ID: 1135740692

View in Genome Browser
Species Human (GRCh38)
Location 16:24972870-24972892
Sequence ACTGAACTCCTCCACAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135740692 Original CRISPR ACTGAACTCCTCCACAGGGA GGG Intronic
902199409 1:14822576-14822598 TTTGAACTACTGCACAGGGACGG - Intronic
904051726 1:27643876-27643898 ACTGACCTCATGCACAGGCAGGG + Intergenic
907318322 1:53586885-53586907 ACTCAGCTCCTCCACAATGAAGG + Intronic
914257647 1:145973769-145973791 AGTGAAGTCCTGCACTGGGAGGG + Intronic
915011215 1:152687806-152687828 ACTGAACTCCTTCTCAGGGAGGG + Intergenic
915713632 1:157924553-157924575 ACTGAACCTCTCCAAAGTGAGGG + Intergenic
920698680 1:208201339-208201361 ACTGACCCCCTCCCCAGGGTGGG - Intronic
1063535130 10:6876062-6876084 CCTGAGCTCCTCCTCAGGGCAGG - Intergenic
1067173585 10:43926928-43926950 ACAGCACACCTCCACAGGGCAGG - Intergenic
1069619755 10:69829616-69829638 ACTGGCCTGCTCCACAAGGAAGG + Intronic
1072567415 10:96628524-96628546 ATTGGTCTCCTCCACAGGCAAGG + Intronic
1073901141 10:108222363-108222385 ACTGACCACCTCCAAAGGGCTGG - Intergenic
1075477976 10:122753054-122753076 ACTCAGCTCCTCCAGAGGCAAGG - Intergenic
1076047932 10:127309759-127309781 AAGGAAGTCCTCCACAGGGCTGG - Intronic
1076362573 10:129899644-129899666 GTTGAACTCCTCCACAGGTGAGG + Intronic
1076613719 10:131742993-131743015 ACTGAAAGCCACCACAGTGAAGG + Intergenic
1078872428 11:15361280-15361302 ACTGCACACCACTACAGGGAGGG - Intergenic
1079162152 11:18005310-18005332 ACAGAACCCCTCCACAGAGGAGG + Intronic
1081596579 11:44463617-44463639 TCTGTACCCCACCACAGGGAGGG - Intergenic
1083857305 11:65399610-65399632 ACTGAAACCCGCCCCAGGGAAGG - Intronic
1084907340 11:72358181-72358203 ACTGATGTTCTCCAAAGGGAGGG + Intronic
1085756386 11:79205417-79205439 ACAGAACGTCTCCACAGGCAAGG + Intronic
1085825416 11:79841662-79841684 GCTGAACTTCTCCAGAGGAAAGG - Intergenic
1086110661 11:83194636-83194658 ACTCAACTCCTCCCCAGAGTCGG + Exonic
1087019019 11:93583906-93583928 TCTTTACTCTTCCACAGGGATGG - Intergenic
1087498791 11:98924291-98924313 ACTGAACTATTCCACAAGGTGGG + Intergenic
1088224956 11:107609803-107609825 CCTGAACTCATCCAAAGGGAAGG - Intronic
1089057357 11:115596853-115596875 GCTAAACTCCCCCACAGGGCTGG + Intergenic
1089672057 11:120063372-120063394 TCTGAGCCCCTCCCCAGGGAGGG + Intergenic
1090621917 11:128568061-128568083 ACTGTGCTCCACCTCAGGGAAGG - Intronic
1092730941 12:11533824-11533846 ACTCCCCTCCTTCACAGGGAGGG + Intergenic
1095169222 12:39013954-39013976 ACTGTACTCCTTCAGTGGGAAGG - Intergenic
1096363504 12:51008470-51008492 ACTAACCTCCTCCTCAGGAATGG + Exonic
1100919147 12:99462797-99462819 ACTCATGACCTCCACAGGGAGGG - Intronic
1101816745 12:108151442-108151464 AATGACCTCCTCCCCAGGGGTGG + Intronic
1102381047 12:112467136-112467158 ACTTAACTCCTCCACAGTAGTGG + Intronic
1102622831 12:114210343-114210365 GCTGAACTCTCCCATAGGGAAGG + Intergenic
1103454475 12:121054027-121054049 ACAGAGCGTCTCCACAGGGAAGG - Intergenic
1105837933 13:24226685-24226707 ACTGAGGTCCTCCCCAGGGATGG - Intronic
1106451817 13:29889013-29889035 CCTGAGCTGCTCCACGGGGATGG - Intergenic
1112813925 13:103250796-103250818 ACTGAACCCCACCCCACGGAAGG - Intergenic
