ID: 1135729448

View in Genome Browser
Species Human (GRCh38)
Location 16:24882156-24882178
Sequence GGATGCAGAGGCCAACAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 230}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135729448_1135729452 -2 Left 1135729448 16:24882156-24882178 CCATTTTGTTGGCCTCTGCATCC 0: 1
1: 0
2: 0
3: 13
4: 230
Right 1135729452 16:24882177-24882199 CCCTACCACGTAGAACTTGGTGG 0: 1
1: 0
2: 0
3: 2
4: 32
1135729448_1135729458 18 Left 1135729448 16:24882156-24882178 CCATTTTGTTGGCCTCTGCATCC 0: 1
1: 0
2: 0
3: 13
4: 230
Right 1135729458 16:24882197-24882219 TGGGGAGCTCACCGGCTATTTGG 0: 1
1: 0
2: 1
3: 5
4: 98
1135729448_1135729454 -1 Left 1135729448 16:24882156-24882178 CCATTTTGTTGGCCTCTGCATCC 0: 1
1: 0
2: 0
3: 13
4: 230
Right 1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 45
1135729448_1135729455 0 Left 1135729448 16:24882156-24882178 CCATTTTGTTGGCCTCTGCATCC 0: 1
1: 0
2: 0
3: 13
4: 230
Right 1135729455 16:24882179-24882201 CTACCACGTAGAACTTGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 47
1135729448_1135729457 10 Left 1135729448 16:24882156-24882178 CCATTTTGTTGGCCTCTGCATCC 0: 1
1: 0
2: 0
3: 13
4: 230
Right 1135729457 16:24882189-24882211 GAACTTGGTGGGGAGCTCACCGG 0: 1
1: 0
2: 1
3: 12
4: 129
1135729448_1135729450 -5 Left 1135729448 16:24882156-24882178 CCATTTTGTTGGCCTCTGCATCC 0: 1
1: 0
2: 0
3: 13
4: 230
Right 1135729450 16:24882174-24882196 CATCCCTACCACGTAGAACTTGG 0: 1
1: 0
2: 0
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135729448 Original CRISPR GGATGCAGAGGCCAACAAAA TGG (reversed) Intronic
900721687 1:4180285-4180307 GGACGCAGAGCCCAACACAGTGG - Intergenic
900765934 1:4505381-4505403 GGATGCAGTGACCAAGAAACAGG + Intergenic
900777920 1:4598728-4598750 GGCTGCAGGGGCCAAGAAAGTGG + Intergenic
901583709 1:10268320-10268342 AAAAGCAGAGGGCAACAAAAGGG - Intronic
901606447 1:10462956-10462978 GTCTGCAGAGGTGAACAAAAGGG + Intronic
903706608 1:25290429-25290451 GGGTGCAGAGGCCACCTTAACGG + Intronic
903720628 1:25402925-25402947 GGGTGCAGAGGCCACCTTAACGG - Intronic
904576838 1:31510298-31510320 GGATGCAGAGGCAAATGACAAGG - Intergenic
905606581 1:39306014-39306036 AGATACAGAGGTAAACAAAATGG - Intronic
906721143 1:48005671-48005693 GGATGATGAGGCCAACACATGGG + Intergenic
907628898 1:56060422-56060444 CAATCCAGAGGCCAAGAAAAGGG + Intergenic
908318125 1:62954372-62954394 GGATTCAGTGGCCAGCAAAAAGG + Intergenic
910033903 1:82766887-82766909 GGATCCAGAGGAGAATAAAATGG - Intergenic
912937390 1:114015448-114015470 GAAAGCAGAGGAGAACAAAAAGG + Intergenic
913030548 1:114898105-114898127 GGATCCAGAGGCTGACAATAAGG - Intronic
