ID: 1135717002

View in Genome Browser
Species Human (GRCh38)
Location 16:24779998-24780020
Sequence TGACCACTTAGACCCCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135717001_1135717002 -8 Left 1135717001 16:24779983-24780005 CCTCTTTTTTGCAGTTGACCACT 0: 1
1: 0
2: 1
3: 13
4: 188
Right 1135717002 16:24779998-24780020 TGACCACTTAGACCCCAAAGAGG 0: 1
1: 0
2: 2
3: 14
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135717002 Original CRISPR TGACCACTTAGACCCCAAAG AGG Intronic
904090537 1:27941894-27941916 TGCCCACCTGGACCCCAAGGAGG + Intronic
907713337 1:56904792-56904814 TGCCATCTAAGACCCCAAAGAGG - Intronic
907768341 1:57434371-57434393 AGACAAGTCAGACCCCAAAGAGG + Intronic
907842179 1:58168931-58168953 TGTCCTCCTAGACCACAAAGAGG - Intronic
911129932 1:94377389-94377411 TTTCCTCTTAGACCGCAAAGAGG + Intergenic
912021145 1:105110528-105110550 TGTCCTCCTAGACCACAAAGAGG - Intergenic
913382480 1:118227044-118227066 TTTCCTCTTAGACCACAAAGAGG - Intergenic
915832160 1:159141254-159141276 TGACCTCTGAGACCACAAAAAGG - Intronic
916083461 1:161251558-161251580 TTTCCTCTTAGACCACAAAGAGG - Intergenic
916480911 1:165213559-165213581 TGCCCACTGAGATCCCAGAGGGG + Intronic
917227406 1:172799742-172799764 TGTCCTCCTAGACCACAAAGAGG - Intergenic
917279742 1:173369355-173369377 TTTCCTCTTAGACCACAAAGAGG - Intergenic
917280978 1:173378042-173378064 TGTCCTCCTAGACCACAAAGAGG - Intergenic
919558509 1:199091759-199091781 TTTCCTCTTAGACCACAAAGAGG - Intergenic
921019549 1:211223688-211223710 TGTCCTCCTAGACCACAAAGAGG - Intergenic
922098165 1:222460330-222460352 TGATCACTTAATCCCCAAACTGG + Intergenic
1065082281 10:22140384-22140406 TTTCCTCTTAGACCACAAAGAGG - Intergenic
1065585111 10:27210327-27210349 TGCCAAGTTAAACCCCAAAGAGG + Intronic
1069365236 10:67689005-67689027 TGTCCTCTTAGACCACAAAGAGG + Intronic
1069909933 10:71752732-71752754 TGACCACTGAGACCCGAAGGTGG + Intronic
1071220998 10:83464305-83464327 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1071834704 10:89407789-89407811 TGTCCTCCTAGACCACAAAGAGG - Intronic
1072371798 10:94771950-94771972 TGTCCTCGTAGACCACAAAGAGG + Intronic
1073970605 10:109042696-109042718 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1074612873 10:115038464-115038486 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1075146199 10:119885026-119885048 TTTCCTCTTAGACCACAAAGAGG - Intronic
1075170085 10:120105080-120105102 TGTCCTCTTATAGCCCAAAGTGG - Intergenic
1076145013 10:128111499-128111521 TGAACACTAAGACCCCAGAAGGG + Intronic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1082906278 11:58311267-58311289 TTTCCTCTTAGACCACAAAGAGG + Intergenic
1083415942 11:62525788-62525810 TGACCTCAAAGGCCCCAAAGTGG - Exonic
1084920125 11:72462447-72462469 TGACCACATAAACTCCAGAGAGG - Intergenic
1086317248 11:85607987-85608009 TGTCCTCCTAGACCACAAAGAGG - Intronic
1087074869 11:94119680-94119702 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1088345797 11:108823460-108823482 TGTCCACTTAGCCGCCCAAGAGG - Intronic
1088492409 11:110400877-110400899 TGTCCTCCTAGACCCCAAAGAGG - Intergenic
1088841620 11:113632302-113632324 TGACCACTGAGACCTTGAAGAGG + Intergenic
1090272124 11:125394274-125394296 GGATCATTTGGACCCCAAAGTGG - Intronic
1091846021 12:3656906-3656928 TGAACACTTAGACCCTCAAGAGG - Intronic
1094320102 12:29173930-29173952 TGTCCTCTTAGACCACAAAGAGG + Intronic
