ID: 1135730524

View in Genome Browser
Species Human (GRCh38)
Location 16:24891266-24891288
Sequence AAAGCTGCTGATATTTGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 285}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135730522_1135730524 3 Left 1135730522 16:24891240-24891262 CCTCTGTGAATGGGAATGACAAA 0: 1
1: 0
2: 3
3: 25
4: 243
Right 1135730524 16:24891266-24891288 AAAGCTGCTGATATTTGCAAAGG 0: 1
1: 0
2: 2
3: 15
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135730524 Original CRISPR AAAGCTGCTGATATTTGCAA AGG Intronic
903363440 1:22791827-22791849 ATTGCTGCTGATATTTGCGTAGG + Intronic
908120627 1:60983058-60983080 AGAGATGTTGATATTTGCTAAGG - Intronic
910911644 1:92240915-92240937 AAATCAGGTGATATTTGAAATGG + Intronic
911360441 1:96869474-96869496 ATAGCTGCAGAAATTTGCATAGG + Intergenic
911806375 1:102213278-102213300 ACAGCTGCTGACATTGGGAAAGG + Intergenic
911864607 1:103002132-103002154 CAAGCTGCTCTTTTTTGCAAAGG + Intronic
916514571 1:165503852-165503874 AAAGCTAGCAATATTTGCAAAGG + Intergenic
916656520 1:166881216-166881238 AGAGCTGCTGATGTCTGAAATGG - Intergenic
918437396 1:184530092-184530114 AAAGCATCTACTATTTGCAAAGG - Intronic
919161597 1:193837488-193837510 ATAGTTGCTTATATTTGGAAGGG - Intergenic
921692878 1:218172620-218172642 AATACTGCTGATATGTGAAAAGG + Intergenic
922014810 1:221634500-221634522 CCAGCTGCTGATATATGCATAGG + Intergenic
924235669 1:241997834-241997856 AAAGGTGCTGGTCTCTGCAACGG + Intronic
924625358 1:245692929-245692951 TCAGCTGCTGATATGTGCACTGG - Intronic
1063255708 10:4325072-4325094 AAGGCTGCTTATATTTGCTTAGG - Intergenic
1064334531 10:14426622-14426644 AATGATGGTGATCTTTGCAAGGG - Intronic
1064535416 10:16352920-16352942 AAAGCCACTGATAGTTGCCAGGG + Intergenic
1064600490 10:16987506-16987528 ACAGCTGCTGCTTTTTGCAATGG + Intronic
1067273909 10:44818128-44818150 ACAGCTGCTGATTTTGGCTAAGG - Intergenic
1067497590 10:46774090-46774112 AACACTGCTGACATTTGCAGAGG - Intergenic
1067597060 10:47566324-47566346 AACACTGCTGACATTTGCAGAGG + Intergenic
1068399333 10:56508572-56508594 CCAGCTGCAGATATTTGCATAGG + Intergenic
1069308150 10:66998170-66998192 AAATCTGGTGAGATATGCAAAGG - Intronic
1070011002 10:72474502-72474524 AATGTTGCTGAGAGTTGCAAAGG - Intronic
1070140419 10:73733946-73733968 AACACTGCTGACACTTGCAAAGG + Intergenic
1072002942 10:91215626-91215648 AGAGCTGCTGATACTGGCCATGG + Intronic
1072203553 10:93182201-93182223 AATGATGGTGATATTTACAACGG + Intergenic
1072654757 10:97322113-97322135 AAAGCTGCCTCTATTAGCAAAGG + Intergenic
1073459523 10:103658659-103658681 TCAGCTGCAGATATTTGCACAGG - Intronic
1075781460 10:125020168-125020190 AAAGCTGTTGATCTTGGCCAAGG - Intronic
1076072891 10:127506018-127506040 AAAACTTGTGGTATTTGCAAAGG - Intergenic
