ID: 1135718707

View in Genome Browser
Species Human (GRCh38)
Location 16:24795584-24795606
Sequence AGGTTCCTCACTTTTAATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135718704_1135718707 7 Left 1135718704 16:24795554-24795576 CCAGTGGATAGCTGGACTAGGTA 0: 1
1: 0
2: 0
3: 9
4: 53
Right 1135718707 16:24795584-24795606 AGGTTCCTCACTTTTAATCCTGG 0: 1
1: 0
2: 0
3: 10
4: 180
1135718700_1135718707 23 Left 1135718700 16:24795538-24795560 CCTTAGAAGTCAGATACCAGTGG 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1135718707 16:24795584-24795606 AGGTTCCTCACTTTTAATCCTGG 0: 1
1: 0
2: 0
3: 10
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135718707 Original CRISPR AGGTTCCTCACTTTTAATCC TGG Intronic
903529017 1:24015337-24015359 AGTTTCCTGACTTCAAATCCAGG + Intergenic
904819252 1:33230180-33230202 AGTTTCCTCACTTGTAAACTGGG + Intergenic
905661430 1:39728974-39728996 AGGTTCTGCAAATTTAATCCAGG - Intronic
908454312 1:64287451-64287473 AGCTTCTTCCCTTTTTATCCAGG - Intergenic
908991002 1:70089099-70089121 AGGTTCCTAACTCCTACTCCAGG + Intronic
910487560 1:87732200-87732222 AGGTTCCTCATTTTTACTTTAGG + Intergenic
910937021 1:92492649-92492671 AGGTTCCTAACCTTTGATCCAGG - Intergenic
912077515 1:105893999-105894021 AGATTGCTCAGATTTAATCCAGG - Intergenic
912923031 1:113887481-113887503 AGTTTCCTGACATGTAATCCTGG + Exonic
915752904 1:158228569-158228591 AGGTTCTCCACTCTAAATCCTGG + Intergenic
916399021 1:164425588-164425610 GGGTTACTGACTTATAATCCTGG - Intergenic
919857555 1:201716085-201716107 GGGTTCCTCAATTCTATTCCTGG - Intronic
919876394 1:201872251-201872273 GGCTTCCTAACTTTTTATCCTGG + Intronic
921173386 1:212568927-212568949 AGGCTCCTTACTTCTGATCCTGG + Intronic
921400311 1:214715018-214715040 AGGTTCCTCCTTTTTACTGCTGG + Intergenic
922030787 1:221795619-221795641 AGGTTCCTCACATGTAACACGGG - Intergenic
924096157 1:240553135-240553157 AGCTGTCTCACTTTTAATTCTGG - Intronic
924535965 1:244936059-244936081 AGGTTCCTCACCTTTAAAATGGG + Intergenic
1066355925 10:34683754-34683776 AGGACCCTCACTTTTCATGCAGG + Intronic
1069943543 10:71971128-71971150 AGGGTCCTCACCTTGCATCCAGG + Intronic
1070112534 10:73498923-73498945 AGGTTCCTCACACTCAGTCCTGG - Exonic
1071337667 10:84614084-84614106 AGGTAGCTCACTGCTAATCCAGG - Intergenic
1075061656 10:119261122-119261144 GGGTTCCTCACTTTTCAGACGGG + Intronic
1076093901 10:127714607-127714629 AGGTTCATCACTTGTAACCAAGG + Intergenic
1076144923 10:128110635-128110657 AGATTCCTCCCTTGAAATCCTGG + Intronic
1076800884 10:132827621-132827643 ACGTTGCTCACTTTAAATGCAGG - Intronic
1081493375 11:43583443-43583465 AGGCTGCTCACTTTTGATCGGGG + Intronic
1082743091 11:56932639-56932661 AGATTTCTGACTTCTAATCCAGG - Intergenic
1082955565 11:58866491-58866513 AGCTTCCTAACTCTTAATTCAGG - Intronic
1083295801 11:61715028-61715050 AGTCTCCTCACTTCTAAACCAGG - Intronic
