ID: 1135740408

View in Genome Browser
Species Human (GRCh38)
Location 16:24970352-24970374
Sequence TGAGACTCCTTGGGAGAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 272}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135740408_1135740412 -7 Left 1135740408 16:24970352-24970374 CCACTTTCTCCCAAGGAGTCTCA 0: 1
1: 0
2: 2
3: 49
4: 272
Right 1135740412 16:24970368-24970390 AGTCTCAGCCGGTCTCCTAGCGG 0: 1
1: 0
2: 0
3: 8
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135740408 Original CRISPR TGAGACTCCTTGGGAGAAAG TGG (reversed) Intronic
900636695 1:3669491-3669513 TGCGCCTCCTTGGCAGGAAGTGG - Intronic
900884177 1:5403711-5403733 TGAGACCCCTTAGGAGTAAGTGG + Intergenic
902933321 1:19746345-19746367 AGTGACTCCCTGGGAGACAGAGG - Intronic
904321065 1:29698157-29698179 TGAGCCTCCTTGTGGGGAAGTGG - Intergenic
905350641 1:37344101-37344123 TGAGAGGCCTGGGGAGAAAAGGG - Intergenic
905827637 1:41038180-41038202 ACAAACTCCTTGGAAGAAAGGGG - Intronic
906935257 1:50208998-50209020 TTTGAATCCTTGGGAGAAAAAGG + Intergenic
906964798 1:50445705-50445727 TGGGACTCCTTGGGGGAGAAGGG + Intronic
907346126 1:53782280-53782302 TGAGAGTCCATAGGAGCAAGAGG + Intronic
907915675 1:58866682-58866704 TTAGGCTCATTGGCAGAAAGAGG - Intergenic
907940941 1:59086357-59086379 TAAGACTCCTTGCTAGACAGCGG - Intergenic
908957599 1:69652647-69652669 TGAGGTTCCATGGGAGATAGGGG - Intronic
910218201 1:84863648-84863670 TGAGAGTCCTGGGGGGAAACTGG - Intronic
911208398 1:95116059-95116081 TGAGAGTCTTGGGGAGAAAAAGG + Intergenic
912429564 1:109621826-109621848 TGAGCCTCCTTAGGAGTATGGGG + Intronic
912709151 1:111937422-111937444 TCAGACTCCCTGGGGGAAGGTGG + Intronic
913236007 1:116784102-116784124 TGTGACTGGTTGGGAGCAAGGGG + Intergenic
913428880 1:118766811-118766833 CGAGCCTCCTTGGCAGAAAAAGG - Intergenic
913451684 1:118997167-118997189 TCAGATTCCTTGTGAGAAAGGGG + Intergenic
916215081 1:162387114-162387136 CGACCCTCCTTGGGAGGAAGTGG + Intergenic
917731499 1:177879405-177879427 AGAGACTTCTGGGGAGATAGAGG + Intergenic
918093924 1:181318899-181318921 TGAGTCTCCTTGTGCGAGAGTGG + Intergenic
918283986 1:183034115-183034137 TAAGACTGCTGGGGAGAAAATGG + Intronic
918296674 1:183163569-183163591 TGAGACTCCTTGATACAAAAGGG + Intergenic
918313434 1:183303170-183303192 TGAGACTCCCTTGGTGACAGTGG - Intronic
919154545 1:193746174-193746196 TGAGAGACCGTGGGAGAGAGAGG + Intergenic
919967364 1:202541476-202541498 TGTGGCTCCTTGGGAAAAAAAGG - Intronic
920084976 1:203408761-203408783 TGAAAGTCCCTGGCAGAAAGTGG + Intergenic
920225541 1:204436086-204436108 TGAGACTTCTTGCCAGTAAGTGG - Intronic
920261169 1:204689015-204689037 TCAGCCTCCTTGGGAGATATGGG + Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921675206 1:217968662-217968684 ACAGACTCCTGGGTAGAAAGGGG + Intergenic