1077249856 11:1556191-1556213 AACACTGCTGACCTTTGCAAAGG - Exonic
1078678286 11:13448390-13448412 ATAAATCCTGATATTTGCAAGGG - Intronic
1078737478 11:14033702-14033724 AATGCCCCTGATATTTGAAAAGG + Intronic
1079642082 11:22818193-22818215 AAAGTTGATGAAAATTGCAATGG - Intronic
1080557791 11:33432535-33432557 AAAGCTGCTGAGATTCTGAAGGG + Intergenic
1083740299 11:64706710-64706732 AAAGGAGCTGATATGAGCAAAGG - Intronic
1086809813 11:91295121-91295143 AAAGCAGCTGGTATTTGGCAGGG - Intergenic
1088121152 11:106371529-106371551 AAACCTGCTGATATTTTGATTGG + Intergenic
1089033786 11:115362973-115362995 AAAGCTGTTGTTATCTGCTAAGG + Intronic
1090460463 11:126887228-126887250 AAAGCTCCTGATAATTGCCCAGG + Intronic
1090839267 11:130474600-130474622 AAAGATGTTGACATTTGCTAGGG + Exonic
1092325442 12:7527010-7527032 GAAGTTGCTGATTTTTGGAAGGG + Intergenic
1092812765 12:12286998-12287020 AGAGCTGCTGAGAATTGCTAGGG - Intergenic
1094468728 12:30782389-30782411 GAAGTTGGAGATATTTGCAAGGG + Intergenic
1094642455 12:32289188-32289210 AAAGCTTCTGAAACTTGCAAAGG + Intronic
1095329949 12:40948212-40948234 AAAGCTTCTGGAATTTCCAATGG - Intronic
1095764391 12:45878350-45878372 AAAGCTGCAAATATATGCAGTGG - Intronic
1098492219 12:71094785-71094807 GAAGCTGTTGTTATTTCCAAGGG - Intronic
1098498116 12:71160350-71160372 AGAGCTACAGAGATTTGCAATGG + Intronic
1098544485 12:71696460-71696482 AAAAAAGCTGAAATTTGCAATGG - Exonic
1099808738 12:87553574-87553596 ACAGTTGCTGATATTGCCAAAGG - Intergenic
1100164894 12:91905890-91905912 AAAGCAGCTTATATTTAAAAGGG + Intergenic
1101246710 12:102890659-102890681 AAAGTTGTTGATATTTGAAGTGG - Intronic
1103665731 12:122563881-122563903 AAAACAGCTGGTATTTGCAAAGG + Intronic
1103667131 12:122577623-122577645 AAAACAGCTGGTATTTGCAAAGG - Intronic
1105727948 13:23184543-23184565 AAATTTGCTGTTATTTACAAAGG - Intronic
1106459303 13:29954814-29954836 AATGGTGCTGAGATTTGCAAAGG + Intergenic
1106827564 13:33541001-33541023 AGAGTTGAGGATATTTGCAAAGG + Intergenic
1107048761 13:36024690-36024712 AAGGCAGCTGAGATTTTCAATGG - Intronic
1107963794 13:45581157-45581179 AGATCTGCTAAGATTTGCAATGG + Intronic
1109970102 13:69756914-69756936 AAAGTTGATGATATTTGCAAAGG - Intronic
1110516359 13:76417363-76417385 AAAGCTATTTATGTTTGCAATGG + Intergenic
1110593910 13:77296574-77296596 AAAGCTGCTGGTAATTGATAAGG - Intronic
1110755062 13:79162606-79162628 AAGGCAGCTGATATATCCAAGGG + Intergenic
1111111066 13:83710157-83710179 AAAGCTGGTACTATTTGCCAAGG - Intergenic
1111713135 13:91843438-91843460 ACAGCTGCTGAAATGTACAAAGG + Intronic
1113099436 13:106701417-106701439 ATAAATGCTCATATTTGCAAAGG + Intergenic
1113245838 13:108394368-108394390 AAAGCTACAGATATATGAAAGGG - Intergenic