913714998 1:121524556-121524578 AGATACAGAGGCCAACATGAAGG + Intergenic
914693425 1:150052858-150052880 GAATGCAGAGTCCAAAAATAAGG + Intergenic
915360334 1:155282720-155282742 GGACGCTGAGGTCTACAAAACGG + Exonic
917456787 1:175192736-175192758 GAGTGCAGAGGCAACCAAAAAGG - Exonic
921657962 1:217763124-217763146 ATATGTAGAGGCCAAGAAAATGG + Intronic
922202159 1:223413809-223413831 GTATGCAGAGGCATACAGAATGG + Intergenic
924489234 1:244519247-244519269 GGATGCAGAGGAACACAAAGAGG + Intronic
1063331364 10:5162984-5163006 GGCTGCCGAGGCCACCAAAGTGG - Intergenic
1065920465 10:30388233-30388255 GGATGCAGTGGCCAGAAAAGGGG + Intergenic
1066295567 10:34051249-34051271 GGATACAGAAGCAAAGAAAAGGG + Intergenic
1066996744 10:42570998-42571020 GGATAAATAGGCCAAAAAAAGGG - Intergenic
1068633169 10:59319313-59319335 GGATGAAGAGGCCAATGAACTGG + Intronic
1070130220 10:73650782-73650804 GGAGGAAGAGGACAGCAAAAAGG + Intronic
1070407232 10:76107673-76107695 GCATCCAGAGACCAGCAAAAGGG - Intronic
1071412038 10:85406548-85406570 GGCTGGAGAGGCCTACACAAAGG + Intergenic
1072661434 10:97366129-97366151 GGAGGCAGACGGCAACAAGATGG - Exonic
1072948543 10:99832645-99832667 GGAGGCAGAGGCCAAGCAAAGGG - Intronic
1073036023 10:100564757-100564779 GGATGAAGAGGTCAGCAGAATGG + Intergenic
1074112960 10:110435600-110435622 GGATCCATTGGCAAACAAAATGG + Intergenic
1075433191 10:122407477-122407499 GGCTCCAGAGGCCAAAAAACTGG - Intronic
1075613911 10:123877111-123877133 GGAAGCAGAGGCCAGAAAATGGG + Intronic
1077782191 11:5343146-5343168 GGTTGCAGATGGCAATAAAACGG + Exonic
1077832112 11:5884661-5884683 GGTTGCAGATGGCAACAAAGCGG - Exonic
1078215504 11:9308454-9308476 GAATGAAGAGTCCAACAGAAGGG - Intronic
1079495936 11:21044134-21044156 AGATGGAGAAGCCAACAAAGAGG + Intronic
1080026843 11:27624224-27624246 GGATGGAGGAGCCAACAAAATGG + Intergenic
1081235207 11:40638930-40638952 GCATGCAGTGGCCAAGAATATGG + Intronic
1082708126 11:56518717-56518739 GAAGGCAGAGGGCAAGAAAAGGG + Intergenic
1083160894 11:60853474-60853496 GGAAGCAGAGGCCAACAGGTCGG + Exonic
1083180443 11:60981736-60981758 GGCTGCAGGAGCCTACAAAATGG - Intronic
1085014282 11:73162733-73162755 GGATGCAGAGCTGAAGAAAAAGG + Intergenic
1085350236 11:75793544-75793566 GGAAGCTGAGGCCTAGAAAAGGG - Intronic
1088822362 11:113467320-113467342 GGATTCATAGACCAAGAAAAAGG + Intronic
1090264047 11:125342984-125343006 GGCTGGAGAGGAAAACAAAAGGG + Intronic
1090825602 11:130383363-130383385 GACTGCAGAGGCCAACAAGGTGG - Intergenic
1091135653 11:133186613-133186635 GAGTGCAGAGGCCACAAAAATGG - Intronic
1091988282 12:4932088-4932110 GGACCCAGACGCCAAGAAAATGG + Intergenic
1092693862 12:11146910-11146932 GGATGCAATAGACAACAAAAGGG - Intronic