921705637 1:218319598-218319620 TCAGACCCCTTTGGAGAAACAGG - Intronic
921881013 1:220253959-220253981 TCAGCCTCCTTGGAAGAAAAGGG + Intronic
923559403 1:235027419-235027441 GGAGAGTCCTTGGGGGAAGGAGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1068780038 10:60909810-60909832 TGAGTCCCCTTGAAAGAAAGTGG + Intronic
1070640575 10:78166026-78166048 TGAGCCTACTTGGGACAAAAAGG + Intergenic
1070827093 10:79397652-79397674 TGAGACTCCTTGATCGAAGGTGG + Intronic
1070865441 10:79705811-79705833 TGTTACTTCTTGGGAGACAGGGG + Intronic
1070879235 10:79843942-79843964 TGTTACTTCTTGGGAGACAGGGG + Intronic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1071632341 10:87228032-87228054 TGTTACTTCTTGGGAGACAGGGG + Intronic
1071645794 10:87360250-87360272 TGTTACTTCTTGGGAGACAGGGG + Intronic
1074963985 10:118472839-118472861 TGAAATTCCTTGGGATAATGAGG - Intergenic
1075085905 10:119414101-119414123 AGAGACTCTCTGGAAGAAAGGGG - Intronic
1076985452 11:232907-232929 CGAGCCTCCCTGGGAGAAACAGG + Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081777387 11:45684903-45684925 CGAGTCTCCTTGGGGAAAAGCGG + Intergenic
1082055001 11:47807132-47807154 TTAGACTCCCTGTGAGAAAAGGG + Exonic
1082852341 11:57776499-57776521 TGGGCCTGCTTTGGAGAAAGAGG + Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084290019 11:68157911-68157933 CGAGACTCCAAGAGAGAAAGAGG + Exonic
1084525926 11:69697988-69698010 TGAGACTGCTAGAGAGAAGGTGG + Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1088988136 11:114928049-114928071 TGTCACTCCTTGGGAGCACGGGG + Intergenic
1089648023 11:119892888-119892910 TGAGACTCCTCGGGTTACAGAGG + Intergenic
1090644923 11:128759724-128759746 TGAGATTCCTTGTGAGCAATGGG + Intronic
1090846637 11:130534972-130534994 TGAGACTGAATGGGAGAGAGCGG + Intergenic
1090883451 11:130855135-130855157 GGAGATTCATTAGGAGAAAGGGG - Intergenic
1091615191 12:2045645-2045667 TGAGCCTCAGTGAGAGAAAGAGG + Intronic
1092803847 12:12200433-12200455 TCAGCCTCCTTGGAAGAAAAGGG - Intronic
1093186946 12:16030889-16030911 TAAGGCTGCCTGGGAGAAAGTGG - Intronic
1093525741 12:20102203-20102225 ACAGACTCCTGGGGAGAAAGGGG - Intergenic
1094072270 12:26430888-26430910 TGAGGCTACTTGGGAGGCAGAGG - Intronic
1094072546 12:26433790-26433812 TGAGGCTACTTGGGAGGCAGAGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1096779681 12:53984805-53984827 TGTAACTCCTGGGGAGAAGGGGG - Intergenic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1098744280 12:74216292-74216314 TGAGAATCTTTGATAGAAAGGGG - Intergenic
1099273614 12:80546997-80547019 TGAGACAGCTGGGGAAAAAGGGG + Intronic
1103159032 12:118712197-118712219 TGACACGCCTTTGAAGAAAGCGG - Intergenic
1103397548 12:120619509-120619531 TGAGTGTCCCTGGGAGGAAGAGG + Intergenic