1114958292 14:27849950-27849972 GAGGCTGCTGATATTCGGAAGGG - Intergenic
1116785711 14:49286308-49286330 AAAGCTGTGGATATTTATAATGG - Intergenic
1117262773 14:54053688-54053710 AAAGATGTTGATAACTGCAAAGG + Intergenic
1118373287 14:65155882-65155904 AAAGCTGCTTATAGTTGAAATGG + Intergenic
1119575580 14:75718495-75718517 AAAGCTGCTTATTTTTGCTGAGG + Intronic
1120625494 14:86820550-86820572 AAAGTTGCTGAGCTTTGTAAAGG + Intergenic
1123845322 15:24294648-24294670 AAATCTCCTGAAATTTGAAAGGG - Intergenic
1124200667 15:27676422-27676444 AAAGCTGCTCATACTTACACAGG + Intergenic
1126184320 15:45816411-45816433 AAAGCTTCTAATATTGGTAAAGG - Intergenic
1126838103 15:52688121-52688143 AAAGCTGCTAATTTCTGGAATGG + Intronic
1127407199 15:58662782-58662804 AAAGCTCCAGATATCTGCACAGG - Intronic
1127489324 15:59447583-59447605 AAAGCTCCTGCTATTAGCATTGG + Intronic
1127619833 15:60723047-60723069 TAGGCTGCTGAGATTTTCAAGGG + Intronic
1130144908 15:81266703-81266725 AAAGCTCCTGATCTCTCCAAAGG + Intronic
1130958474 15:88644069-88644091 GAAGCTGGTGGTATTTGAAAGGG + Intronic
1131496357 15:92914650-92914672 AATGCTGCTTATAATTTCAAGGG - Intronic
1134340267 16:13338423-13338445 ATATCTGCTGATATTTGAAGTGG + Intergenic
1134889274 16:17824537-17824559 GAAGTTGATCATATTTGCAAGGG - Intergenic
1135730524 16:24891266-24891288 AAAGCTGCTGATATTTGCAAAGG + Intronic
1138704310 16:58898564-58898586 AAAGCTGCCGACCCTTGCAAAGG - Intergenic
1138845483 16:60560132-60560154 AAAGGTTCTGTTATTTTCAAAGG - Intergenic
1140239739 16:73190179-73190201 GAAGCTGCTGACATGTGTAATGG + Intergenic
1140693118 16:77503760-77503782 AATGCTGCTAATCTTTGCTAAGG - Intergenic
1142373376 16:89695067-89695089 AAAGGTGCTGATCTCTGCACGGG + Exonic
1143424881 17:6827630-6827652 AAACCTGCTGAGATTTTCATTGG + Intronic
1145085589 17:19936466-19936488 AAAGTTGCTTATACTTGCTATGG - Intronic
1146520985 17:33525381-33525403 GAAGCTGTAGATATTTCCAAGGG - Intronic
1146760783 17:35476116-35476138 AAAACTGCTGATTTCTGCATGGG - Intronic
1148481729 17:47964143-47964165 AAAGCTGTAGAAATATGCAAAGG - Intergenic
1149553143 17:57554938-57554960 AAACCTGCTGAGACTTCCAAGGG + Intronic
1153196154 18:2599076-2599098 AAAGGTGCTGAGAATTCCAAAGG + Exonic
1153719270 18:7885002-7885024 AAAGCTGCATAGATTTGGAAGGG - Intronic
1154262865 18:12853212-12853234 AAAGCTGCAGTGAGTTGCAATGG - Intronic
1155692615 18:28644413-28644435 AGTTCTGCTGATATTTGCTAAGG - Intergenic
1155942576 18:31814605-31814627 AAAGCTTCTCAGATGTGCAAAGG + Intergenic
1156207954 18:34906400-34906422 CAAGCTGCAAATATTTGCAAAGG - Intergenic
1156718432 18:40040609-40040631 CAAACTGCATATATTTGCAAAGG - Intergenic
1157708214 18:49827208-49827230 GAGGCTGCTGATCTTTGCTAAGG + Intronic
1158882917 18:61798384-61798406 AAAGCGGCTGATTTTTAAAAAGG - Intergenic
