ID: 1135729454

View in Genome Browser
Species Human (GRCh38)
Location 16:24882178-24882200
Sequence CCTACCACGTAGAACTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 45}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135729448_1135729454 -1 Left 1135729448 16:24882156-24882178 CCATTTTGTTGGCCTCTGCATCC 0: 1
1: 0
2: 0
3: 13
4: 230
Right 1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135729454 Original CRISPR CCTACCACGTAGAACTTGGT GGG Intronic
905409061 1:37755829-37755851 CCTACCTCTCAGAACTTGGGTGG + Intronic
920688685 1:208129379-208129401 GCTACAACATAGAACTTGGTAGG - Intronic
923041750 1:230324620-230324642 CTTACCACTTAGAACAGGGTTGG - Intronic
1068334503 10:55614835-55614857 CCTACGAAGTAAACCTTGGTTGG - Intronic
1072508119 10:96090384-96090406 CCTAACACGTAAAACGTGTTGGG - Intergenic
1073486651 10:103823494-103823516 CCTAGCACATGGAACTTGCTAGG - Intronic
1078114488 11:8432070-8432092 CCTAGCACCTAGTACCTGGTAGG + Intronic
1087740459 11:101881297-101881319 CCAACCACGAAGAAGTTGGAGGG + Intergenic
1103256000 12:119541966-119541988 CTTAACACCTAGAACTTGGTTGG - Intergenic
1103716178 12:122946715-122946737 GCCACCATGTAGAACTTGGCTGG - Intronic
1115808654 14:37080623-37080645 ACTACTACTTAGTACTTGGTAGG + Intronic
1117909461 14:60622933-60622955 CAAACCACGCAAAACTTGGTAGG + Intergenic
1132604281 16:787252-787274 GCAACCACGTAGAGCGTGGTGGG + Intronic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1138769529 16:59647593-59647615 CCTACCACATAGGATTTTGTAGG + Intergenic
1139498472 16:67339787-67339809 CATACCACGGAGAAATTAGTGGG - Intronic
1145190289 17:20835774-20835796 CCTACCAAGTAAACCTTGGTTGG - Intergenic
1145401502 17:22539652-22539674 CCTACCAAGTAAACCTTGGTTGG - Intergenic
1153468389 18:5415569-5415591 CATCCCACGTAGAACTCAGTGGG + Intronic
1159845764 18:73458094-73458116 CCTACCACGTAGGAGTTTGGGGG - Intergenic
934706976 2:96488406-96488428 CCAACAAAATAGAACTTGGTTGG - Intergenic
943527550 2:189036678-189036700 TGTACCACGTAAAACCTGGTGGG - Exonic
946174617 2:217914866-217914888 TCTGCAAAGTAGAACTTGGTAGG - Intronic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
950036743 3:9891226-9891248 CCTACCACGTAATATATGGTAGG + Intronic
950255352 3:11500252-11500274 TCTAACATGTAGAATTTGGTTGG + Intronic
953801907 3:46031093-46031115 CCTGCCCCTTAGAAGTTGGTGGG + Intergenic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
955060632 3:55489027-55489049 CCTGCCACGGAGATCTTGGCGGG + Intronic
959568835 3:107860357-107860379 CCTTCCAGGTAGAAATGGGTAGG + Intergenic
982016505 4:151159657-151159679 TCTAGCACATAGATCTTGGTTGG - Intronic
985736089 5:1584151-1584173 CTTACAATGTAAAACTTGGTGGG - Intergenic
986144973 5:5069464-5069486 CCTACAACGGAGTACTTGGATGG - Intergenic
992763778 5:79975788-79975810 CCTTCCAAGTAGAACTGTGTAGG - Intergenic
996210140 5:120798458-120798480 CCTACCAGGTAGCACATTGTGGG + Intergenic
1004773192 6:18810379-18810401 CCTTCCACGTAGAACAGAGTGGG + Intergenic
1006786494 6:36671098-36671120 CCTATCCCATAGAAGTTGGTGGG + Intergenic
1007037208 6:38687072-38687094 CCTACCACCTACAACTTGCAAGG + Intronic
1009663894 6:66651495-66651517 CCTACCACTTTGGTCTTGGTGGG + Intergenic
1012635766 6:101538898-101538920 ACTACCACATAAAATTTGGTTGG - Intronic
1019748887 7:2716565-2716587 CCTCCCCCTTTGAACTTGGTGGG - Intronic
1033922283 7:146409032-146409054 CCTACAACTTAGAATATGGTAGG + Intronic
1038469804 8:27805606-27805628 CCTACCACCCAGATCTTGGTTGG + Intronic
1040528877 8:48249204-48249226 CCTACAATTTAAAACTTGGTGGG - Intergenic
1044888445 8:96805866-96805888 CCTCCACCATAGAACTTGGTAGG + Intronic
1189845100 X:45128668-45128690 CCTAGCAGGGAGAACTTGGGTGG + Intergenic
1195419605 X:104659151-104659173 CCTACCACTGAGAAATTGTTGGG + Intronic
1195712806 X:107788110-107788132 CCTAAAAAGTAGAGCTTGGTTGG - Intronic
1200970753 Y:9150077-9150099 CCTACAATTTAAAACTTGGTGGG - Intergenic
1200978500 Y:9239280-9239302 CTTACCATTTAAAACTTGGTGGG + Intergenic
1202140272 Y:21714236-21714258 CCTACAATTTAAAACTTGGTGGG + Intergenic