1104436506 12:128761182-128761204 TGAGACTTCTTGGGAGAAGATGG + Intergenic
1106597839 13:31161790-31161812 TAAGAAACCCTGGGAGAAAGCGG + Exonic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1111243711 13:85508226-85508248 AGAGATTCCTGGGCAGAAAGGGG + Intergenic
1111692646 13:91583684-91583706 TGAGACACCCTTGAAGAAAGAGG + Intronic
1112117917 13:96377778-96377800 TGTGACACCATGGAAGAAAGAGG + Intronic
1112545965 13:100371131-100371153 TGCCACCACTTGGGAGAAAGTGG - Intronic
1113405109 13:110031690-110031712 TCTGACTCCTGGGGGGAAAGGGG - Intergenic
1113503049 13:110793403-110793425 ACAGGCTCCTTGGCAGAAAGGGG + Intergenic
1113986821 13:114324290-114324312 TGAGGCTCCAGGGGAGTAAGAGG - Exonic
1114405594 14:22453152-22453174 TGTGAGTCCCTGGGAGAAAATGG - Intergenic
1114670275 14:24407447-24407469 TGTGACAGCTGGGGAGAAAGTGG - Intronic
1115118494 14:29910690-29910712 TGAGACTTGTTAGGACAAAGAGG + Intronic
1118040352 14:61909630-61909652 TGAGCTTACTTGGGAAAAAGGGG - Intergenic
1119261698 14:73241571-73241593 TGAGACTCACTGGGAGGAGGTGG - Intronic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1119426820 14:74540974-74540996 TAAATCTCCTTGGGAGAAAGTGG + Intronic
1119430726 14:74566748-74566770 TGAGACTCCTTGGGGACACGGGG - Intronic
1119507661 14:75186872-75186894 TGAGACTCTATGGGAGAAAGAGG + Intergenic
1119755986 14:77119955-77119977 TCAGAATCCCTGAGAGAAAGAGG + Intronic
1119758166 14:77133261-77133283 TGAGACTCCCTGGGACCTAGAGG - Exonic
1120273722 14:82346991-82347013 AAAGTCTCCTTGGGAGAAAAGGG - Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1121221638 14:92289679-92289701 TGAGACTCTTTGGGAGGTGGGGG + Intergenic
1121828379 14:97029083-97029105 TGAGACTCCTGAGGGGAAATGGG + Intergenic
1123160046 14:106269223-106269245 TGAGAGGCCTTTGGAGATAGTGG + Intergenic
1123467140 15:20525883-20525905 TGAGAGTCCTGGAGAGAAGGTGG + Intergenic
1123650975 15:22475159-22475181 TGAGAGTCCTGGAGAGAAGGTGG - Intergenic
1123741383 15:23284001-23284023 TGAGAGTCCTGGAGAGAAGGTGG - Intergenic
1123745614 15:23318557-23318579 TGAGAGTCCTGGAGAGAAGGTGG + Intergenic
1124277886 15:28341874-28341896 TGAGAGTCCTGGAGAGAAGGTGG + Intergenic
1124304815 15:28569734-28569756 TGAGAGTCCTGGAGAGAAGGTGG - Intergenic
1124441281 15:29687996-29688018 TGGGACTTCCTGGGAGGAAGGGG + Intergenic
1125057516 15:35379165-35379187 TGAGGATCCTTAGAAGAAAGAGG - Intronic
1125501492 15:40242543-40242565 GGAGCCTCCTTGGTAGAAAGAGG + Intronic
1126556047 15:49988786-49988808 GGAGCATCCTAGGGAGAAAGGGG - Intronic
1126810526 15:52398586-52398608 AGTGATTACTTGGGAGAAAGGGG - Intronic
1126887590 15:53167393-53167415 TGAAAATACTTGGGAGAATGTGG + Intergenic
1127374090 15:58366858-58366880 TGAGAGTTTTTGGGAGAAAGGGG - Intronic
1128879462 15:71230122-71230144 TGACAGTCCCTGGGAGAGAGGGG + Intronic