1095910563 12:47422338-47422360 TGAACACTTAGAGGCCAATGTGG - Intergenic
1097309895 12:58107166-58107188 TGAGCACTGAGGCCCCAAAAAGG - Intergenic
1097767497 12:63542797-63542819 TGCCCACTCAGACCCCAAAGTGG + Intergenic
1097783867 12:63737845-63737867 TGCCCACTCAGACCCCAAAGTGG + Intergenic
1099414883 12:82373045-82373067 TGTCCTCCTAGACCACAAAGAGG + Intronic
1100013518 12:89981585-89981607 TGACCACTTGCACCACAAAGAGG - Intergenic
1100050899 12:90446875-90446897 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1100092034 12:90984222-90984244 TTTCCTCTTAGACCACAAAGAGG - Intronic
1100530432 12:95456842-95456864 TTTCCTCTTAGACCACAAAGAGG + Intergenic
1101040778 12:100753348-100753370 TGATCTCTTTCACCCCAAAGAGG + Intronic
1102252129 12:111394623-111394645 TGACATCTTACACCCCAGAGAGG + Intergenic
1103773023 12:123343372-123343394 TGACAGGTTAGAACCCAAAGGGG + Intronic
1104766969 12:131336347-131336369 TTTCCTCTTAGACCACAAAGAGG - Intergenic
1109446897 13:62451317-62451339 TGATCTCTCAGACCCCAAAAAGG - Intergenic
1112450675 13:99505996-99506018 TGACCAATTATACCCCCTAGTGG + Intronic
1113551656 13:111197405-111197427 TGTCCTCCTAGACCACAAAGAGG + Intronic
1120198660 14:81514498-81514520 TGTCCTCCTAGACCCCAAAGAGG - Intronic
1126072189 15:44874923-44874945 TTTCCTCTTAGACCACAAAGAGG + Intergenic
1126085996 15:45011742-45011764 TTTCCTCTTAGACCACAAAGAGG - Intergenic
1129549729 15:76435087-76435109 TGATCACTTGGATCCAAAAGGGG + Intronic
1131569061 15:93514877-93514899 TAACCACTATGGCCCCAAAGGGG + Intergenic
1132367480 15:101268033-101268055 GGACCACGTAGACCCCAAGACGG + Intergenic
1135717002 16:24779998-24780020 TGACCACTTAGACCCCAAAGAGG + Intronic
1139260483 16:65588736-65588758 TGACTCCTCAGACCCAAAAGAGG + Intergenic
1139842755 16:69894743-69894765 TGAGCACTGGGTCCCCAAAGTGG - Intronic
1139964699 16:70738893-70738915 TGACCTCTTAGACCCCCAGCTGG - Intronic
1141755227 16:85986554-85986576 TCACCACCTAGACCCCCATGGGG + Intergenic
1143626043 17:8110594-8110616 TGCCCACTTCCACCCCAGAGAGG + Intronic
1146310353 17:31763799-31763821 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1146310365 17:31763884-31763906 TGACCTCCTAGACCACAAGGAGG - Intergenic
1146584781 17:34072863-34072885 TATCCACTAAGCCCCCAAAGTGG - Intronic
1147643994 17:42022831-42022853 GGACCCCTTAAACCACAAAGAGG - Intronic
1148092625 17:45031692-45031714 TGACCACGTACTCCCCAGAGGGG - Intronic
1149073764 17:52574656-52574678 TTTCCTCTTAGACCACAAAGAGG - Intergenic
1149209528 17:54287720-54287742 TTTCCTCTTAGACCACAAAGGGG - Intergenic
1149223406 17:54440639-54440661 TTTCCTCTTAGACCACAAAGAGG - Intergenic
1150920415 17:69476710-69476732 AGACCACTTCCACCCCAAAAAGG - Intronic
1153207395 18:2717731-2717753 TGACCACACAGACCAAAAAGAGG - Intronic
1153437908 18:5086861-5086883 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1153662296 18:7335895-7335917 AGACCACTTACACACAAAAGTGG + Intergenic
1153896956 18:9572151-9572173 TCACCACCTAGAACCCAACGTGG - Intronic
1156501032 18:37558468-37558490 TATCCACCTAAACCCCAAAGTGG - Intronic
1159945692 18:74443023-74443045 TGACCAGTCAGACGACAAAGTGG + Intronic
1161220156 19:3114715-3114737 TGTCCCCTGAGACCCCAGAGAGG + Intronic
1164993113 19:32698768-32698790 TGTCCTCCTAGACCTCAAAGAGG + Intronic
926072885 2:9914509-9914531 TCACCACTGAGACCCCAGGGAGG - Intronic
928663464 2:33527370-33527392 TCACCACTTAGAACCCAACATGG + Exonic