1085851857 11:80130020-80130042 AGTTTCCTCACTTGTAAAACAGG + Intergenic
1087176882 11:95104499-95104521 TTGTTCCCCAGTTTTAATCCTGG + Intronic
1087478285 11:98665672-98665694 AGGTTCATCACTTTTGAACTGGG - Intergenic
1088524045 11:110732782-110732804 AGGTTCCTTAATTTTAATAGTGG + Intergenic
1088671407 11:112144992-112145014 AGGTTCTTCCATGTTAATCCTGG + Intronic
1089605588 11:119639568-119639590 AGTTTCCTCACTATAAATCGTGG + Intronic
1089879672 11:121761789-121761811 AGTTTCCTCATTTATAAACCAGG - Intergenic
1092985097 12:13837566-13837588 AGGCTCCTCACTGTTAAAACAGG - Intronic
1094154228 12:27320710-27320732 AGTTTCCTCACTTGTAAGACAGG - Intronic
1099473567 12:83080236-83080258 AGATTCCTAACTTTTAAACATGG - Intronic
1103092642 12:118108241-118108263 AGGTTGCTCACTTATAAAACTGG - Intronic
1103347509 12:120261048-120261070 AGTTTCCTCACTTATAAAACAGG + Intronic
1104021705 12:124996435-124996457 CGGCTACTCACTTGTAATCCCGG - Intronic
1104999924 12:132683831-132683853 GTGTATCTCACTTTTAATCCAGG + Intronic
1106208986 13:27623517-27623539 AGTTTCCTCATTTTCAATGCTGG - Intronic
1106626149 13:31422854-31422876 AGGTTCCAATCTTTTAACCCTGG - Intergenic
1106902700 13:34370910-34370932 AGTTTCCTCACTTATAAAGCAGG + Intergenic
1107658657 13:42616802-42616824 AGGTTCTGCCCTGTTAATCCAGG + Intergenic
1108709695 13:53020445-53020467 ATTTCCCTGACTTTTAATCCTGG + Intergenic
1110076595 13:71253083-71253105 ACTTTCTTCACTGTTAATCCAGG + Intergenic
1110676499 13:78252589-78252611 AGGATCCTCCCATTTAAGCCTGG - Intergenic
1111170998 13:84526652-84526674 AGTTTCCTCATTTGTAATACAGG + Intergenic
1113836793 13:113333251-113333273 GGGTTCCTCACGTGTAACCCGGG + Intronic
1119700311 14:76750399-76750421 AGGCTCCTCACTTCTCATACGGG - Intergenic
1121360406 14:93252668-93252690 ATGTTTCTCATTTTTAAACCAGG - Intronic
1121543022 14:94742769-94742791 AGTTTCCTCATTTTTAACACTGG - Intergenic
1122300378 14:100727892-100727914 AGGTTCATCCCTATTAAGCCGGG - Intronic
1122343851 14:101045878-101045900 AGGTTCCTCACTATCATTCACGG - Intergenic
1123453261 15:20387742-20387764 AGTTTCTTCAGTTTTAATACTGG + Intergenic
1126572113 15:50163766-50163788 AGGTTCCTGACTTTAGGTCCTGG - Intronic
1127645870 15:60958569-60958591 AGTTTCCTCATTTTTAAAACAGG - Intronic
1128524838 15:68405236-68405258 AGGTCCCTCAGTTTTACTCTGGG - Intronic
1129115502 15:73363280-73363302 ACCTTTCTCACTTTGAATCCTGG - Intronic
1130984470 15:88835990-88836012 AGGTTTCTCAGTTTAATTCCGGG - Intronic
1131715958 15:95111122-95111144 AGGTTCCTCCCCTTTCTTCCAGG - Intergenic
1132311416 15:100860657-100860679 AAGCTCCTCACTTTTTATCCAGG - Intergenic
1135718707 16:24795584-24795606 AGGTTCCTCACTTTTAATCCTGG + Intronic
1136668566 16:31836532-31836554 AGGCTCCTCACTTCTCATACGGG - Intergenic
1139007291 16:62588240-62588262 AGGTTTCTCTGTTTTAAGCCAGG - Intergenic
1143748320 17:9009928-9009950 AGTTTCCTCACTCGTAATCTGGG + Intergenic