1129771296 15:78204994-78205016 GGAGTTTCCTAGGGAGAAAGCGG + Intronic
1130577461 15:85105252-85105274 TGAGCTTTCTTGGGAGGAAGAGG + Intronic
1130631199 15:85570533-85570555 TGAGACTCCCTGAAGGAAAGAGG + Intronic
1131221974 15:90592068-90592090 TGAGTCCACTTGGGAGAAATAGG + Intronic
1131593648 15:93774642-93774664 AGAGACTTCTTGGGAGACAATGG - Intergenic
1135655371 16:24243867-24243889 TGGGACTACTGGGGAGAAATTGG - Intergenic
1135740408 16:24970352-24970374 TGAGACTCCTTGGGAGAAAGTGG - Intronic
1138007834 16:53354572-53354594 TGAGAGTCCTGGAGAGAAGGTGG + Intergenic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1139641819 16:68297082-68297104 TGAGGCTTGTTGGGAGACAGGGG + Intronic
1142057262 16:88005918-88005940 AGAAACTCCATGGGAGAAAATGG - Intronic
1142603907 17:1071332-1071354 AGGGTCTCCTGGGGAGAAAGTGG - Intronic
1142627648 17:1202799-1202821 TTCTACTGCTTGGGAGAAAGTGG + Intronic
1144138098 17:12318597-12318619 ACAGACTCCTTATGAGAAAGAGG + Intergenic
1146785943 17:35721433-35721455 TATGGCTCCTAGGGAGAAAGAGG - Intronic
1146946147 17:36874923-36874945 TGAGATTCTTGGGGAGACAGAGG - Intergenic
1152107450 17:78339122-78339144 ACAGAGTCCTGGGGAGAAAGTGG + Intergenic
1153672076 18:7420995-7421017 TGAGACACTTAGGGAGAAACAGG + Intergenic
1153692575 18:7608199-7608221 TGAGATGACTTGGGAAAAAGAGG + Intronic
1153763573 18:8354258-8354280 ACAGAGTTCTTGGGAGAAAGTGG + Intronic
1153945430 18:10013456-10013478 GGAAACTCATTGGGTGAAAGGGG + Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155377044 18:25170787-25170809 TGAAACTCCAAGGGAGAAATAGG - Intronic
1155495219 18:26436048-26436070 TGAGAGCCCTTAGGAAAAAGAGG - Intergenic
1157743841 18:50117513-50117535 AAAGACTCCCAGGGAGAAAGGGG - Intronic
1157913621 18:51642474-51642496 TGAAGCACCTTGAGAGAAAGAGG + Intergenic
1158683053 18:59586224-59586246 TGATACTCCCTGGGAAGAAGAGG + Intronic
1159830033 18:73264866-73264888 AGGGACTACATGGGAGAAAGAGG + Intergenic
1160380987 18:78455636-78455658 TGAGACTTCCTGGGAGAGGGTGG + Intergenic
1161973728 19:7597250-7597272 AGAGACTGTCTGGGAGAAAGAGG - Intronic
1163834006 19:19562478-19562500 TGAGACTCGGTGGGAAAAAGGGG + Intronic
1164903111 19:31945048-31945070 TTTGTCTCCTTGGGAGAAACAGG + Intergenic
1166048708 19:40245225-40245247 TGAGACTTCTTAAGAGAAAAAGG + Intronic
1166090851 19:40507996-40508018 TCAGAACTCTTGGGAGAAAGGGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166472375 19:43089379-43089401 TGTGATTCCATGGGAGAAAGTGG + Intronic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
926357890 2:12057663-12057685 TGAGTCTGCCTGTGAGAAAGCGG - Intergenic
926659705 2:15450993-15451015 TGGGACTGTTTGGGAGAAAAAGG + Intronic
928757828 2:34547261-34547283 AGAGACTTCTTGGGAGCCAGAGG - Intergenic
930190134 2:48450126-48450148 AGAGATGCCTTTGGAGAAAGAGG - Intronic