1113247987 13:108420114-108420136 ACTGAACACTTCAGCAGGGAGGG - Intergenic
1114415910 14:22543986-22544008 ACTGATCTCCCCCACAAGGCAGG - Intergenic
1117529829 14:56649314-56649336 AAGTAACTTCTCCACAGGGAAGG + Exonic
1120195573 14:81478716-81478738 GCTGAAGTCCTCCACAGATAGGG - Intronic
1120250153 14:82053464-82053486 ACTTCAATACTCCACAGGGAAGG - Intergenic
1121496907 14:94398692-94398714 ACTGAACTAACACACAGGGAAGG - Intergenic
1121558733 14:94858384-94858406 CCTGAGCTCCTCCAAAAGGAGGG - Intergenic
1122278262 14:100606324-100606346 ACTGAAATTATCCAGAGGGAAGG + Intergenic
1123065453 14:105616791-105616813 GCTGAGCCCCTGCACAGGGAAGG - Intergenic
1123069657 14:105636257-105636279 GCTGAGCCCCTCCACAGGGAAGG - Intergenic
1123088750 14:105732040-105732062 GCTGAGCCCCTCCACAGGGAAGG - Intergenic
1123094679 14:105761297-105761319 GCTGAGCCCCTGCACAGGGAAGG - Intergenic
1123427153 15:20182055-20182077 AATGAACGCCTCCTCGGGGATGG - Intergenic
1123536382 15:21188564-21188586 AATGAACGCCTCCTCGGGGATGG - Intergenic
1123801697 15:23827959-23827981 ACTAAACTCCTGCATAGCGAAGG - Intergenic
1129869614 15:78932093-78932115 TCTGAACCCCTCCGCCGGGAAGG + Intronic
1130326941 15:82888951-82888973 CCTCCACTCCTCCCCAGGGAAGG - Intronic
1130474387 15:84251238-84251260 ACTGAAAGCGACCACAGGGAAGG - Intergenic
1130481802 15:84365286-84365308 ACTGAAAGCGACCACAGGGAAGG - Intergenic
1131551015 15:93357140-93357162 ACTGAACTCCTTCACCTGGTTGG - Intergenic
1134189668 16:12111482-12111504 AGTGGACTCCTGCGCAGGGAGGG - Intronic
1135740692 16:24972870-24972892 ACTGAACTCCTCCACAGGGAGGG + Intronic
1136143275 16:28300932-28300954 CCTGAGCTCCTACACCGGGATGG - Intronic
1136857145 16:33667781-33667803 AATGAACGCCTCCTCGGGGATGG + Intergenic
1137958175 16:52853618-52853640 ACTCAACTTCTCCACAAAGAAGG - Intergenic
1138176518 16:54903393-54903415 AATGAACTCCTCTATAGGTAAGG - Intergenic
1139113198 16:63917798-63917820 ACTGAACTCTTTCTCAGGAATGG - Intergenic
1203118718 16_KI270728v1_random:1516272-1516294 AATGAACGCCTCCTCGGGGATGG + Intergenic
1142504343 17:353279-353301 AATGAACCCCTGCACAGCGAGGG + Intronic
1143906956 17:10216558-10216580 CCTGGACTTCTCCACAGGAAAGG + Intergenic
1148082895 17:44977231-44977253 ACTGAACTCCTACACAGGGCCGG + Intergenic
1151166869 17:72211349-72211371 ACTGTCCTGCACCACAGGGATGG - Intergenic
1158555340 18:58470352-58470374 TCTGAAGTCCACCACTGGGAGGG + Intergenic
1160358485 18:78248804-78248826 ACTAAGCCCCTTCACAGGGAAGG + Intergenic
1161233580 19:3187361-3187383 ACGGGACTCCTTCACAGGGAAGG - Intronic
1162175449 19:8826853-8826875 GCTGAACTCACCCAAAGGGAAGG - Intronic
1166500849 19:43340103-43340125 CCTGAGCTGCTCCACAGGGAGGG - Intergenic
1166509250 19:43393314-43393336 CCTGAGCTGCTCCACGGGGAGGG + Intergenic
1167533635 19:50034783-50034805 ACTCAACTGCACCACAAGGATGG - Intronic
1167661404 19:50798017-50798039 ACCGAACAGCTCCACAGGGAGGG + Exonic
925478845 2:4248007-4248029 TCTGACCTCCCCCACTGGGAGGG + Intergenic
925708727 2:6716227-6716249 TCTGAACTCCTGCTCAGGGATGG - Intergenic
929750927 2:44712703-44712725 ACTGAAGTCCTCCAGAAGGTGGG + Intronic
930111009 2:47678515-47678537 ACTGAACAACTCCACAGGAAGGG - Intergenic
