ID: 1135720378

View in Genome Browser
Species Human (GRCh38)
Location 16:24812468-24812490
Sequence GCCATTAAGTGGTGCATGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 74}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135720378_1135720381 -2 Left 1135720378 16:24812468-24812490 CCAGTCATGCACCACTTAATGGC 0: 1
1: 0
2: 2
3: 7
4: 74
Right 1135720381 16:24812489-24812511 GCAATGTTTCAGTAAACAATGGG 0: 1
1: 0
2: 3
3: 14
4: 199
1135720378_1135720382 16 Left 1135720378 16:24812468-24812490 CCAGTCATGCACCACTTAATGGC 0: 1
1: 0
2: 2
3: 7
4: 74
Right 1135720382 16:24812507-24812529 ATGGGCCATATATCCAGTAGTGG 0: 1
1: 1
2: 2
3: 30
4: 398
1135720378_1135720383 17 Left 1135720378 16:24812468-24812490 CCAGTCATGCACCACTTAATGGC 0: 1
1: 0
2: 2
3: 7
4: 74
Right 1135720383 16:24812508-24812530 TGGGCCATATATCCAGTAGTGGG 0: 1
1: 2
2: 11
3: 227
4: 2717
1135720378_1135720380 -3 Left 1135720378 16:24812468-24812490 CCAGTCATGCACCACTTAATGGC 0: 1
1: 0
2: 2
3: 7
4: 74
Right 1135720380 16:24812488-24812510 GGCAATGTTTCAGTAAACAATGG 0: 1
1: 0
2: 7
3: 45
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135720378 Original CRISPR GCCATTAAGTGGTGCATGAC TGG (reversed) Intronic
904225554 1:29015051-29015073 GTCATTAAGTGAGGCATGGCAGG + Intronic
908152469 1:61316510-61316532 GGCATTCAGTGGTGCAGGCCAGG + Intronic
919294766 1:195682751-195682773 GCCATTAACTGTTGCAAGAAAGG + Intergenic
923053025 1:230402023-230402045 GCCAGGAAGTGGTGGGTGACAGG + Intronic
1063552746 10:7048604-7048626 GCCATTAAATGACACATGACTGG - Intergenic
1065783072 10:29188901-29188923 AACATTAAGTGATACATGACTGG + Intergenic
1068183619 10:53555896-53555918 GCTAATGAGGGGTGCATGACAGG - Intergenic
1070258647 10:74832089-74832111 GACCTTAAGTGGTCCATGGCTGG + Intronic
1070534150 10:77362513-77362535 TCCATAAAGCGGAGCATGACTGG + Intronic
1071725360 10:88193140-88193162 ACCATTAAGTTGTGGGTGACAGG - Intergenic
1073463040 10:103677475-103677497 GCCATCCACTGGTGCAAGACAGG + Intronic
1074353262 10:112758643-112758665 GCCACAAAGTGGTGAATGGCAGG - Intronic
1075580306 10:123612404-123612426 TCCATGGAGTGGGGCATGACTGG + Intergenic
1076597113 10:131630708-131630730 GCCACTGAGTGGAGCATCACAGG + Intergenic
1078550622 11:12277728-12277750 GCTATTAAGCGATGCATGACTGG - Intronic
1080424898 11:32146400-32146422 GCCATTAAGGTCTGCATGTCTGG - Intergenic
1082853502 11:57786064-57786086 GCCATTAAGTCCTACATTACTGG - Intronic
1084357560 11:68650199-68650221 GCCCTAAAGTGGCCCATGACAGG - Intergenic
1085691612 11:78668936-78668958 GACATCAAGTGCTTCATGACAGG - Exonic
1091179958 11:133595725-133595747 GGCAGTAAGTGTTGCACGACTGG - Intergenic
1091491672 12:937883-937905 GCCCTCAAATGGTGCCTGACAGG + Intronic
1099440920 12:82698844-82698866 GCTATTAAGTGATGAATGAGCGG + Intronic
1100867207 12:98869499-98869521 GGAATTAAGTGCTGAATGACAGG - Intronic
1121204809 14:92154684-92154706 ATCATTAAGTGATGCATGACTGG - Intronic
1123480584 15:20627887-20627909 GCCATGAATTGGGGCATGACAGG - Intergenic
1124604725 15:31161662-31161684 GCCTTTAAGAGGGGCAAGACAGG - Intergenic
1130085110 15:80771613-80771635 CTCATGAAGTGATGCATGACTGG + Intergenic
1135720378 16:24812468-24812490 GCCATTAAGTGGTGCATGACTGG - Intronic
1136697463 16:32097748-32097770 GTCATTCAGTGATGCGTGACTGG - Intergenic
1136797961 16:33041034-33041056 GTCATTCAGTGATGCGTGACTGG - Intergenic
1137822614 16:51460356-51460378 GCCATTAAGTGGTGTCTAATTGG + Intergenic
1139297172 16:65911199-65911221 GTCATTATGTGGTGCATGACTGG - Intergenic
1139792140 16:69447013-69447035 GACATTGTGTGGTGCCTGACAGG - Intronic