929330212 2:40673486-40673508 TGTCCTCCTAGACCACAAAGAGG - Intergenic
929655124 2:43723377-43723399 TGAACACTTATACACCAAACTGG + Intronic
930501198 2:52220639-52220661 TGGCCAATTAGAGGCCAAAGTGG + Intergenic
931540332 2:63323729-63323751 TGTCCTCCTAGACCACAAAGAGG - Intronic
936920193 2:117680622-117680644 TGACCACTTAGAGGCCATTGTGG - Intergenic
937635470 2:124151106-124151128 TCCCAACTTAGACCCCAGAGTGG + Intronic
940655763 2:156486225-156486247 TTAACACTTAGCCCCCAAAGTGG + Intronic
943103225 2:183511535-183511557 TGTCCTCCTAGACCACAAAGAGG + Intergenic
944911663 2:204316321-204316343 TGAGCACTCATACCGCAAAGAGG + Intergenic
947919427 2:233856347-233856369 TGACCAATCAGAGCCTAAAGTGG + Intergenic
1172861322 20:38054864-38054886 TGACCACTTTGATGCCACAGTGG + Intronic
1174867627 20:54152490-54152512 TGATGACTTAGATCCCACAGGGG - Intergenic
1178336079 21:31744843-31744865 TGGGCACTTAGACACCAAAGAGG - Intergenic
1181966820 22:26662283-26662305 AGGCCTCTTGGACCCCAAAGGGG - Intergenic
952555201 3:34522897-34522919 TGTCCTCCTAGACCACAAAGAGG + Intergenic
952941108 3:38444981-38445003 TTCCCTCTTAGACCGCAAAGAGG + Intergenic
953623108 3:44549513-44549535 TGTCCTCTTAGACCACAAAGAGG + Intergenic
953662513 3:44901434-44901456 TGGCCACCCAGCCCCCAAAGTGG - Intronic
954586825 3:51743724-51743746 TTTCCTCTTAGACCACAAAGAGG - Intergenic
956843136 3:73158177-73158199 TGTCCTCCTAGACCACAAAGAGG + Intergenic
958635707 3:96742353-96742375 AGACCACATAGACTCAAAAGTGG + Intergenic
960063524 3:113347932-113347954 TGTCCTCTTAGACCACAATGAGG - Intronic
960267742 3:115639988-115640010 TTCCCATCTAGACCCCAAAGAGG - Intronic
963021113 3:140873833-140873855 TGTCCTCCTAGACCACAAAGAGG - Intergenic
963696577 3:148572257-148572279 TGTCCTCCTAGACCACAAAGAGG - Intergenic
964972089 3:162575933-162575955 TGTCCTCCTAGACCACAAAGAGG - Intergenic
967583472 3:191186927-191186949 TGTCCTCTTAGACCACAAAGAGG - Intergenic
970643797 4:18096589-18096611 AGAACACTTAGACACGAAAGGGG + Intergenic
971578325 4:28304508-28304530 TGTCCTCCTAGACCACAAAGAGG - Intergenic
972161057 4:36227974-36227996 AGACCTCTGGGACCCCAAAGAGG - Intronic
972243541 4:37220423-37220445 TGACCTCTAACATCCCAAAGCGG + Intergenic
974526401 4:63054341-63054363 TGTCCTCCTAGACCACAAAGAGG - Intergenic
975717347 4:77217636-77217658 AGACCCCTTGGATCCCAAAGGGG + Intronic
976174484 4:82337620-82337642 TGTCCTCCTAGACCACAAAGAGG + Intergenic
977835076 4:101636777-101636799 TGTCCTCCTAGACCACAAAGAGG + Intronic
977883929 4:102236723-102236745 TGCCCTCCTAGACCACAAAGAGG - Intergenic
980291063 4:130847801-130847823 TGTCCTCCTAGACCACAAAGAGG + Intergenic
981096869 4:140791052-140791074 TCCCCACCCAGACCCCAAAGAGG - Intergenic
982068806 4:151676951-151676973 TAACCAATTAGAGCACAAAGTGG + Intronic
982657903 4:158171469-158171491 AGACCACTTATATCCCGAAGCGG - Exonic
982700959 4:158659392-158659414 TGTCCTCCTAGACCACAAAGAGG - Intergenic
983835090 4:172375756-172375778 TGTCCTCCTAGACCACAAAGAGG + Intronic
983981906 4:174008178-174008200 AGACCATGTAGACCACAAAGTGG + Intergenic
987278270 5:16385673-16385695 TGACCACCTAGACTCTCAAGGGG + Intergenic
988605682 5:32676649-32676671 TGTCCTCCTAGACCACAAAGAGG + Intergenic
989496087 5:42112810-42112832 TGTCCTCCTAGACCACAAAGAGG - Intergenic
990116567 5:52398716-52398738 TGTCCTCCTAGACCACAAAGGGG - Intergenic
