ID: 1135738604

View in Genome Browser
Species Human (GRCh38)
Location 16:24954335-24954357
Sequence GGTCAGGGTGTACCACAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135738599_1135738604 16 Left 1135738599 16:24954296-24954318 CCAGAGTTTTAAATGAAACAATC 0: 1
1: 0
2: 2
3: 17
4: 277
Right 1135738604 16:24954335-24954357 GGTCAGGGTGTACCACAATCAGG 0: 1
1: 0
2: 0
3: 5
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135738604 Original CRISPR GGTCAGGGTGTACCACAATC AGG Intronic
900594266 1:3473333-3473355 GGCCAGCCTGTACCAAAATCAGG - Intronic
902064129 1:13670208-13670230 GGACAGGTTGAACCAAAATCTGG + Intergenic
904643284 1:31946485-31946507 GGTTACAGTGTACCACATTCTGG + Intergenic
904955983 1:34284250-34284272 TTTCAGGGTGTAGCTCAATCAGG + Intergenic
910872270 1:91845663-91845685 GGTCAGGGTATACTACATGCAGG - Intronic
920123585 1:203676365-203676387 GGCCAGGGTGAACTAGAATCTGG + Intronic
923054878 1:230418535-230418557 TGTCAGCTTGTACCACAGTCTGG + Intronic
924088492 1:240478777-240478799 GGTCAGTGTGTGCCAGAAACTGG + Intergenic
1065833640 10:29637734-29637756 GGTATGGATGTACCACAATGAGG - Intronic
1070016330 10:72536031-72536053 GAACAGGGTGTACCACAGGCTGG + Intronic
1072570915 10:96656812-96656834 GGTCCGGCTGCACCACCATCAGG + Exonic
1075674559 10:124287371-124287393 GGCCAGTGAGTACCAGAATCAGG - Intergenic
1078106123 11:8359052-8359074 GGACAGGCTGTCCCTCAATCTGG - Intergenic
1083140651 11:60718526-60718548 GCTCAGGGAGTACCAAGATCTGG + Intergenic
1096388016 12:51207879-51207901 GGGCAGGCTGTTCCACCATCTGG - Intronic
1098015660 12:66101874-66101896 GGTCAGTGTTTTCCAAAATCAGG + Intergenic
1135354867 16:21760607-21760629 GGGAAGGGTGTCCCACCATCTGG - Exonic
1135738604 16:24954335-24954357 GGTCAGGGTGTACCACAATCAGG + Intronic
1137514767 16:49133493-49133515 TGTCAGGGTTTACCAAAATCAGG - Intergenic
1137715567 16:50596195-50596217 GGTCTGGGTGGACCAAAGTCTGG + Intronic
1138107586 16:54297489-54297511 GGGCACGGTGTACCACAGACTGG + Intergenic
1140868282 16:79083299-79083321 GGTCAGGGTGAACCACACACTGG - Intronic
1148690415 17:49523951-49523973 GGGGAGGGGGGACCACAATCTGG - Intergenic
1149993524 17:61395721-61395743 GGTGACGGCGTGCCACAATCCGG - Intergenic
1153561414 18:6375376-6375398 AGTCAGGTTGTAGCACAGTCTGG - Intronic
1157718172 18:49903592-49903614 GGTCAGGGTGGAGCACACCCTGG - Intronic
1159849837 18:73514724-73514746 GGACCAGGTGTACCACAAGCAGG + Intergenic
1168274633 19:55270594-55270616 GGTCAAGGTGCGCCACAGTCAGG + Intronic
1173293846 20:41738320-41738342 GCACTGGGTGTACCACAATGAGG - Intergenic
1175806384 20:61831506-61831528 GGTCAGGGAGTAGCGCATTCGGG - Intronic
1180611371 22:17100372-17100394 GGTCAGGGTCAACCACAAAGTGG - Exonic
1180944172 22:19680583-19680605 GCTCAGGCTGTTCCACAATGGGG - Intergenic
1181540405 22:23569964-23569986 GCTCGGGGTGTAGCACAAGCTGG - Intergenic
1182884191 22:33759293-33759315 TGACAGGGTGTCACACAATCTGG - Intronic
949549255 3:5098616-5098638 TGTCACGATGCACCACAATCTGG - Intergenic
954731142 3:52663275-52663297 GGTCAGGGTCTACCAGAAGCTGG + Intronic
955837084 3:63067895-63067917 GGGGAGGGTGTACAAGAATCAGG + Intergenic
960198457 3:114800430-114800452 TGTCAGAGTCTACCACAGTCTGG - Intronic
966851533 3:184167911-184167933 GGACTGGCTGTACCACAATGTGG + Exonic
967947763 3:194817762-194817784 GGTCAGGATGTACCTCAGACAGG + Intergenic
985871173 5:2557840-2557862 GGTCAGGGTGGATCTCAATGTGG - Intergenic
988819094 5:34863007-34863029 GGTCAAGCTGTACTACACTCTGG + Exonic
992381096 5:76238617-76238639 GGTGAGGGTGTGTCACAGTCAGG + Intronic
994189080 5:96847561-96847583 GGTCATGTTAAACCACAATCTGG + Intronic
997229829 5:132234250-132234272 GGTCAGGGTTTACGACTATCTGG + Intronic
1009373499 6:62938432-62938454 GGGCAGTGTGCACCACAACCTGG - Intergenic
1014108110 6:117590198-117590220 ACTCACTGTGTACCACAATCTGG + Intronic
1021976253 7:26013532-26013554 TGTCAGATTGTAACACAATCAGG + Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1024167064 7:46745915-46745937 AGTCAGCTTGTACCACATTCTGG - Intronic
1028398947 7:90403975-90403997 GGTCTGGGTCTACCACACACAGG + Intronic
1028777432 7:94694523-94694545 TGCCAAGGTGGACCACAATCTGG - Intergenic
1033024888 7:137762585-137762607 GGTGAGGGTGTTCCACATTCAGG - Intronic
1036282698 8:7415331-7415353 GATCAGGGTCTTTCACAATCAGG - Intronic
1036338776 8:7896218-7896240 GATCAGGGTCTTTCACAATCAGG + Intronic
1039943833 8:42113566-42113588 GGTCAGGGAGCACCAGTATCAGG - Intergenic
1041983414 8:63890837-63890859 GGGCAGACTGTACCACAAACAGG + Intergenic
1055730681 9:79276981-79277003 GCTCAGGGTGTTCCATAATAAGG - Intergenic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1199429687 X:147745178-147745200 GCTGAGGGTGTACCACATGCAGG - Intergenic