930357113 2:50334974-50334996 TCAGACTCCGGGAGAGAAAGTGG + Intronic
931099091 2:58975129-58975151 TGAGACTCCGTCAGGGAAAGTGG + Intergenic
933299655 2:80527658-80527680 TGGGAGTCATTGGGAGAGAGAGG + Intronic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
934950138 2:98570534-98570556 TGACAGTCTTTGGGACAAAGTGG - Intronic
939766204 2:146252600-146252622 TGGAAATGCTTGGGAGAAAGAGG + Intergenic
941005096 2:160239803-160239825 TCAGACTCCATGGGAAAGAGAGG + Intronic
941348053 2:164394463-164394485 TGAGACACCTTGGGAGGCCGAGG - Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942140227 2:172969797-172969819 TGAGTCACCTTGGGAGAAATGGG + Intronic
942244129 2:173991511-173991533 TGAGACATCTGGGGAGAAAGGGG - Intergenic
943651149 2:190458690-190458712 TGAGACTCTTTCAGTGAAAGTGG + Intronic
943790306 2:191923890-191923912 TGAGATTCCTTAGGTGAATGAGG + Intergenic
945212529 2:207398191-207398213 TGAGAGACCCTGGGACAAAGTGG + Intergenic
945753209 2:213813977-213813999 TGAGACACAGAGGGAGAAAGTGG + Intronic
946033414 2:216723213-216723235 TGAGAGTCCTTCAGAGACAGGGG - Intergenic
946878992 2:224158993-224159015 AGAGACCCCTGGGGAGACAGGGG - Intergenic
947521085 2:230846604-230846626 CGAGACCCCTTGGGAGAAGATGG - Intergenic
947840341 2:233203811-233203833 TGAGACTACTTGGGAGTAGCTGG - Intronic
947967120 2:234290857-234290879 CCAGACACCTTGGGAGGAAGTGG + Intergenic
948436731 2:237958812-237958834 AGAGAGGCCTTGGGAGAAACCGG - Intergenic
1170956567 20:20985382-20985404 TGAAAAGCCTTGGGAGAGAGGGG - Intergenic
1171060227 20:21949503-21949525 AAAGACTCCTTGGGAGGTAGGGG + Intergenic
1171209453 20:23305539-23305561 TGAGACTCCTTGGGTGAATTTGG - Intergenic
1172461737 20:35124028-35124050 TGAGGCTCTGTGGGAGAAAGTGG + Exonic
1173936855 20:46874266-46874288 AGAGATTCCTTGGGAGGAGGTGG - Intergenic
1175654276 20:60755003-60755025 TGGGAGGACTTGGGAGAAAGAGG - Intergenic
1178502688 21:33138999-33139021 TCTGACTTCTTGGGAGGAAGGGG + Intergenic
1178613722 21:34111331-34111353 TGAGCCTCCTTGGCAGGAAGCGG - Intronic
1178821074 21:35975875-35975897 TGAGACTTCTTGAGAGAGAGAGG - Intronic
1182483736 22:30626815-30626837 TCAGACTCCTTGGCAAAAAACGG + Exonic
1184540155 22:45117162-45117184 TGAAACTCCGAGGGAGAAAGTGG + Intergenic
1185028530 22:48429461-48429483 TGAAAGTTCTCGGGAGAAAGAGG + Intergenic
1185269797 22:49924114-49924136 TGGAACTCTTTGGGAGAAACTGG - Intronic
949123040 3:411075-411097 TGAAAATCCTTGGGAGAATATGG + Intergenic
950450470 3:13062278-13062300 TGAGAATCCAGGGGAGGAAGGGG + Intronic
950859814 3:16137992-16138014 TGAGAGTCCTTGGGAGTTAGGGG + Intergenic
953699153 3:45182657-45182679 TGAGCCTCCTAGGAAGCAAGGGG - Intergenic
953847663 3:46440934-46440956 GGAGACTCCTTGGGAGTTAGTGG - Intronic
955691541 3:61595511-61595533 TGTGACTGCTTGAGAGAAGGTGG + Intronic
