTACCGCCGGG + Exonic
1008326127 6:50184273-50184295 CTGTGTCTCTCTCTGTCTCCTGG - Intergenic
1008364051 6:50655094-50655116 CTGTTGCTCCCTCTCTTGCCAGG + Intergenic
1009014897 6:57887370-57887392 CTGTGGATCATTCAATCTCCAGG + Intergenic
1010523257 6:76867613-76867635 CTCTGTCTCTCTCTCTCTCCTGG + Intergenic
1011228689 6:85135993-85136015 CTGGGGCTCCCTCTACCCCTAGG + Intergenic
1012177270 6:96103571-96103593 TTCTTGCTCCCTCTATCTTCTGG + Intronic
1013711406 6:112904288-112904310 CTGTGGCTCCTTTGTTCTCCAGG + Intergenic
1014125912 6:117776873-117776895 CTGTGCCTCCCTCTTTAACCTGG + Intergenic
1015800604 6:137058377-137058399 CCGTGTCTCTCTCTCTCTCCTGG - Intergenic
1016329827 6:142944957-142944979 CAGTGACTCCCTTTACCTCCCGG - Intronic
1017658993 6:156655734-156655756 CTGTGGCTCTCTTTCTCTCCAGG - Intergenic
1018312669 6:162526766-162526788 CTGTGTTTTCCTCTGTCTCCAGG - Intronic
1018438369 6:163783656-163783678 CTGAGTCTCACTCTGTCTCCAGG - Intergenic
1018440245 6:163805910-163805932 CTGTCCCTCCCTCTATCCCTAGG - Intergenic
1019216977 6:170450278-170450300 CTGTTCCTCCCTCTTTCTGCAGG + Intergenic
1019441272 7:1048501-1048523 CTCAGGCCCCCTCTGTCTCCAGG + Intronic
1019570221 7:1707959-1707981 CTGAGGCTCCCTCAGCCTCCAGG + Intronic
1020890737 7:13875139-13875161 ATGTTGCTCTCTCTATCTACTGG - Intergenic
1021055035 7:16036391-16036413 CTGAGTCTCACTCTGTCTCCAGG - Intergenic
1022687846 7:32613243-32613265 TTCTGGCTCCCTCTACCTCCTGG - Intergenic
1023365804 7:39461996-39462018 CTGTGGCTGCCTTTATCCCAAGG - Intronic
1024485216 7:49910032-49910054 CTGTAGCTGCTTCAATCTCCTGG - Intronic
1024807092 7:53155298-53155320 CTGTGGCTCTCTCTACATCCTGG - Intergenic
1024849591 7:53695798-53695820 CTCTGGCTCCTTCTATCAACTGG + Intergenic
1024856956 7:53793940-53793962 CTGTGGCTCCTGGCATCTCCAGG - Intergenic
1024948460 7:54834516-54834538 CTGTGGCTCCCTGTCCTTCCTGG - Intergenic
1025319593 7:58080892-58080914 CTGTGGCTCTCTCTACATCCCGG + Intergenic
1025478004 7:60951362-60951384 CTGTGGCTCTCTCTACATCCCGG + Intergenic
1025554121 7:62282582-62282604 CTGTGGCCCTCTCTACATCCCGG - Intergenic
1025560660 7:62370692-62370714 CTGTGGCCCTCTCTACATCCCGG + Intergenic
1026234613 7:68515834-68515856 CTGTCCCTCCCTCCAGCTCCTGG - Intergenic
1026742982 7:72990464-72990486 CTGTGGCTCCCTGTCCCACCTGG + Intergenic
1026919058 7:74141630-74141652 CAGTGGCGCCCTCTGCCTCCCGG - Intergenic
1027029097 7:74875168-74875190 CTGTGGCTCCCTGTCCCACCTGG + Intergenic
1027100753 7:75374614-75374636 CTGTGGCTCCCTGTCCCACCTGG - Intergenic
1027185873 7:75970312-75970334 CAGGGTCTCCCTCTGTCTCCCGG + Intronic
1028816463 7:95151975-95151997 CTGTGTCTCACTCTGTCACCAGG + Intronic
1031447492 7:121872905-121872927 CAGCGGATCCCTCTAACTCCAGG + Intergenic
1032074604 7:128830430-128830452 CTCTGGCTCTCTCTCCCTCCAGG - Exonic
1033547543 7:142415241-142415263 CTGTGTGTCCCTTTATATCCTGG + Intergenic
1033573449 7:142656757-142656779 CTGTGGGGCCTTTTATCTCCTGG + Intergenic
1033810077 7:145001988-145002010 CTTTGGCTCCCTATGTCTTCGGG + Intergenic
1034950168 7:155291511-155291533 CTGTGGGGCCCTCTTCCTCCCGG + Intergenic
1035208215 7:157308687-157308709 CTGTGTCTCGCTCTGTCGCCAGG - Intergenic
1036034182 8:5001383-5001405 CTGTGGCACCCACAATGTCCGGG - Intergenic
1036452672 8:8882362-8882384 CTGAGTCTCGCTCTGTCTCCAGG - Intronic