930826871 2:55703889-55703911 TCTGACTTCCTCCACAGAGAGGG + Intergenic
931134511 2:59382043-59382065 ACTGAACTTCTGCACAGCAAAGG + Intergenic
932417609 2:71583344-71583366 ACTCAACTCCTACACAGGATGGG - Intronic
935585416 2:104796378-104796400 GCTGACTTCCTCCACAGGGAAGG + Intergenic
938080997 2:128370105-128370127 CTTGGCCTCCTCCACAGGGACGG - Intergenic
944580638 2:201129725-201129747 ACAGAACTCCCCCACTGGAAAGG + Exonic
946754854 2:222933595-222933617 ACAGAACTACTCCAGAGGAATGG + Intronic
947959876 2:234227577-234227599 ACTGAGCACCTCCTAAGGGAAGG - Intergenic
948839271 2:240641195-240641217 ACTAAACTGTTCCACAGGAAAGG - Intergenic
948846472 2:240685134-240685156 CCTGAACTTCCCCAGAGGGAGGG + Intergenic
948847390 2:240689599-240689621 CCTGAACTTCCCCAGAGGGAGGG - Intergenic
1168805913 20:672263-672285 ACAGAACTCCTAAACAGGGAAGG - Intronic
1172345472 20:34195214-34195236 ACTGAGCTGCTCCTCATGGAAGG + Intronic
1173334910 20:42104638-42104660 ACGGAACTCACACACAGGGATGG + Exonic
1175549928 20:59810796-59810818 GCTGAGCTCCTACACAGAGAGGG - Intronic
1175585267 20:60134109-60134131 ATTGACCTGCCCCACAGGGATGG + Intergenic
1184017826 22:41799548-41799570 ACTGATGGCCTCCTCAGGGAAGG + Intergenic
952946225 3:38479348-38479370 GGTGGACACCTCCACAGGGAAGG - Intronic
954712226 3:52510880-52510902 CCTGAAATGCTCCACATGGAAGG - Intronic
955495096 3:59522739-59522761 ACAGAAATACTCCACAGTGATGG - Intergenic
958257896 3:91346392-91346414 ACAGCACTCCTCCACACAGAGGG - Intergenic
961447469 3:126987646-126987668 GAGGAATTCCTCCACAGGGAAGG - Intergenic
961781977 3:129325635-129325657 GCTGGCCTCCTCCACAGAGAGGG + Intergenic
969433281 4:7168569-7168591 ACTGAGAGCTTCCACAGGGAAGG + Intergenic
971599441 4:28573280-28573302 ACTTAACAGTTCCACAGGGATGG - Intergenic
972445636 4:39140906-39140928 TCTTATCTCTTCCACAGGGAAGG - Intergenic
972918067 4:43904730-43904752 ACTGAACCCCACCACATGGAAGG + Intergenic
974468061 4:62283203-62283225 AATGGACTCCTCCACAGAAATGG + Intergenic
981278955 4:142935425-142935447 TCTGAAGGCCTCCATAGGGATGG + Intergenic
982565904 4:156986478-156986500 CCTGAACTCCTCCCCAGGGGTGG + Intergenic
985723198 5:1501455-1501477 ACTTACTTCCTCCACAGGGCCGG + Exonic
985745150 5:1642638-1642660 CCAGGACTCCTCCACAGGCAGGG + Intergenic
985865606 5:2511737-2511759 TGAGCACTCCTCCACAGGGAGGG - Intergenic
986365112 5:7021692-7021714 ACTGAACCCCACCCCATGGAAGG - Intergenic
990745725 5:58958121-58958143 ACAGAACTCCTCAACAGCAAGGG - Intergenic
992896859 5:81253120-81253142 AATTCATTCCTCCACAGGGAGGG - Intronic
994821590 5:104658517-104658539 AATGAACTCTTCTACAGGGTTGG + Intergenic
995114128 5:108459775-108459797 ACTGAAGTCCTAAACAGTGAGGG + Intergenic
995691932 5:114836479-114836501 ACTTACCTCCTCCACAAAGAAGG + Intergenic
997441721 5:133913272-133913294 ACTGAACTGCTCCAGAGAGAGGG + Intergenic
997529451 5:134572915-134572937 ACAGAACTCCTCAGCAGAGAGGG - Intronic
997531172 5:134582057-134582079 ACACAGCTCCTCCGCAGGGAAGG + Exonic
997626059 5:135331228-135331250 ACTGAGATTCTCCACAGAGAGGG + Intronic
998521352 5:142803767-142803789 GCTGGACTCCTCCACAGATAAGG - Intronic
1000249477 5:159480362-159480384 ACCCAACTCCTCCACAGAGAGGG - Intergenic