958734198 3:97990048-97990070 TGAGATGCCTTGGAAGAAATAGG - Intronic
960077782 3:113507431-113507453 TTAGACTAATTGGGAGTAAGGGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
964753069 3:160069871-160069893 TAAGAATCCTTGGGAAAAATAGG - Intergenic
967385702 3:188908768-188908790 TGGGACTCCTATGGAGAAAAGGG + Intergenic
967938204 3:194746266-194746288 TGAGACTCAGTGAGAGTAAGTGG + Intergenic
969455488 4:7297535-7297557 TGAGTCTCCCTGGGTGAACGTGG + Intronic
969532217 4:7736432-7736454 TGAGACTCAGTGGGAGAGGGGGG - Intronic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
974285156 4:59855854-59855876 ACAGACTCCTTGGCGGAAAGGGG - Intergenic
974481889 4:62455020-62455042 TGAAACTGATTGGTAGAAAGGGG - Intergenic
976982765 4:91252137-91252159 TCAGAATCTTTGGGAGACAGAGG + Intronic
979076086 4:116272896-116272918 TTAAACTCCTTGGGAGACTGAGG + Intergenic
980114446 4:128665774-128665796 TCATTCTCCTTGGGAGAATGAGG + Intergenic
981662374 4:147183128-147183150 TCAGACTCCCTGGAAGCAAGTGG - Intergenic
982217742 4:153096697-153096719 TGAGAATCCTGGGGAAACAGAGG + Intergenic
982388294 4:154836737-154836759 TGAGACTGCTTGGCTGGAAGGGG - Intergenic
983853914 4:172617994-172618016 TGAGAATCTTTTGGAGAAGGAGG - Intronic
984785491 4:183563930-183563952 TGAGATTGCTTAGTAGAAAGAGG - Intergenic
985545441 5:506686-506708 TCAGACTCCTTCAGAGAGAGTGG + Intronic
986608985 5:9547863-9547885 GGAGCCTCCCTGGGAGGAAGAGG + Intergenic
988568472 5:32340847-32340869 TGAGACCCTTTGGGAAAAACAGG - Intergenic
992722491 5:79574556-79574578 TGAGACTCCATGAGAGACAGAGG + Intergenic
995220996 5:109647645-109647667 TAAGTCTTCATGGGAGAAAGGGG - Intergenic
995362973 5:111320151-111320173 TGATACTGCTAGGGAGAAAAGGG + Intronic
996752088 5:126899101-126899123 TGAGATTGTTTGGGATAAAGCGG - Intronic
1000288351 5:159847046-159847068 TTAGACTGCTAGGGAGAAGGGGG + Intergenic
1000678328 5:164151623-164151645 TAAGAATCCTAGGGACAAAGAGG - Intergenic
1001175911 5:169468716-169468738 TGAGGCTACTGAGGAGAAAGTGG + Intergenic
1001382310 5:171312572-171312594 TGAGGCTCCGCGGGAAAAAGAGG - Intergenic
1001406970 5:171483415-171483437 TGAGGCTCCATGCGAGGAAGGGG - Intergenic
1001851877 5:174974849-174974871 TGAGAATTCTTGGAAGGAAGGGG - Intergenic
1001949092 5:175803669-175803691 GGAGTCTCTTTGGGAGACAGAGG + Intronic
1002158301 5:177300096-177300118 TGAAACTCCTAGTGAAAAAGAGG + Exonic
1002797295 6:484549-484571 GGGGACTTCTTGGAAGAAAGGGG - Intergenic
1003516624 6:6823876-6823898 TGACACTCCTTGGCAGGAAGAGG + Intergenic
1005944207 6:30583892-30583914 TGAGACCACTGGGGAGAAAAGGG + Intronic
1006020262 6:31113639-31113661 TAAGAAACCTTGGGAGAAAGTGG + Intergenic
1007052323 6:38844797-38844819 AGAGACTCTCTGGGAGGAAGAGG - Intronic
1007205524 6:40146968-40146990 TAAGAATCCCCGGGAGAAAGTGG + Intergenic