1159275160 18:66209840-66209862 AAAGCTGCTTTTAGTTACAATGG + Intergenic
1165165971 19:33856790-33856812 TAAACTGCTGGTATGTGCAATGG + Intergenic
925019388 2:556810-556832 AGAGCTGCAGATATTTACAAAGG - Intergenic
926025126 2:9535760-9535782 AAAGCTGCTCAGTTCTGCAAAGG - Intronic
926409758 2:12590698-12590720 AAAGGTGTTGCTATTTGCACTGG + Intergenic
929365337 2:41148213-41148235 AAATCTGCTAAAATTTGGAAGGG + Intergenic
930100652 2:47600567-47600589 AGTGCTGCTGATGTTGGCAAGGG + Intergenic
930746568 2:54889708-54889730 AAAACTATTCATATTTGCAAAGG - Intronic
931080999 2:58770686-58770708 AAAGTTGCTGAAATTTCCCAGGG + Intergenic
933457396 2:82533967-82533989 AAAGCTGCTTTTTTTTACAAAGG + Intergenic
934466662 2:94269074-94269096 AAAGCTGTTGGTGTTTGTAAAGG + Intergenic
934479003 2:94618101-94618123 GAGGCTGCTGATCTTTGGAAGGG + Intergenic
935341441 2:102063222-102063244 CAAGCAGCTGATATTTACTAAGG + Intergenic
935467051 2:103411104-103411126 AAAGCTGCTGATATCAACATTGG + Intergenic
937670466 2:124532635-124532657 AAAGCTGCTGCCACTTGCACTGG - Intronic
939721149 2:145653428-145653450 AAACCTGCAGATGTTAGCAAGGG + Intergenic
941576173 2:167233251-167233273 AAAGCTGGAGATTTTGGCAAAGG + Intronic
942192267 2:173482012-173482034 AAGGCTGCAGTTATTGGCAATGG + Intergenic
942651540 2:178174134-178174156 AAAGCTGCAGGTGTTTGCAGCGG + Intergenic
942785164 2:179692698-179692720 AAAGTTGCTAATATTTGGAGAGG - Intronic
944836632 2:203586677-203586699 ATAGCATCTGACATTTGCAAGGG + Intergenic
945216130 2:207436061-207436083 CAAGCCGCTGAAATTTGCATTGG - Intergenic
946452465 2:219792559-219792581 AATGCTGATGATAATTGCAAAGG + Intergenic
946474610 2:219995334-219995356 ATAGCTGCTGATATGGGCCAGGG + Intergenic
947684756 2:232073113-232073135 AAAGCAACTGATATTTCCACAGG - Intronic
947948498 2:234127212-234127234 AAACTAGCTTATATTTGCAATGG - Intergenic
1169105886 20:2994150-2994172 TAATCTGCAGATATTTGCCATGG - Intronic
1169542744 20:6618191-6618213 TAAGCTGCTGAGATTTGAGATGG - Intergenic
1173029913 20:39347175-39347197 AAACCTGCTGATATTTGAAAGGG - Intergenic
1174755429 20:53153758-53153780 TAAGCTGCTGAGTTTTGGAATGG - Intronic
1177240763 21:18453962-18453984 AAAGCATATGATATTTGCCAGGG + Intronic
1178266478 21:31147046-31147068 TAACCTGCTGATATTTCCAGTGG - Intronic
1178286063 21:31326394-31326416 AAGGCAGCTGAAATTTTCAAAGG + Intronic
1179364612 21:40745438-40745460 AAATCTGCTGAAACTTGCACTGG - Intronic
1185364016 22:50427204-50427226 ACAGCTGGTGATGTGTGCAAAGG + Intronic
949381440 3:3450148-3450170 AACACTGCTCATCTTTGCAATGG + Intergenic
949648070 3:6121300-6121322 AAAGCACCAGATATTAGCAAAGG - Intergenic
951146935 3:19238346-19238368 AATGCTGCAGATATATGAAATGG + Intronic
951549853 3:23866112-23866134 AAGGCTGTTTATATTTGCATAGG - Intronic