1093881778 12:24412857-24412879 GGATGCTGAGGCCAGGAGAATGG - Intergenic
1095614199 12:44169272-44169294 GGAAGCAGTGGAAAACAAAATGG - Intronic
1098143593 12:67475681-67475703 GGATACAGAGGCCATTAAAGGGG - Intergenic
1099544059 12:83954274-83954296 GGAAGCAGAAGCCAATAAAAAGG - Intergenic
1100628447 12:96361311-96361333 GGAAGAAGAAGCAAACAAAAAGG + Intronic
1101730935 12:107426356-107426378 GGATGCAGAGGGCAGCCCAATGG - Intronic
1102408099 12:112691516-112691538 GGATGCAGTGTTCACCAAAAGGG - Intronic
1103012720 12:117469584-117469606 AGATGCAGAGGGGATCAAAAAGG + Intronic
1103046655 12:117741096-117741118 GGATGCAGTGGCCAGCTAGAAGG + Intronic
1103188223 12:118980097-118980119 AGATGAAGAGGCCAACAGAGAGG - Intergenic
1103873064 12:124105221-124105243 GGAAGCTGAGGCCAAGAGAATGG - Intronic
1105291908 13:19058703-19058725 GGCTGAAGAGGCCAAGGAAAAGG + Intergenic
1110920621 13:81079726-81079748 GGATGCTGAGGAGAACACAAAGG - Intergenic
1110954803 13:81540741-81540763 GGAGGCAGAGAAGAACAAAAGGG - Intergenic
1113944409 13:114035751-114035773 GGATGCAGAGGCCATGAGGAAGG + Intronic
1114574826 14:23702384-23702406 GTGTACAGAGGCAAACAAAAAGG + Intergenic
1117815905 14:59597552-59597574 GAATTCAGTGGTCAACAAAAGGG + Intronic
1119205199 14:72788760-72788782 AGATGTAAAGGCCAACAAAGGGG + Intronic
1121224688 14:92312588-92312610 GGAAACTGAGGCCAAGAAAAGGG - Intergenic
1122265048 14:100542590-100542612 GGATTCAGAGCCCAAACAAAAGG - Intronic
1122534140 14:102450614-102450636 AGCTGCAGAAGCCAACACAAAGG - Exonic
1126333102 15:47555263-47555285 GGAGGCAGAGGCCATCACAGAGG - Intronic
1128146550 15:65335196-65335218 GGCTGCAGAGGCCAGCTGAAGGG + Intronic
1128283150 15:66413983-66414005 GAATGCAGAGGATATCAAAAGGG - Intronic
1129478858 15:75807250-75807272 GGGTGCAGTGGCCAAAAAAGGGG - Intergenic
1130025665 15:80268596-80268618 GGATGCAGAGGTCAACGCAGAGG + Intergenic
1130227509 15:82071005-82071027 AGACGAAGAGGCCAACAACAAGG - Intergenic
1130584847 15:85172876-85172898 GGGTGCAGTGGCCAGAAAAAGGG - Intergenic
1131539654 15:93265629-93265651 GGATTCAGAAGACAAGAAAACGG - Intergenic
1135073063 16:19369280-19369302 GGAGACAGATGCCAACTAAAAGG + Intergenic
1135729448 16:24882156-24882178 GGATGCAGAGGCCAACAAAATGG - Intronic
1139191538 16:64869157-64869179 GGACACAGAGAACAACAAAAGGG - Intergenic
1139654875 16:68381401-68381423 GGAAGCAGAGGTAAACTAAAGGG - Intronic
1140486522 16:75297871-75297893 GGAAGCAGAGGACAAGAGAAGGG + Intronic
1141472753 16:84250690-84250712 GGCAGCAGAGGCCAGGAAAAGGG + Intergenic
1142991836 17:3736522-3736544 GGAAGCTGAGGCCAAGAAACGGG - Intronic
1144453279 17:15398756-15398778 AGAAGCAGAGGTCAAAAAAAGGG - Intergenic
1146543337 17:33717160-33717182 GTATTCAGAGGCACACAAAAAGG + Intronic