990116579 5:52398801-52398823 TGTCCTCCTAGACCACAAAGGGG - Intergenic
990368050 5:55089842-55089864 TGTCCTCCTAGACCACAAAGAGG + Intergenic
993635639 5:90340195-90340217 TGAACACCAACACCCCAAAGAGG + Intergenic
995583607 5:113624465-113624487 TGTCCTCCTAGACCACAAAGAGG + Intergenic
995706212 5:114991490-114991512 TGTCCTCCTAGACCACAAAGAGG - Intergenic
995802340 5:116011523-116011545 TGACCCCTAACTCCCCAAAGAGG - Intronic
996680210 5:126222795-126222817 TGTCCTCCTAGACCACAAAGAGG - Intergenic
997072230 5:130635014-130635036 TGTCCTCCTAGACCACAAAGAGG - Intergenic
998111296 5:139504754-139504776 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1000085054 5:157881439-157881461 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1001683530 5:173575969-173575991 TGACCCATCAGACACCAAAGTGG - Intergenic
1003020765 6:2507332-2507354 GGACAATTCAGACCCCAAAGTGG + Intergenic
1005067154 6:21829919-21829941 TAACCACTTACCCCCCAAATAGG + Intergenic
1005456490 6:26024691-26024713 TGACCACAGTGACCCCAAACTGG - Intergenic
1006376847 6:33676457-33676479 TATCCACTGAGACCCCAAACAGG - Intronic
1006847286 6:37071410-37071432 TTACCCCTTATTCCCCAAAGTGG + Intergenic
1007029862 6:38617908-38617930 TTTCCTCTTAGACCACAAAGAGG - Intronic
1010269656 6:73905300-73905322 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1011535208 6:88369455-88369477 TGACCTTATAGACCCCAATGAGG + Intergenic
1013235927 6:108197909-108197931 GGACCACCAAGACACCAAAGAGG - Intergenic
1013977247 6:116092509-116092531 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1014270539 6:119330946-119330968 TGCCCACATGGAGCCCAAAGGGG - Intronic
1016183846 6:141177580-141177602 TGGCCTCCTAGACCACAAAGAGG - Intergenic
1016220349 6:141661631-141661653 TGAACACTTAGAGGCCATAGTGG + Intergenic
1017059480 6:150468921-150468943 TAACCATTTACCCCCCAAAGTGG + Intergenic
1023151227 7:37203183-37203205 TGTCCTCCTAGACCACAAAGAGG + Intronic
1024735114 7:52296311-52296333 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1028495397 7:91454908-91454930 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1028495406 7:91454993-91455015 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1030420338 7:109300614-109300636 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1034580167 7:152034866-152034888 TGTCCTCCTAGACCACAAAGAGG + Intronic
1034973967 7:155437186-155437208 TGTCCACTTGGACCCCCAAGTGG - Intergenic
1035229694 7:157457565-157457587 TGAAAACATAGACTCCAAAGCGG + Intergenic
1038653033 8:29422858-29422880 TGAACACTTACACCCCGAATTGG + Intergenic
1039275828 8:35933470-35933492 TTTCCTCTTAGACCACAAAGAGG - Intergenic
1039693352 8:39883993-39884015 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1040527006 8:48234379-48234401 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1040648894 8:49428520-49428542 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1040796963 8:51297767-51297789 TTTCCTCTTAGACCACAAAGAGG + Intergenic
1040971641 8:53142068-53142090 TTTCCTCTTAGACCACAAAGAGG + Intergenic
1042771742 8:72389454-72389476 TTTCCTCTTAGACCACAAAGAGG - Intergenic
1044005607 8:86933014-86933036 TTTCCTCTTAGACCACAAAGAGG + Intronic
1044456808 8:92399470-92399492 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1045381991 8:101636379-101636401 TGTCTACTTACTCCCCAAAGGGG - Intronic
1045858381 8:106790067-106790089 TTTCCTCTTAGACCACAAAGAGG - Intergenic