1037766695 8:21776543-21776565 CTGCTGCAACCTCTATCTCCTGG + Intronic
1037915925 8:22773515-22773537 CTGTGGCTCTCACTGTCTCCTGG + Intronic
1038726971 8:30090284-30090306 CTGTGGCACCATCTGTCTTCTGG - Intergenic
1038833711 8:31094368-31094390 CAGGGTCTCCCTCTGTCTCCCGG + Intronic
1041660713 8:60398520-60398542 CTGTGGCAACCTCCACCTCCTGG + Intergenic
1042239602 8:66649482-66649504 CAGGGTCTCACTCTATCTCCTGG - Intronic
1043619986 8:82178149-82178171 CTGAGGCATCCTCTATCTACAGG - Intergenic
1045734102 8:105275158-105275180 ATGGGGCCCCCTCCATCTCCAGG - Intronic
1049402541 8:142436012-142436034 CTTTGACCCCCTCTGTCTCCTGG - Intergenic
1049973562 9:841791-841813 CTCTGGCCCCCTCTCTCGCCTGG - Exonic
1050230868 9:3525426-3525448 CTGTGGCTCCCTCTCCCGCTCGG + Intronic
1050396460 9:5203211-5203233 CTGTGCCTGCTTCTATCTCTGGG + Intergenic
1053391645 9:37740484-37740506 CAGTGGCTTCCTCTGTCTCCTGG + Exonic
1053444069 9:38137972-38137994 CTATGGCTCCCCCTGTCTCTAGG - Intergenic
1053945487 9:43305068-43305090 CTGTGGCTCTCTCTACAACCCGG + Intergenic
1054765865 9:69041905-69041927 CCATGTCTCCCTCTAACTCCAGG - Intronic
1054777682 9:69137746-69137768 CTGTGGGTCCCCAGATCTCCTGG + Intronic
1056486628 9:87064753-87064775 CTTTGTCTCTCTCTTTCTCCTGG - Intergenic
1056529108 9:87471187-87471209 CTGTTGGACCCTTTATCTCCTGG + Intergenic
1056814606 9:89792216-89792238 CTGTAGCTCCCTCCAGGTCCTGG - Intergenic
1056933940 9:90901355-90901377 CTCTGTCTCTCTCTCTCTCCAGG + Intergenic
1057602797 9:96473194-96473216 CTGTGGCTCCATCTGCCTACTGG + Intronic
1059251254 9:112889861-112889883 GTGGGGCACCCTCCATCTCCTGG - Exonic
1060173681 9:121481654-121481676 CAGAGTCTCACTCTATCTCCAGG - Intergenic
1060625343 9:125107381-125107403 CAGTGTCTCCCTCTGTCGCCAGG - Intronic
1061014498 9:127974068-127974090 CTGTGCCCCCATCCATCTCCCGG + Intronic
1061453307 9:130680598-130680620 CGGAGTCTCCCTCTGTCTCCAGG - Intronic
1061729631 9:132603814-132603836 CTGTGGTTCCCGCTGTCTGCAGG + Intronic
1062035435 9:134380620-134380642 CTGTGGCTGCCTCTGTGGCCAGG + Intronic
1062466064 9:136682202-136682224 CTGAGGCTCCCTCCCTCCCCCGG + Intronic
1203588622 Un_KI270747v1:33646-33668 CTGTGGCTCTCTCTACAACCCGG + Intergenic
1185662976 X:1741659-1741681 CTGAGTCTCCCTCTGTCACCAGG - Intergenic
1186138500 X:6545916-6545938 TTGTGACTCCCTCTCTTTCCAGG - Intergenic
1187344399 X:18449818-18449840 CGGAGGCTCACTCTGTCTCCAGG + Intronic
1187392210 X:18893610-18893632 CTGTGGCTTGGTCTTTCTCCAGG + Exonic
1190023804 X:46903831-46903853 CTGGGGCTCCCCCTAGCTCTTGG - Intergenic
1190939952 X:55030471-55030493 CTTTGACTCCCTCTACCTGCTGG - Intronic
1191103658 X:56759229-56759251 GGGTGGCTCCCACTTTCTCCTGG + Intergenic
1194005294 X:88484143-88484165 CTCTGCCTCCCTCTGCCTCCCGG - Intergenic
1195007891 X:100704676-100704698 CTGTGTCTCCAACTATTTCCTGG - Intronic
1196752953 X:119133692-119133714 CTGTGTCTCGCTCTGTCGCCAGG + Intronic
1196884320 X:120228534-120228556 CTCTGGCTCTCTCTTTCTCTGGG - Intergenic
1197568789 X:128122645-128122667 CTGTGGCCCTAACTATCTCCAGG - Intergenic
1199438661 X:147843528-147843550 CAGGGTCTCCCTCTTTCTCCAGG + Intergenic
1199770145 X:150969945-150969967 CTGAGTCTCACTCTGTCTCCAGG - Intergenic
1201246064 Y:12004921-12004943 CAGTGTCTGCCTCCATCTCCAGG + Intergenic
1201416128 Y:13751250-13751272 CTGTGTCTCGCTCTATCGCCAGG - Intergenic