1146940036 17:36838070-36838092 GGAGGAAGAGGCCAAGGAAAAGG - Intergenic
1147190548 17:38735648-38735670 GGAGACAGAGTCCAACTAAAGGG + Intronic
1148727585 17:49805521-49805543 GGATACAGTGGCCAACAAGATGG + Intronic
1148859082 17:50594756-50594778 GAGTGCAGAGGCCAAAAAGATGG - Intronic
1151248230 17:72812949-72812971 GGTTGTAGAGGCCAACACTAAGG - Intronic
1151787568 17:76282682-76282704 GGATGCAGAGGAGAACACCAGGG - Intronic
1151932489 17:77241394-77241416 GGGTGGACAGGCCAACAAAGGGG - Intergenic
1151967087 17:77437106-77437128 GGATGCTGATGCCAACCGAATGG - Intronic
1152415546 17:80158990-80159012 GGATGCAGAGCCCAGGACAAAGG + Intergenic
1153531652 18:6052824-6052846 GAAAGAACAGGCCAACAAAATGG + Intronic
1154280167 18:12995573-12995595 GAATGCAGTGGCAAACCAAATGG + Intronic
1156020302 18:32592795-32592817 GGAAGAAGAGGCCATTAAAATGG + Intergenic
1156104795 18:33647226-33647248 GCATGCAGAGGACAAACAAAGGG - Intronic
1157300703 18:46477127-46477149 AGAAGCAGAGGCCATCAAGATGG - Exonic
1159596402 18:70386552-70386574 GGATGCAGAACCCAAGAATATGG + Intergenic
1159890236 18:73946099-73946121 AGATGCACAGGTGAACAAAATGG + Intergenic
1160937209 19:1602370-1602392 GGAGGCAGATGCCACCAACAGGG + Intronic
1161857794 19:6775647-6775669 GGCTTCAAAGGGCAACAAAATGG - Intronic
1162173191 19:8807574-8807596 GCATGCAAAGGCCCACAACAAGG - Exonic
1166108854 19:40610821-40610843 GGATGCAGAGGCCAAGTGATGGG + Intronic
1167143024 19:47665170-47665192 GGGTGCTGAGGACAGCAAAAGGG - Intronic
1167592162 19:50409888-50409910 GGATACAGAGGGGAACAAAATGG + Intronic
929550735 2:42889802-42889824 GGTTGCAGATGCCAACACAGGGG + Intergenic
930441537 2:51414161-51414183 GGATGCAGAGGGAAGAAAAAGGG + Intergenic
931371755 2:61669582-61669604 GGATGCAGGGGTGAACAAAAAGG - Intergenic
932316749 2:70789981-70790003 AGATGCAGAGAGCAAGAAAAAGG + Intronic
936710727 2:115128061-115128083 GCATCCAGAGGGGAACAAAAAGG - Intronic
937024156 2:118683434-118683456 GGGTGCAGGGGCCAAGAACATGG + Intergenic
937095161 2:119230537-119230559 GGATACAAAGGCAAACATAATGG - Intronic
937556065 2:123157599-123157621 AGATGCAGAGGACAACACCATGG - Intergenic
937730888 2:125227525-125227547 GGATACAGAGGCCAGGAAATGGG - Intergenic
940176616 2:150884609-150884631 GTGATCAGAGGCCAACAAAATGG + Intergenic
941087606 2:161135469-161135491 GGATGAAGAGACCAAAGAAAGGG + Intergenic
941147792 2:161873916-161873938 GGACTGGGAGGCCAACAAAAGGG + Exonic
943272103 2:185819300-185819322 AGATGCAGAAAACAACAAAATGG + Intronic
943663046 2:190579141-190579163 GGTTTCAAAGGCCATCAAAAAGG - Intergenic
946243433 2:218371181-218371203 GGATGCTGTGGCCAGCAAACAGG + Intergenic
1170035960 20:11990322-11990344 AAATGCAGTGGCCAAAAAAATGG - Intergenic