951645567 3:24886782-24886804 AAAGCTAATGATATCTGTAAAGG + Intergenic
952903880 3:38127176-38127198 CATGCTGCACATATTTGCAAGGG - Intronic
953355950 3:42256532-42256554 AAAACTAGTGATTTTTGCAAGGG + Intergenic
953579037 3:44136763-44136785 AAAATAGCTGATATTTTCAAAGG + Intergenic
953696029 3:45160211-45160233 AAAGCTGATGATACTTTAAATGG + Intergenic
955609299 3:60740106-60740128 AAAGTTGCTGACATTTGATAAGG + Intronic
955877028 3:63501619-63501641 AAAGCTGATGATGATAGCAAAGG - Intronic
955898610 3:63727311-63727333 AAAGTTGCTGACATCTGGAATGG + Intergenic
956196148 3:66655232-66655254 AAAGCTGCAGCTGTTTGCAAGGG + Intergenic
956403486 3:68904650-68904672 AAGACTGCTGATATGAGCAACGG + Intronic
956577630 3:70771142-70771164 AAAGCTGCTGATATCATTAAGGG - Intergenic
957668621 3:83270411-83270433 AAAGATGCTGGTATTTTCATAGG + Intergenic
957881973 3:86228246-86228268 AAAGCAGCTGGTAAATGCAAGGG + Intergenic
959074094 3:101732278-101732300 AACAGTGCTGATATTTGCCAGGG + Intronic
960582208 3:119290306-119290328 AAGACTGCAGATGTTTGCAATGG + Intergenic
961100651 3:124195780-124195802 ACAGCTGCTGAAGTCTGCAAAGG + Intronic
961760469 3:129163500-129163522 AAAGCTGCTGTGATTTACATCGG + Intergenic
962052634 3:131833751-131833773 AAAACTGGAGAAATTTGCAAAGG + Intronic
962343583 3:134604307-134604329 CAAGCTGCAGATCTTTGCCAAGG - Exonic
963049211 3:141127390-141127412 TAAGCTGCTGTTATTATCAAAGG - Intronic
964552022 3:157895609-157895631 TAAGCTGCTGATATTTGTACTGG - Intergenic
965627161 3:170692745-170692767 AAAGCTGCTGACATGAGAAAAGG - Intronic
970270743 4:14344800-14344822 CAAGGCGCAGATATTTGCAAAGG - Intergenic
970434132 4:16016743-16016765 AAAGTTACTCATATTTGCCAGGG - Intronic
970678019 4:18475093-18475115 ACATCTGCGGTTATTTGCAAAGG - Intergenic
971936018 4:33148559-33148581 AAAGCAGCTGAGATTTGAATAGG - Intergenic
974125131 4:57686879-57686901 AAAGCTGCTGATTATGGCATTGG + Intergenic
974624759 4:64410920-64410942 AAAGCCAAAGATATTTGCAAAGG + Intergenic
975487970 4:74955908-74955930 GAAGCTACTTATGTTTGCAAAGG + Intronic
975884091 4:78943675-78943697 AGTGCTGCTGAAATCTGCAAAGG - Intergenic
976236019 4:82898110-82898132 AAAGATAGTGTTATTTGCAAAGG - Intronic
976995175 4:91422845-91422867 AAAGCAGCTGGTGTTAGCAATGG + Intronic
977035971 4:91954134-91954156 AAAACTTCTGATTTTTGAAAGGG - Intergenic
977377385 4:96223224-96223246 AAAGCTGCCATTATTTGAAACGG - Intergenic
978625714 4:110683236-110683258 AAATCTCCTTACATTTGCAAAGG + Intergenic
978930150 4:114300855-114300877 AAATCTGCTGATAACTGCACTGG + Intergenic
981260013 4:142708327-142708349 CAAGCTGCAGAAATTTGCATAGG + Intronic
982365374 4:154572220-154572242 AAAGCTGTTGAAATTTTTAAAGG - Intergenic
982783514 4:159516062-159516084 AAAGCTGATTATATTAGCTAGGG + Intergenic
983116720 4:163827055-163827077 GAAACTGCTGGTATATGCAAAGG - Intronic