1144872508 17:18379883-18379905 AGGTTCCTCACTCGTAAAGCAGG - Intronic
1146087140 17:29839905-29839927 TGGTTCCTCACCTTTAAACAGGG + Intronic
1146554027 17:33807634-33807656 AGGTTCCCCACTTCTAATCTTGG + Intronic
1147409182 17:40236868-40236890 AGGTTTCTAACTTTTAATAGTGG + Intronic
1149793671 17:59500418-59500440 AGGCTCCTCACTTCTCATACGGG - Intergenic
1151748746 17:76025143-76025165 AGGTTCCTCACTTGTAAAGCGGG + Intronic
1151806945 17:76411610-76411632 TGGGTGCTCTCTTTTAATCCCGG + Intronic
1158190622 18:54824485-54824507 AGGTTCATGACTTTTCATCTAGG + Intronic
1159115355 18:64107206-64107228 AGGTTAGTCACTTCTAATCCAGG - Intergenic
1163654478 19:18537866-18537888 AGTTTCCCCAATTTTAACCCCGG + Intronic
1165852173 19:38855907-38855929 AGGCTCCTCACTTCTCATACGGG + Intergenic
1165948063 19:39457219-39457241 AGGTTCCTCACTGATCTTCCTGG - Intronic
1167517132 19:49929938-49929960 AGCTTCCTTCCTTTTAAACCAGG + Intronic
1168148345 19:54431634-54431656 AGTTCCCTCACTTATAAACCTGG + Intronic
927921407 2:26974736-26974758 AGTTTCCTCATTTATAACCCTGG + Intronic
930765791 2:55084037-55084059 AAGTTCCAAACTTTTAATCATGG - Intronic
931120439 2:59212293-59212315 GTTTTCCTAACTTTTAATCCTGG + Intergenic
931327236 2:61239272-61239294 AGCTTCCTCACTTTAAATGAGGG + Intronic
935183341 2:100709225-100709247 ATGGTCCACACTTGTAATCCTGG - Intergenic
936675722 2:114711500-114711522 AGGTTCCTCATCTTTAAACTGGG + Intronic
938942127 2:136178595-136178617 AGGTTCCTGACTTATACCCCAGG - Intergenic
939782845 2:146470895-146470917 ATGTTCCTTACTTTTAACTCTGG + Intergenic
940007447 2:149020842-149020864 AGGTTTTTCACTTCTAATTCTGG + Intronic
941137881 2:161739865-161739887 AGCTGCTTGACTTTTAATCCTGG + Intronic
942563921 2:177248113-177248135 AGGATCCTCATTTATAAACCTGG - Intronic
943323434 2:186472980-186473002 AGGCTCCTCACTTCTCATACGGG - Intergenic
944941947 2:204638207-204638229 AGGTTCCTAACTATGAAACCAGG - Intronic
946552235 2:220815249-220815271 AGGATGATCACTTTTAATTCTGG + Intergenic
947337554 2:229103078-229103100 AGGTTCCTCTTTTTGAATCAGGG + Intronic
1168799922 20:637957-637979 AGGGTCTTCAATTTTAATTCAGG - Intergenic
1170715585 20:18828336-18828358 AGATTCCTCACTGGGAATCCGGG - Intronic
1171213899 20:23337799-23337821 ATGTTCCTCCCGTTTAATCTGGG - Intergenic
1172051640 20:32122430-32122452 AGGCTCCTCACTTCTCATACGGG + Intronic
1175616325 20:60402703-60402725 AGCTTCCTCATTTGTAATACAGG + Intergenic
1178750516 21:35298203-35298225 AGGGTCTTCCCTTTTATTCCTGG + Intronic
1181136516 22:20770668-20770690 AGGTTCCAAAATTTTAAACCTGG + Intronic
1181137030 22:20774913-20774935 AGGTTCCAAAATTTTAAACCTGG + Intronic
950428477 3:12937530-12937552 AGGTGCCTGAGTTCTAATCCAGG + Intronic
953657788 3:44867078-44867100 AGTTTCCTCACCTCTAATACAGG - Intronic
954837911 3:53486843-53486865 AGTTTCCTCACCTTTAAAACAGG - Intergenic