1171104734 20:22421571-22421593 GGAAGCAGATGCCAAGAAGAAGG - Intergenic
1173437472 20:43045999-43046021 GAATGCAAAGGCCAAGAAATGGG + Intronic
1173869418 20:46332270-46332292 GGATGCAGAGGGAGACAAACAGG - Intergenic
1174704377 20:52640559-52640581 GGATGCAAAGGCAAAGACAATGG - Intergenic
1179001192 21:37460363-37460385 GGAGGCAGTAGCGAACAAAAGGG + Intronic
1184483380 22:44761221-44761243 GAATACAGAGGCCACCAATACGG - Intronic
1184969632 22:48006591-48006613 AACTGCTGAGGCCAACAAAAAGG - Intergenic
1185173399 22:49306107-49306129 AGATGCAGAGGCCAGGAAGACGG + Intergenic
949998996 3:9641945-9641967 GGATCCAGAGGCCACCCAAAGGG - Intergenic
950757189 3:15185153-15185175 GGAGGTAGGGGCCAACAAACTGG - Intergenic
953262998 3:41358449-41358471 GGATGCAGAGGCAGAGAAAGGGG + Intronic
953932675 3:47013521-47013543 TGAGGCAGAGGCCCAGAAAAGGG + Intergenic
959549978 3:107643433-107643455 GGAAGCAGAGGCCTTGAAAAGGG + Intronic
959926078 3:111923332-111923354 GTACACAGAGGCAAACAAAAGGG - Intronic
960214987 3:115022632-115022654 GGAGGCAAAGGACAACAAATTGG - Intronic
963006638 3:140732346-140732368 GAAAGCAGAGCCCAACACAAGGG - Intergenic
964512450 3:157467674-157467696 GGAGGCAGAAGCCACTAAAATGG - Intronic
964892213 3:161551082-161551104 GAATGCAGAGGCCCACTAAGAGG - Intergenic
965603184 3:170474550-170474572 GGAGGCAGAGGAAAAAAAAACGG - Intronic
967076638 3:186009171-186009193 GGATGCATGGTCCAACAGAAGGG + Intergenic
967124136 3:186409334-186409356 GGGTGCAGAGGAAGACAAAAAGG - Intergenic
969843187 4:9898767-9898789 GGAGGCAGAGCCCAACCAACAGG - Intronic
969959892 4:10933834-10933856 GGATGAAGATGTCAACAATAAGG - Intergenic
972266514 4:37465327-37465349 GGATACAAAGGTGAACAAAATGG + Intronic
973581360 4:52347531-52347553 GGTTGCAGAGGACATCAAAAAGG - Intergenic
974736412 4:65939118-65939140 GGATACACAGAACAACAAAAAGG + Intergenic
974812636 4:66965029-66965051 GGATGTAGGGGCCAAAAAATAGG - Intergenic
976439818 4:85060422-85060444 TGATGCAGTGGTTAACAAAAGGG + Intergenic
977346626 4:95824413-95824435 GGACACAGATGCCAACTAAATGG + Intergenic
978005573 4:103612000-103612022 GGAAGCAGAGGCCAATTAGATGG - Intronic
978597837 4:110397835-110397857 GGATGCGGAGCCCAGAAAAATGG - Intronic
979670664 4:123357248-123357270 GGATGCTGAGGGCCACAAAGAGG - Intergenic
981349449 4:143711910-143711932 AGATGGAGAAGACAACAAAACGG + Intergenic
981934979 4:150229415-150229437 GGATTCAGAGGCCACCAAGGAGG + Intronic
982884563 4:160762631-160762653 GGAGGCACAGGCCACCAGAAAGG - Intergenic
986694836 5:10342467-10342489 GGATGCAGAACCCAAGAACAGGG + Intergenic
987164608 5:15182685-15182707 TGAGGCAGAGACCAAGAAAATGG - Intergenic
988989101 5:36651747-36651769 GGATGGAGAGCTGAACAAAATGG - Intronic
990558249 5:56957764-56957786 GGAAGCAGGGGCCAAGAAAGTGG - Intronic