984968588 4:185165577-185165599 GAAGCTGATCTTATTTGCAAAGG + Intronic
985266396 4:188155407-188155429 AAAAATGCTGAAATGTGCAAAGG + Intergenic
986076337 5:4341388-4341410 AAAGGTGCTGACATGGGCAAGGG - Intergenic
986794032 5:11191768-11191790 AAAGCTGCCGCTCTTTGCCACGG - Intronic
987037838 5:14035991-14036013 AACGCTGCAGCTGTTTGCAAAGG + Intergenic
987287964 5:16478261-16478283 CAAGCTTCACATATTTGCAAAGG + Intronic
987511830 5:18849010-18849032 AAATGGGCTGAGATTTGCAAAGG - Intergenic
989510129 5:42276842-42276864 ATAGCAGCTGATTTTTTCAAAGG + Intergenic
989782739 5:45288854-45288876 AAAGCTTCTGTTATTAGCACAGG + Intronic
990063069 5:51676076-51676098 AAAGTTTCTCATATTTTCAATGG + Intergenic
990150742 5:52814654-52814676 TAAGCTCCTGATATTTGAACAGG + Intronic
990294540 5:54387343-54387365 AAACATGCTGAGATTTGTAAAGG + Intergenic
991283877 5:64947404-64947426 ACAGATGCTGATATATGCATGGG - Intronic
992014774 5:72564803-72564825 AAAGCTCTTGATCTTTCCAAGGG + Intergenic
992227028 5:74628948-74628970 TCAGCTGCTGAAATTTGGAAAGG - Exonic
992715592 5:79508390-79508412 AAAGATGCTTATCTTTCCAACGG + Intronic
995928825 5:117410133-117410155 TAAACAGGTGATATTTGCAAAGG - Intergenic
996292814 5:121873940-121873962 AAAAATGCTAATATTTGAAATGG - Intergenic
996464607 5:123785109-123785131 TATGCTGCTTATATTTACAAGGG - Intergenic
996517870 5:124393748-124393770 AAAGCTGCTTTTCTTTACAAAGG - Intergenic
999773335 5:154791948-154791970 GAAGCTGCTGAGACTTGCAGAGG + Intronic
999795779 5:154988628-154988650 ATAGCGACTGATATCTGCAAAGG - Intergenic
1000378219 5:160603990-160604012 CAAGCTGCTGATATTGGAATTGG - Exonic
1000896549 5:166861977-166861999 CAAGCTGCTGAAATTTAAAATGG + Intergenic
1001852785 5:174984144-174984166 AAAGCTGCTTAATTTTCCAAGGG + Intergenic
1002839271 6:892259-892281 GATGCTGCTGATATTGGCTATGG + Intergenic
1002896001 6:1380682-1380704 ATACCTGCAGATATTTTCAAAGG + Intergenic
1008367352 6:50697878-50697900 AGAGCTTCTGAGATTTGCCATGG + Intergenic
1011904740 6:92350885-92350907 AGGGCTGCTGATTTTTACAAAGG - Intergenic
1012395496 6:98791690-98791712 ATTGCTTCTGATATTTACAATGG - Intergenic
1012967788 6:105694040-105694062 AAAGCTACTGATGTTTCAAAAGG + Intergenic
1013200038 6:107885603-107885625 AAAGCTGCTGAAATTTACATTGG - Intronic
1013258000 6:108408429-108408451 AAAGCTCCAGATATCTGCATAGG - Intronic
1013262920 6:108464118-108464140 CAAGCTGTTGATTTTTGAAAAGG + Intronic
1013740826 6:113282275-113282297 AAACCTGCTGAAATTAGTAAGGG - Intergenic
1014067425 6:117143978-117144000 TGGGCTGCTGGTATTTGCAATGG - Intergenic
1014148321 6:118023531-118023553 AAAGATGATGATATATGCTAGGG + Intronic
1014240022 6:119007006-119007028 ATATCTCCTGCTATTTGCAAAGG + Intronic
1014602016 6:123424944-123424966 AAAGCTGCTGAAATTTTCAGGGG + Intronic