1141489512 16:84362668-84362690 GCCATTATTTGCTGAATGACAGG - Intergenic
1148915689 17:50975926-50975948 GACATGGAGAGGTGCATGACAGG + Intronic
1151453067 17:74211224-74211246 GCCCTTAAGTGCTGCATACCAGG + Intergenic
1156753651 18:40493491-40493513 GCCATTAATCGGTGCTAGACAGG - Intergenic
1158172266 18:54613324-54613346 ACCATGAAGTGGTGCATGGGAGG - Intergenic
927528033 2:23766521-23766543 GCCTTTGAGTGGTGCATGTTTGG - Intronic
933424619 2:82094229-82094251 GACATTATGGGATGCATGACTGG + Intergenic
937626642 2:124051432-124051454 TCCAGTATGTGGTGCATGATTGG - Intronic
941863276 2:170307568-170307590 GCCTTGAAGTGTTGCAGGACAGG + Intronic
942819211 2:180091289-180091311 ATCATTAAGTGATGCATGACTGG + Intergenic
945319189 2:208401997-208402019 GCCATTTGGTGGCACATGACTGG + Intronic
945397013 2:209331484-209331506 GCCATCAAGTGGTGCCTTAGTGG + Intergenic
1181093466 22:20490239-20490261 AACATTAAGTGATGCATGACTGG - Intronic
1181994610 22:26866512-26866534 GTCATTATGGAGTGCATGACTGG - Intergenic
949968008 3:9375629-9375651 GTCATTAAGTGATGCATGACTGG - Intronic
951009344 3:17658211-17658233 CCCATCAAGTGGAGCATGATTGG + Intronic
954877110 3:53809380-53809402 GCCATTCATTCGTGCACGACAGG + Intronic
959527727 3:107396553-107396575 GCCATTACCTGGTATATGACAGG + Intergenic
966438563 3:179917966-179917988 GTCTTTATGTGGAGCATGACTGG + Intronic
967698621 3:192565783-192565805 GTCATTAAGAGACGCATGACTGG + Intronic
970833604 4:20372260-20372282 GACATTAAGTGGTGCAGAAAGGG + Intronic
974988349 4:69057131-69057153 GCAAGCAGGTGGTGCATGACAGG - Intronic
978101399 4:104845093-104845115 GTCATTAAGTGACACATGACTGG + Intergenic
981621919 4:146710465-146710487 GTCCTTACGCGGTGCATGACTGG + Intronic
982170887 4:152660706-152660728 GCCATAAAGTGGTGAATGAGAGG + Intronic
983414591 4:167438593-167438615 GACAGTAAGGGGTGCATGATCGG + Intergenic
984733748 4:183091595-183091617 ATCATTAAGTGGTACCTGACAGG - Intergenic
986295109 5:6431174-6431196 GCCATTAAGGGGTGCAGAAGAGG + Intergenic
987628930 5:20442499-20442521 GCCATTAAGTGGTGCGCTAATGG + Intronic
987648035 5:20701320-20701342 GCAATGAAGTTCTGCATGACAGG + Intergenic
988332283 5:29857478-29857500 GAAATTCAGTGGTGCTTGACAGG + Intergenic
998774306 5:145581806-145581828 CTCACTATGTGGTGCATGACTGG - Intronic
1012565437 6:100643474-100643496 GTCATTAAGCAATGCATGACTGG - Intronic
1016375733 6:143418849-143418871 GTCATTAAGTGGAGAATGAAAGG - Intergenic
1016633070 6:146254684-146254706 TCAATTTAGTGGGGCATGACTGG - Intronic
1021999873 7:26216314-26216336 GTCATTAAGCAATGCATGACAGG + Intergenic
1022165548 7:27756994-27757016 CCAATTTAGTGGTTCATGACTGG - Intronic
1024208484 7:47183787-47183809 TCCAGTAAATGGTGCATGACAGG - Intergenic
1027717025 7:81685376-81685398 GACATGAAGTGGTGCATGCTTGG - Intergenic
1032251886 7:130264749-130264771 GTGAGTAATTGGTGCATGACTGG - Intergenic
1046580407 8:116085661-116085683 GTCATTAAATGGTCCATTACAGG - Intergenic
1048611102 8:136024088-136024110 GCCATAAAAGGGTGCCTGACAGG - Intergenic
1050709632 9:8446770-8446792 TTCATTAGGTGTTGCATGACAGG - Intronic
1050907777 9:11027176-11027198 TCCATTAGGTGGTACCTGACTGG + Intergenic
1055322488 9:75096214-75096236 GACATAAAGTGGTAAATGACTGG - Intronic
1185982697 X:4797053-4797075 GCCATGAACTGGTGCATAAATGG + Intergenic
1191110004 X:56796867-56796889 TCCTTTAAGTGGGACATGACCGG + Intergenic
1193270891 X:79529835-79529857 GCCTCCTAGTGGTGCATGACTGG - Intergenic
1193291686 X:79780619-79780641 GACTTTAAGTGGTACAAGACTGG + Intergenic
1196330944 X:114469687-114469709 GACGTTAAGGGGTGCATGATCGG - Intergenic
1201672021 Y:16533560-16533582 GCCATTGACTGGTACATGAGAGG - Intergenic