955443239 3:58979289-58979311 AATTTCCTCACCTTTAATCTAGG + Intronic
955753320 3:62203929-62203951 AGATTTATCACTGTTAATCCAGG + Exonic
955799027 3:62667348-62667370 AGGTTCCTAACATTCATTCCAGG - Intronic
957310687 3:78514962-78514984 AGGTTTCTCAGTTCTAATTCAGG - Intergenic
959651849 3:108757910-108757932 AACTTCCTTATTTTTAATCCAGG - Intergenic
963900248 3:150726701-150726723 AGGTTCCTCACTTGTAAACTGGG + Intergenic
967492731 3:190112191-190112213 AGGTTCCTGGATTCTAATCCTGG + Intronic
969188789 4:5500264-5500286 AGTTTCCTCATTTTTAAACAGGG + Exonic
970935398 4:21564459-21564481 AGGTCCCCCACTTATGATCCTGG - Intronic
972019919 4:34299697-34299719 AGTTTCCTGATTTTTATTCCTGG - Intergenic
974488457 4:62533628-62533650 AGGGTTCTCACTCTTAATACTGG - Intergenic
976785773 4:88818694-88818716 AGCTGCCTCACTTTAAATCTGGG - Intronic
978877695 4:113661580-113661602 AGGTTCCTAACTTTCAATCTTGG - Intronic
979485601 4:121266621-121266643 AGGTTTCTCATTTTTAATTATGG - Intergenic
980895151 4:138854201-138854223 AGGCTCCTCACTTCTCATACTGG - Intergenic
982467956 4:155753864-155753886 AGTTTCCTCACTTGTAAAACAGG - Intergenic
984879331 4:184396734-184396756 AGATTCCTCACTTTTAAAAACGG + Intronic
986409035 5:7457973-7457995 AGTTTCCTCACTTTTGGCCCTGG + Intronic
990427016 5:55696786-55696808 AGGCTCCTCACTTCTCATACGGG + Intronic
993069860 5:83147003-83147025 ATGGTCCTGACTTTTAATTCTGG + Intronic
993281482 5:85930720-85930742 AGGTTCGTGACTTTTACTCTCGG - Intergenic
993657876 5:90595974-90595996 AGGCTCCTCACTTTTCAGACGGG + Intronic
993657886 5:90596014-90596036 AGGCTCCTCACTTCTCATACGGG + Intronic
994136757 5:96296814-96296836 CTGTTCCTCAGTTTTAATCATGG + Intergenic
994141913 5:96350928-96350950 AGGTTCTTCACTTATAATGAAGG - Intergenic
994644690 5:102453714-102453736 ATTTTCCTCATTTTTAAGCCTGG + Intronic
995515973 5:112954981-112955003 AGGCTCCTCACTTCTCATACGGG - Intergenic
997245293 5:132342963-132342985 AGGTTCCAGGCTTCTAATCCAGG + Intronic
999459404 5:151745012-151745034 AGATTCCTCATTATTCATCCTGG + Intronic
999674547 5:153985978-153986000 AGCTGCCTGACTTTAAATCCTGG + Intergenic
1000045624 5:157519759-157519781 AGGTTGCTTACTTTGAATCCAGG - Intronic
1000484094 5:161817692-161817714 AAGTTCCTAAATTTTAATCTAGG + Intergenic
1001204008 5:169745213-169745235 AGGATCCTCTCTTTTCAGCCAGG + Intronic
1001305697 5:170570940-170570962 AGTTTCCTCACTTATAAATCAGG - Intronic
1003527583 6:6910883-6910905 AGTTTCCTCACATTTAAAACAGG - Intergenic
1003529377 6:6925200-6925222 TGGTTCCTCCATGTTAATCCTGG + Intergenic
1005204035 6:23380386-23380408 AGGTTTTTCACTTTTATTTCTGG - Intergenic
1005644714 6:27827700-27827722 AGGCTCCTCACTTCTCATACGGG + Intergenic
1010023848 6:71193174-71193196 AAGTTCCAGACTTTTAATCATGG - Intergenic
1011052363 6:83167164-83167186 AGGTTCCTCACTTATAAAATGGG - Intronic
1012629301 6:101443497-101443519 AGGTTTCTGAGTTTTAATCAAGG + Intronic