1007952607 6:45885700-45885722 GTAGAGACCTTGGGAGAAAGTGG + Intergenic
1007998642 6:46335561-46335583 CAAGACTGCTTGGGAGAAGGAGG - Intronic
1008540973 6:52546215-52546237 TGTGACTCCCTGGGAAAATGAGG + Intronic
1009253582 6:61345031-61345053 TCAGACTCCTATGGAGAAACAGG + Intergenic
1009258268 6:61446852-61446874 TCAGACTCCTATGGAGAAACAGG + Intergenic
1009369961 6:62887112-62887134 TGAGAAACCTGGGCAGAAAGTGG - Intergenic
1009519990 6:64669495-64669517 TGAGAGTACTGGGGAGAAAAGGG + Intronic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010058602 6:71594486-71594508 TGAAACTAATTGGTAGAAAGAGG - Intergenic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1012227896 6:96725659-96725681 TGAGAATATTTGGAAGAAAGTGG - Intergenic
1012493433 6:99808680-99808702 CGAGAGTGCTTGGGAAAAAGAGG - Intergenic
1013081231 6:106815229-106815251 TAAGACTCCTTGGGAGAAACAGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015578763 6:134701435-134701457 GGAGACTCCTGTGTAGAAAGGGG - Intergenic
1016711074 6:147172552-147172574 TTTGCATCCTTGGGAGAAAGAGG + Intergenic
1018663613 6:166113220-166113242 TGAGAATAAATGGGAGAAAGTGG + Intergenic
1018668851 6:166163305-166163327 TGATTCTCCTGGGGAGAATGGGG - Intronic
1019380633 7:720732-720754 TGAAATTCCTTGGGAAAAAGAGG - Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1020415410 7:7940543-7940565 TGAGAATCCTTGGAAGACAGTGG - Intronic
1022383453 7:29882016-29882038 TGAGACTGCAGAGGAGAAAGGGG - Intronic
1022534547 7:31087698-31087720 TGAGTGTCCTTGGGATGAAGAGG + Intronic
1022844045 7:34192038-34192060 TTAGACTCCTGGAGAAAAAGAGG - Intergenic
1022990004 7:35697291-35697313 TCAGACTCCTTTGAAGCAAGGGG + Intergenic
1024638246 7:51308631-51308653 AGAGACTCCTTGTTAGAATGAGG - Intronic
1027207100 7:76109250-76109272 TGAGACTGCTAGGTAGGAAGGGG - Intergenic
1029131984 7:98338470-98338492 TGAGGCTTCATGCGAGAAAGGGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030239811 7:107309898-107309920 TGCCAGTCCTTGGGAGAGAGGGG - Intronic
1030274358 7:107703879-107703901 TGTTACTCATTGGGAGAAACTGG - Intronic
1032831032 7:135626076-135626098 TGAAAATCCTAGGAAGAAAGCGG + Intronic
1033354380 7:140587600-140587622 TGAGTCTGTCTGGGAGAAAGGGG - Intronic
1033414753 7:141152018-141152040 TGTGACTCGTAGGGAGAGAGGGG + Intronic
1034621421 7:152460154-152460176 TGAGACTGCTCTGGAGAAAGGGG + Intergenic
1035434759 7:158850874-158850896 TTAGAGTCCTGGGGAAAAAGAGG - Intergenic
1035456792 7:159014063-159014085 TGGGACTCCTTGGGAGACCGAGG + Intergenic
1035830967 8:2694055-2694077 TGAGATTACCTGGGAGAAAAGGG + Intergenic
1037865608 8:22440614-22440636 TCACACTCCTTGAGACAAAGCGG + Intergenic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1039554268 8:38465794-38465816 TGAGACTGTTTAGCAGAAAGTGG - Intronic
1040870829 8:52098871-52098893 TGGTAATCCTTGGGAGAAACAGG + Intergenic
