ID: 1135733980

View in Genome Browser
Species Human (GRCh38)
Location 16:24916216-24916238
Sequence CAGGGCCATCACAATGGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135733973_1135733980 -3 Left 1135733973 16:24916196-24916218 CCACGGAGCTCCCAGAGAACCAG No data
Right 1135733980 16:24916216-24916238 CAGGGCCATCACAATGGTCCAGG No data
1135733970_1135733980 21 Left 1135733970 16:24916172-24916194 CCCAACAGAGGAGCGGGAGTCAC No data
Right 1135733980 16:24916216-24916238 CAGGGCCATCACAATGGTCCAGG No data
1135733969_1135733980 22 Left 1135733969 16:24916171-24916193 CCCCAACAGAGGAGCGGGAGTCA No data
Right 1135733980 16:24916216-24916238 CAGGGCCATCACAATGGTCCAGG No data
1135733971_1135733980 20 Left 1135733971 16:24916173-24916195 CCAACAGAGGAGCGGGAGTCACT No data
Right 1135733980 16:24916216-24916238 CAGGGCCATCACAATGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135733980 Original CRISPR CAGGGCCATCACAATGGTCC AGG Intergenic
No off target data available for this crispr