992100189 5:73400363-73400385 GGAGGCAGAGACCTCCAAAAAGG - Intergenic
993001597 5:82386767-82386789 AGATGCAGGAGCCAACAAGAGGG - Intronic
993323753 5:86508123-86508145 GAATGCAGAGGGCAATAAATTGG - Intergenic
993540058 5:89138170-89138192 GTAAACAGAGGCAAACAAAATGG - Intergenic
993978184 5:94508627-94508649 AGATGCAGATGCTGACAAAAAGG + Intronic
997584877 5:135038297-135038319 GGATGCAGAGGCCTCCAGACAGG - Intronic
997751847 5:136354448-136354470 GGTTGCAGGGGCCCACAAATTGG - Intronic
998485971 5:142502580-142502602 GGCTGCACAGGCCACCAAAGAGG - Intergenic
1000052435 5:157574960-157574982 GGAAACCGAGGCCCACAAAAGGG - Intronic
1000779080 5:165456942-165456964 GTAAGCTGAGGCCAAGAAAATGG - Intergenic
1001884624 5:175278180-175278202 GAATGCAGAGGAGAAAAAAAGGG + Intergenic
1003040303 6:2681748-2681770 GGATGCAGAGATCATCATAAAGG - Intronic
1003260171 6:4509789-4509811 GGATGTTGAGGCCAACGAGAAGG + Intergenic
1003522197 6:6867828-6867850 GCATGCAGAGGCCCACACTATGG + Intergenic
1004004561 6:11627065-11627087 AGGTGCAAAGGGCAACAAAAGGG + Intergenic
1005340023 6:24834929-24834951 GAATGCAGAAGCTAATAAAATGG - Intronic
1005690154 6:28297056-28297078 GGAGGCAGAGGCCAGAAGAAGGG - Intronic
1005797001 6:29374909-29374931 GATTGCAGATGGCAACAAAACGG + Exonic
1007189904 6:40004515-40004537 GGATGTGCAGGCAAACAAAATGG - Intergenic
1009833161 6:68965338-68965360 GGATGCAGAGGAAAATAAGACGG - Intronic
1010958135 6:82114800-82114822 GGAAGCAGAGGCAAACAGTAGGG - Intergenic
1013165294 6:107584605-107584627 TGATGCAGAGGTGAACATAATGG + Intronic
1013322911 6:109012708-109012730 ATATGCAGAGGCCCAGAAAAAGG + Intronic
1020776365 7:12458920-12458942 AGATGTAGAGACCAACACAACGG - Intergenic
1020820717 7:12963961-12963983 GGATACAGACACAAACAAAATGG - Intergenic
1020969126 7:14911912-14911934 GTATGCAGATGCCAGAAAAAAGG + Intronic
1023105233 7:36757275-36757297 AGATACAGAGGCCAAACAAAAGG + Intergenic
1023282352 7:38584192-38584214 GGACACAGAGGCCAACATGAAGG - Intronic
1023360668 7:39412120-39412142 GGAAACAGAGGCCCAGAAAAAGG - Intronic
1023389923 7:39699915-39699937 GGATGCAGAGCCCACCGACATGG - Intronic
1023896115 7:44434292-44434314 GGCTGCAGAGGCCAAGACCAAGG - Intronic
1024151746 7:46578697-46578719 GAGTTCAGAGGCCAATAAAACGG + Intergenic
1024257414 7:47549087-47549109 GCATCCACAGGCCAACCAAATGG + Intronic
1024707280 7:51973929-51973951 GGAGTCAGAGGCCAAAGAAATGG + Intergenic
1026045097 7:66901715-66901737 GCCTGGAGAGGCCACCAAAAGGG - Intergenic
1026124758 7:67569902-67569924 TGATGCAGAAGCAAAGAAAAAGG - Intergenic
1026689405 7:72539082-72539104 GGATGCAATGGCCAAAGAAATGG + Intergenic
1027147997 7:75711745-75711767 AGATGCAGAGGCCAGGAAAGAGG - Intronic