1015136896 6:129882625-129882647 GAAGCTGCTGATCTTTGGATGGG + Intergenic
1015213390 6:130722285-130722307 AAAGCAGATGTTACTTGCAAAGG + Intergenic
1016426154 6:143937627-143937649 AAATCTGTTTATGTTTGCAAAGG + Exonic
1016552102 6:145293648-145293670 AAAGCTGTTAATATTTGCTGTGG - Intergenic
1016922244 6:149307147-149307169 AATGCTGACCATATTTGCAACGG - Intronic
1017899879 6:158710435-158710457 AAAGATGTTGATATTTCCTAAGG - Intronic
1018073740 6:160191070-160191092 AAAGCTGTTAGTGTTTGCAATGG - Intronic
1019298845 7:293003-293025 CCAGAAGCTGATATTTGCAAAGG - Intergenic
1022521184 7:31007928-31007950 AAAACTGCTGATGTTTACTAGGG + Intergenic
1022539530 7:31122828-31122850 AGAGCTCCTGCTATTTCCAAAGG - Intergenic
1022886288 7:34649130-34649152 ATAGCTTCTCCTATTTGCAAGGG - Intergenic
1023298182 7:38738479-38738501 AAAGATGCTGAAATTCTCAAGGG + Intronic
1026029855 7:66781690-66781712 AAAGCTGCAGGTATCTGCAGAGG - Intronic
1027357672 7:77374899-77374921 AAAGTTGTTTATATTTGCTATGG + Intronic
1027448431 7:78301723-78301745 AAAGCTGCTGAGATTGGTATTGG - Intronic
1027792960 7:82656574-82656596 AGAGCTGTGGATATTTGCAGAGG + Intergenic
1028625943 7:92876948-92876970 AAATCTGCTGATAGCTGCATTGG - Intergenic
1028918119 7:96282098-96282120 AAAACTCCTGAAAATTGCAAGGG - Intronic
1029945751 7:104531295-104531317 AGAGCTGCTTATATTTTCACTGG - Intronic
1031254404 7:119428991-119429013 AAAGCTGCTGCTGTTTGCTGGGG - Intergenic
1031639950 7:124150178-124150200 AAAGCTGATGATATTTAAAAGGG + Intergenic
1032307257 7:130747070-130747092 AAAGCATCTTATATTTGAAAAGG + Intergenic
1034212800 7:149379620-149379642 AAATGTGCTGAAATATGCAAAGG - Intergenic
1034250765 7:149688783-149688805 AAATCTCTTGGTATTTGCAATGG - Intergenic
1035133736 7:156679118-156679140 AAAGCTGCAGACATTTGCCTGGG - Exonic
1035832458 8:2712029-2712051 AAAGCTCCAGAAATCTGCAAAGG + Intergenic
1037203982 8:16291824-16291846 AAAATTGCTAACATTTGCAATGG - Intronic
1038670194 8:29576944-29576966 AAAGCTGGTGCTGTTTGCAGGGG - Intergenic
1039310360 8:36311930-36311952 ACAGCTGCTGCTATTTCTAATGG + Intergenic
1039646370 8:39288764-39288786 AAATCTGCTGATAGTTGTATTGG + Intergenic
1041992897 8:64015794-64015816 GGAGCTGATGATATATGCAAGGG + Intergenic
1043112950 8:76210986-76211008 AGAGCTGAAGATATTAGCAAAGG - Intergenic
1043724079 8:83587153-83587175 AAAGCAGCTTATATTTGTAAAGG - Intergenic
1044606428 8:94051988-94052010 ACAGCAGCTGAAATTTCCAAAGG - Intergenic
1044970925 8:97618887-97618909 AAAGCTGCTCCTAGTTGCAGGGG + Intergenic
1045434810 8:102151745-102151767 AAATCTCCTTATATTTTCAAGGG + Intergenic
1045683318 8:104685965-104685987 AAAGCTGTTGATACTTGTACTGG - Intronic
1045719033 8:105084772-105084794 AAAGTTGGAAATATTTGCAATGG + Intronic
1047368301 8:124233002-124233024 AGAGATGCTTATATTTGCACAGG + Intergenic