1002480208 5:179496176-179496198 ACGGAAGTCCTCCGCAGGGATGG + Intergenic
1005229386 6:23683147-23683169 GCAGACCTCCTCCACAAGGAGGG + Intergenic
1008997375 6:57674377-57674399 ACAGCACTCCTCCACACAGAGGG + Intergenic
1009185884 6:60573715-60573737 ACAGCACTCCTCCACACAGAGGG + Intergenic
1010060594 6:71618058-71618080 ACAGAACCCCTCTGCAGGGAAGG - Intergenic
1012529646 6:100220256-100220278 ACTGAAGTGCTCCAGAGGTACGG - Intergenic
1014097682 6:117478521-117478543 GCTGAGCTCTGCCACAGGGAGGG + Intronic
1014724056 6:124954948-124954970 ACTCATCTCCTCCACAGAGAAGG + Intergenic
1017222883 6:151987013-151987035 ACCAATCTCCTCTACAGGGAAGG + Intronic
1018927780 6:168218446-168218468 ACTAAACTACCCCCCAGGGAAGG - Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1021581111 7:22154397-22154419 ACTGATCTCCTTCAAAAGGAGGG - Intronic
1021839811 7:24713458-24713480 CCTGAACCCCGTCACAGGGAAGG + Intronic
1026054859 7:66975241-66975263 ACTGAACTCATCCACTGCGTAGG - Intergenic
1026074892 7:67157081-67157103 ACTCACCTCCTCCACAAAGAAGG - Intronic
1026701965 7:72655081-72655103 ACTCACCTCCTCCACAAAGAAGG + Intronic
1027874936 7:83756707-83756729 ACTGAACTTCTTAACAGGGAGGG - Intergenic
1029306548 7:99624088-99624110 CCTCCACTCCTCCTCAGGGAAGG - Exonic
1029436995 7:100569031-100569053 ACTGACCCCCTCCAAGGGGATGG - Intergenic
1031865570 7:127035573-127035595 ACTGAGCTCCTCAAAAGGCAGGG + Intronic
1031955724 7:127940397-127940419 AATGGACTCCCCCACAGGGCTGG - Intronic
1032419658 7:131767889-131767911 ACTGCAGTGCTCCACAGAGAGGG + Intergenic
1033775283 7:144602479-144602501 ACTGACCACCTCCACTAGGAAGG + Intronic
1035473880 7:159128859-159128881 ACTGAGCTCAGCCGCAGGGAGGG - Intronic
1035648139 8:1244007-1244029 TCTGCACTCCACCATAGGGATGG + Intergenic
1038583468 8:28769904-28769926 CACGAACTGCTCCACAGGGATGG + Exonic
1045030269 8:98128262-98128284 ACTGAATTCCTCCACCAAGAAGG - Intronic
1045071792 8:98513896-98513918 ACTGAGCTCTTCCTCAGAGATGG - Intronic
1046967820 8:120186870-120186892 ACTGAACTCCTTGACTGGGGAGG - Intronic
1050318044 9:4423293-4423315 ACTAAACTCCACCACACGGAAGG + Intergenic
1050364240 9:4859421-4859443 ATTGAAATCCTCCTGAGGGAAGG + Intronic
1052646442 9:31241366-31241388 ACTGAATTCCTCCAAATTGAAGG - Intergenic
1055283572 9:74702939-74702961 ACTGAGTTCCTCCCCAGGGCAGG - Intergenic
1058651733 9:107181386-107181408 ACTCACTTCCTCCACAAGGAAGG + Intergenic
1060665659 9:125430777-125430799 ACTGAGATCCTACACAGGGAGGG - Intergenic
1061037183 9:128120392-128120414 ACTGAACTCTCCCACAAGGCGGG + Intergenic
1061518708 9:131104610-131104632 ACTGGCCTACTCCACGGGGAGGG + Intronic
1192039677 X:67605325-67605347 ACTGAACTCATTCCCAGGGAAGG - Intronic
1192851226 X:74958333-74958355 ACTGACCTCCTGCCCAGGAATGG + Intergenic
1196978208 X:121183246-121183268 ACTGAACCCCTACACAGGTTAGG - Intergenic
1199184629 X:144900827-144900849 ACTTAACTCCTCCTCACAGAGGG + Intergenic
1199666281 X:150099079-150099101 CCTGAAGTCCTCCCCAGGGAAGG + Intergenic
1201054243 Y:9972915-9972937 ACTCACCTCCTCCACAAAGAAGG + Intergenic
1202376603 Y:24243627-24243649 ACTGAAAGCCACCACATGGAAGG + Intergenic
1202494177 Y:25426492-25426514 ACTGAAAGCCACCACATGGAAGG - Intergenic