1047537586 8:125733786-125733808 TCCTCACTTAGACCCTAAAGAGG - Intergenic
1047608558 8:126498291-126498313 TGACCACACAGACCCCACAAAGG - Intergenic
1051935082 9:22435955-22435977 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1051935095 9:22436040-22436062 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1052050559 9:23843073-23843095 TAATCACTTAAACCCCCAAGGGG + Intergenic
1052057962 9:23924455-23924477 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1056392977 9:86155852-86155874 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1185791970 X:2933988-2934010 TGATCACTCAGACACCAAACTGG - Intergenic
1186629286 X:11331513-11331535 TGACCCTTTAGAGCGCAAAGGGG + Intronic
1188136315 X:26498807-26498829 TTTCCACTTAGACCACAAAGAGG - Intergenic
1188136328 X:26498892-26498914 TTTCCTCTTAGACCACAAAGAGG - Intergenic
1190699799 X:52979290-52979312 TGACCTTTTAGATCCCAAAATGG + Intronic
1192482948 X:71500634-71500656 TTTCCTCTTAGACCACAAAGAGG + Intronic
1192511157 X:71721086-71721108 GGACCTGTGAGACCCCAAAGTGG - Intergenic
1192515540 X:71760467-71760489 GGACCTGTGAGACCCCAAAGTGG + Intergenic
1193376051 X:80762889-80762911 AGACTACTGAGACCCCAGAGAGG - Intronic
1195439373 X:104884085-104884107 TGTCCTCCTAGACCACAAAGAGG - Intronic
1195439386 X:104884170-104884192 TGTCCTCCTAGACCACAAAGAGG - Intronic
1196127514 X:112115208-112115230 TCTCCGCTTAGACCACAAAGAGG + Intergenic
1196419589 X:115508229-115508251 TTTCCTCTTAGACCACAAAGAGG + Intergenic
1196488798 X:116244917-116244939 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1197733666 X:129833753-129833775 TGACCACTTACAGCCCTTAGAGG - Intronic
1200695128 Y:6351939-6351961 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1200711094 Y:6485698-6485720 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1201022840 Y:9676288-9676310 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1201040149 Y:9822771-9822793 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1201272108 Y:12265363-12265385 TGTCCTCTTAGACCACAAAGAGG + Intergenic
1201312228 Y:12607286-12607308 TTTCCTCTTAGACCACAAAGAGG + Intergenic
1201403595 Y:13629230-13629252 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1201407668 Y:13664839-13664861 TTTCCTCTTAGACCACAAAGAGG + Intergenic
1201516130 Y:14820206-14820228 TTTCCTCTTAGACCACAAAGAGG + Intronic
1201568727 Y:15392240-15392262 TTTCCTCTTAGACCACAAAGAGG + Intergenic
1201568741 Y:15392325-15392347 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1201631086 Y:16072674-16072696 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1201989684 Y:20009989-20010011 TTTCCTCTTAGACCACAAAGAGG + Intergenic
1202028502 Y:20550110-20550132 TAACCACAAAGACCCCCAAGAGG - Intergenic
1202074874 Y:21027627-21027649 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1202257669 Y:22938553-22938575 TGTCCACCCAGACCACAAAGAGG - Intergenic
1202272258 Y:23083505-23083527 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1202293768 Y:23337177-23337199 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1202410659 Y:24572300-24572322 TGTCCACCCAGACCACAAAGAGG - Intergenic
1202425255 Y:24717249-24717271 TGTCCTCCTAGACCACAAAGAGG + Intergenic
1202445534 Y:24952836-24952858 TGTCCTCCTAGACCACAAAGAGG - Intergenic
1202460122 Y:25097772-25097794 TGTCCACCCAGACCACAAAGAGG + Intergenic