1047700215 8:127442209-127442231 AAAGGTGCTGTAATTTGAAAGGG - Intergenic
1050606459 9:7306332-7306354 AAAGCATGTGATATTTGCAGTGG - Intergenic
1050962557 9:11754120-11754142 AATGCTATTGATTTTTGCAAGGG + Intergenic
1051114188 9:13675156-13675178 AAAGATGTTGAGATGTGCAATGG - Intergenic
1052489966 9:29153535-29153557 AAAGTTACTGTCATTTGCAAGGG - Intergenic
1053678826 9:40465468-40465490 GAGGCTGCTGATCTTTGGAAGGG - Intergenic
1053928811 9:43093821-43093843 GAGGCTGCTGATCTTTGGAAGGG - Intergenic
1054284897 9:63159474-63159496 GAGGCTGCTGATCTTTGGAAGGG + Intergenic
1054291904 9:63301006-63301028 GAGGCTGCTGATCTTTGGAAGGG - Intergenic
1054389923 9:64605549-64605571 GAGGCTGCTGATCTTTGGAAGGG - Intergenic
1054505792 9:65910827-65910849 GAGGCTGCTGATCTTTGGAAGGG + Intergenic
1054822705 9:69539505-69539527 AAAGATGCTGGTGGTTGCAATGG - Intronic
1056614792 9:88154710-88154732 AAAACTGCTGAGATTTTGAAAGG + Intergenic
1057055972 9:91961108-91961130 AAAGCTGCCAATATTTTTAAAGG + Intergenic
1057548328 9:96034455-96034477 ACAGCTTCTTAAATTTGCAAAGG + Intergenic
1057938714 9:99261941-99261963 AAGGCTGCTGCTCTTGGCAAAGG + Intergenic
1058084060 9:100730312-100730334 AAAGCTGCAGATCTATGCACTGG - Intergenic
1058546413 9:106064905-106064927 AAAGTTGCTCATAGTTGCATTGG - Intergenic
1059074127 9:111172813-111172835 AAACCTGCTGATATTTAGACTGG - Intergenic
1060089082 9:120727410-120727432 ATAGCAGCTGATATTTGTTAAGG + Intergenic
1061045189 9:128160912-128160934 TAAGCTGCTGACATTTGGCAAGG - Intronic
1061777462 9:132975122-132975144 AAAAGTGCTGTTATTTGAAAGGG + Exonic
1061891886 9:133626046-133626068 AAAGTTGCAGAAATTTGCATAGG - Intergenic
1186751513 X:12626456-12626478 AAATCTGCTGATAGTTGTATTGG - Intronic
1188926214 X:36047859-36047881 AAATCTGCTGATGATTGAAATGG - Intronic
1189087768 X:38045279-38045301 AAATGTGCTCATATATGCAAAGG - Intronic
1191004951 X:55701587-55701609 GAAACTGCTTATTTTTGCAAAGG - Intergenic
1194611163 X:96047564-96047586 AAAATTGCTGATATTTGTATTGG - Intergenic
1196161912 X:112494577-112494599 AATGCTACTGATATTTGGATGGG + Intergenic
1196370179 X:114968852-114968874 AACCCTGCTGATATTTGTATTGG - Intergenic
1197401342 X:125995160-125995182 GAATCTGATGATATATGCAAAGG + Intergenic
1197415810 X:126171271-126171293 AAATCTGGGGATAATTGCAAAGG - Intergenic
1199006516 X:142704770-142704792 CAACCTGCTGATATTTTCATTGG - Intergenic
1199104936 X:143854688-143854710 AATGTTGCTGAGATTTACAAAGG - Intergenic
1199315146 X:146368090-146368112 AGAGCTGCTTATTTTTGCTATGG + Intergenic
1199700120 X:150369421-150369443 AAAGGGGCTGATATTTTGAAGGG + Intronic
1199919572 X:152384046-152384068 AAGGCTCCTGATTTTTGTAAGGG - Intronic
1200882703 Y:8235213-8235235 AAAGCAGCTGCTATTTCAAAAGG - Intergenic