1014806876 6:125839489-125839511 AAGTTCCAACCTTTTAATCCTGG + Intronic
1016527817 6:145022413-145022435 AGGTTTTTCAGTGTTAATCCAGG - Intergenic
1018124671 6:160670104-160670126 AGGTTCCTCACTTGTAAAATAGG + Intergenic
1019800693 7:3085914-3085936 AGGTCCCTGATTTTAAATCCAGG + Intergenic
1019845017 7:3490188-3490210 AGGTTCTTTACTTTGCATCCAGG + Intronic
1021377124 7:19921920-19921942 AGGTTTCTCGCTTTAAATCAAGG - Intergenic
1022255425 7:28651955-28651977 AGCTTCCTCACTTGTAAAACAGG + Intronic
1022539735 7:31124563-31124585 AGGATACTCACTTTAAATCATGG + Intergenic
1022684205 7:32579989-32580011 AGTTTCCTCACTTGTAAAACAGG - Intronic
1023596752 7:41837346-41837368 AGTGTTCTCTCTTTTAATCCTGG + Intergenic
1025587789 7:62814510-62814532 AAATTCCTCAGTTTTTATCCTGG + Intergenic
1026385039 7:69838429-69838451 AGTTTCCTCACTTGTAAAACAGG - Intronic
1026426952 7:70304265-70304287 AGTTTCCTCACTCATAATTCTGG - Intronic
1033471749 7:141656237-141656259 AGGAACCTGACTTTGAATCCAGG + Intergenic
1037296759 8:17410012-17410034 AGGATTCTCACTTTATATCCTGG + Intronic
1038543085 8:28405036-28405058 CGGTTCCTCATTTGTAAACCTGG + Intronic
1039152321 8:34519951-34519973 AGGATACTCTCTTTTAATGCTGG - Intergenic
1039453523 8:37694176-37694198 ATGTTCCCCAATTTTAATCTTGG - Intergenic
1041284963 8:56251196-56251218 AGGTTTCTCTCTTTTCTTCCTGG - Intergenic
1044139966 8:88638002-88638024 AGATTCCCCACTTCTAATACTGG + Intergenic
1044693295 8:94899546-94899568 AGCTTCCTCATTTATAAACCAGG - Intronic
1048299690 8:133242298-133242320 AGTTTCCTCACCTGTAATACAGG + Intronic
1050684805 9:8156147-8156169 ATTTTGCTCACTTTTCATCCAGG + Intergenic
1051002122 9:12295605-12295627 AGGTTTATAACTTTTTATCCTGG - Intergenic
1052231439 9:26158931-26158953 AGCTTCCTCATTTTTAACTCTGG - Intergenic
1055407356 9:75988765-75988787 AGGTTTCTCACTTTAAAACTAGG - Intronic
1055680728 9:78712410-78712432 AGGTTCCTCACATTTAAAAGGGG - Intergenic
1058652651 9:107191037-107191059 AGATAACTCACTTTTGATCCTGG + Intergenic
1060350095 9:122852268-122852290 AGGCTCCTCACTTCTCATACGGG - Intronic
1060538672 9:124414292-124414314 AGATTCCTGAGTCTTAATCCAGG - Intronic
1061928395 9:133819157-133819179 AGGTTGCTCACTTTTAACCTCGG - Intronic
1188441408 X:30217781-30217803 AGATTCCTCAATTTGACTCCTGG - Intronic
1188907016 X:35801613-35801635 AGGTGCCTTACTTTGAATCCAGG - Intronic
1190496452 X:51032149-51032171 AGGGTCTTCACTTTGACTCCAGG + Intergenic
1190509521 X:51161786-51161808 AGGGTCTTCACTTTGACTCCAGG - Intergenic
1191659940 X:63638765-63638787 AGGTTCATCACTCTCAACCCAGG - Intronic
1193341686 X:80355733-80355755 AGCTTCCTCCCTTTTCAGCCTGG + Intronic
1199874761 X:151921065-151921087 AGGTTTCTGACTTTGATTCCTGG - Intronic
1199947218 X:152679482-152679504 AGGGTCCTCACCTTGAAACCTGG - Intergenic
1199962462 X:152788972-152788994 AGGGTCCTCACCTTGAAACCTGG + Intergenic