1029389010 7:100262468-100262490 GGATGAACAGATCAACAAAATGG - Intronic
1031872770 7:127104892-127104914 TGTTGCAGAATCCAACAAAATGG - Intronic
1032019864 7:128401333-128401355 GGCTGCAGAGAAAAACAAAAAGG + Intronic
1032105040 7:129020947-129020969 GGAAGCAGAGGCAAACAACAGGG + Intronic
1032612566 7:133430935-133430957 GGATACAGAAGTGAACAAAATGG - Intronic
1033060965 7:138106795-138106817 GGTTGCACAGGCAAACCAAAAGG - Intronic
1033160281 7:138990166-138990188 GGGAGGAGAGGCAAACAAAAAGG + Intergenic
1033811253 7:145014703-145014725 GGATACAGAAGGCAGCAAAAAGG + Intergenic
1035735005 8:1881492-1881514 GGGTGCAGGGGCCAAGGAAATGG + Intronic
1037992046 8:23328156-23328178 GGAAGCAGAGGCCCAAAAGACGG - Intronic
1039522547 8:38183639-38183661 GGAATCAGAAGCCAAGAAAAAGG - Intronic
1039533749 8:38288531-38288553 TGATGCAGAGATCATCAAAACGG - Exonic
1040336471 8:46418573-46418595 GGACGCAGAGGCCGACAGAGGGG + Intergenic
1040453988 8:47577527-47577549 GGATGCAGAACCCACCAATACGG - Intronic
1042018341 8:64342353-64342375 GCATGCTGGGGCCTACAAAAGGG + Intergenic
1045774209 8:105782723-105782745 GGATGCAGAACCCAACCATATGG + Intronic
1047932500 8:129744218-129744240 GGAAGCACAGGCAAACAAACAGG - Intergenic
1048194898 8:132324339-132324361 GGATGCAGAGGCATATAAATAGG - Intronic
1048586148 8:135776019-135776041 GAATGTAGAGGCCAACCAATGGG - Intergenic
1050894055 9:10863288-10863310 GTATGCAGATGCCAAAAAATAGG + Intergenic
1051930637 9:22381062-22381084 GGCTGCAGAGGCCTCCAAAATGG - Intergenic
1053341855 9:37343385-37343407 GGAGGCTGAGGCCTACAAAATGG - Intronic
1054781544 9:69170678-69170700 AGAGGGAGAGGCCAACAACATGG - Intronic
1056332110 9:85529540-85529562 GGAAGCAGAGGCAACCAACAGGG - Intergenic
1057054234 9:91949243-91949265 GGTTTCAGGGACCAACAAAAGGG + Intronic
1057569753 9:96195434-96195456 GGAAGGAGAAGCCAACAAAATGG - Intergenic
1057910737 9:99018195-99018217 GGATTCAGAGTCAAACAAACTGG - Intronic
1058348038 9:103987969-103987991 GTATGCAGGGGCATACAAAATGG + Intergenic
1061267972 9:129519272-129519294 GGCTCCAGACCCCAACAAAAGGG - Intergenic
1189077267 X:37929575-37929597 CCATGCAGAGGAAAACAAAAGGG + Intronic
1189724907 X:43958683-43958705 GGAGGCAGAGGACAAAAAATTGG + Exonic
1194207226 X:91026159-91026181 GGATGCAGAACCCAAAAATATGG + Intergenic
1195383896 X:104295816-104295838 GGATGAAGAGGCCAAGTTAATGG + Intergenic
1195570783 X:106396606-106396628 TGAAGAAGAGGCCACCAAAATGG - Intergenic
1196654391 X:118201809-118201831 AGATGAAGAGGCCAAGATAATGG - Intergenic
1197148183 X:123191604-123191626 GTAGGCAGAGACCAGCAAAAGGG - Intronic
1200032847 X:153310424-153310446 GGAGGCAGCTGGCAACAAAATGG - Intergenic
1201672699 Y:16542013-16542035 AGATGCAGAGGCAAACACAGTGG - Intergenic