1041106183 8:54446185-54446207 TGAGCCTGCTTTGGAGACAGAGG + Intergenic
1041802581 8:61815808-61815830 TGAGGATCATTGGGAGAATGGGG - Intergenic
1045936623 8:107686937-107686959 AGTGACTATTTGGGAGAAAGAGG - Intergenic
1046034029 8:108820153-108820175 TCAGCTTCATTGGGAGAAAGAGG + Intergenic
1046579019 8:116068557-116068579 TGGGACTCCTTGAGACAAACAGG + Intergenic
1048187314 8:132253177-132253199 TCAAACTCCTGGGGAGTAAGTGG - Intronic
1048437501 8:134431989-134432011 TAAGCCTTCTTGGGAGAATGAGG + Intergenic
1048442846 8:134472578-134472600 TGAGACTCCAAGAGGGAAAGGGG - Intergenic
1048578218 8:135709601-135709623 TGACACTCCTTGGGACACTGGGG + Intergenic
1048654281 8:136518171-136518193 ACAGACTCCGTGGGAGAAAGGGG - Intergenic
1048686954 8:136915565-136915587 TGGGACTCCTTAGGAAAATGGGG - Intergenic
1049204086 8:141355317-141355339 TGAGGCTCAGAGGGAGAAAGGGG - Intergenic
1049298605 8:141856893-141856915 TGAGGGCCCTGGGGAGAAAGGGG + Intergenic
1049389459 8:142360528-142360550 GAAGCCTCCTTGGGAGCAAGTGG - Intronic
1050401601 9:5262007-5262029 TGGAACTCCTTGGGGAAAAGAGG - Intergenic
1052743485 9:32416435-32416457 AGACACTCCTTGGGAAAAAAGGG - Intronic
1052988256 9:34503293-34503315 AGTGCCTCCATGGGAGAAAGAGG + Intronic
1053267327 9:36724804-36724826 TGAGAGACATTTGGAGAAAGAGG + Intergenic
1054811897 9:69441705-69441727 TGTGCCTCCTTGGGAGAATGGGG + Intronic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058528444 9:105883241-105883263 TGAGAGTCATTGGGAGACACGGG - Intergenic
1060121428 9:120994015-120994037 TGAGACGAGTTGGGAGAAAAGGG + Intronic
1060730076 9:126031465-126031487 AGAGACTCCTTGGGAGATGGAGG - Intergenic
1185784098 X:2875233-2875255 TGAGACTCCTTGGGAGGATTAGG + Intronic
1186203098 X:7173891-7173913 GTAGAATCTTTGGGAGAAAGTGG + Intergenic
1186526074 X:10249511-10249533 TGAGGATCCTTAGAAGAAAGAGG + Intergenic
1189061916 X:37763394-37763416 TGAGATTCCTTGGGTGAATAAGG - Intronic
1189326128 X:40112227-40112249 TGAGACTGGTGGGGAGGAAGGGG - Intronic
1190495749 X:51027120-51027142 TGAAACCCTTTGGGTGAAAGCGG + Intergenic
1190510172 X:51166478-51166500 TGAAACTCTTTAGGTGAAAGTGG - Intergenic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1191938634 X:66453771-66453793 GGAGACTCTTTGGGAGGAAGCGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1194812865 X:98407142-98407164 TGAGAACCAATGGGAGAAAGTGG + Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1199076808 X:143534686-143534708 TGGGACAACTTGGGAGAAAAGGG - Intergenic
1200206743 X:154321774-154321796 AGGGACTCCCTGGGAGAATGAGG + Intronic
1201020091 Y:9647326-9647348 TGTGACTGCCAGGGAGAAAGAGG - Intergenic
1202302964 Y:23437238-23437260 TGTGGCTCCTTGGGAAAAAGAGG - Intergenic
1202567847 Y:26233356-26233378 TGTGGCTCCTTGGGAAAAAGAGG + Intergenic