ID: 1135744850

View in Genome Browser
Species Human (GRCh38)
Location 16:25008149-25008171
Sequence CAAAATGGTGATAGGGATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 303}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135744850_1135744855 25 Left 1135744850 16:25008149-25008171 CCACAATCCCTATCACCATTTTG 0: 1
1: 0
2: 1
3: 23
4: 303
Right 1135744855 16:25008197-25008219 ATCTTTTTTTGTAACTTATTTGG 0: 1
1: 1
2: 4
3: 73
4: 722

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135744850 Original CRISPR CAAAATGGTGATAGGGATTG TGG (reversed) Intronic
900567492 1:3340791-3340813 CAAAATGGTGTCAGGGTGTGGGG + Intronic
901275802 1:7990108-7990130 GGAGATGGTGATAGTGATTGTGG - Intergenic
907124419 1:52036891-52036913 CAAAATCATGAAAGAGATTGTGG - Intronic
907613365 1:55895812-55895834 TAAAATGGTGATAAGGAATAAGG - Intergenic
908650147 1:66323913-66323935 CAAGAAAGTGATAGGGATAGAGG - Intronic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909610969 1:77551526-77551548 CAAAATGAGGAGGGGGATTGGGG + Intronic
909957563 1:81799571-81799593 CAAAATACTGATAGGTATTTAGG + Intronic
911742931 1:101407137-101407159 TAAAATGGGGATAAGTATTGTGG + Intergenic
912239698 1:107892842-107892864 TAAAATGGTTATAGGGATGGGGG - Intronic
912575474 1:110667390-110667412 CAGTATGGTGATAGTGATTGGGG - Intergenic
912842112 1:113048193-113048215 CAGAATGGTGGGAGGGGTTGAGG + Intergenic
913142743 1:115957296-115957318 CAAAATGAGAAAAGGGATTGAGG + Intergenic
913941671 1:125115244-125115266 GAAAATGTAGTTAGGGATTGGGG + Intergenic
914412192 1:147440602-147440624 CAAAATGGTGACTTGGACTGGGG + Intergenic
915369836 1:155339526-155339548 CAAAATGCTGATAATCATTGTGG - Intronic
916722367 1:167494060-167494082 CAAAATGATGACAGAGCTTGGGG + Intronic
916976176 1:170081896-170081918 CATTATGGTGGTAGGTATTGTGG - Intronic
917192190 1:172429886-172429908 CAAAATGGTGCCAAGGATTAAGG - Intronic
918252704 1:182717798-182717820 AAAGATGGTTCTAGGGATTGAGG - Intergenic
919675425 1:200377559-200377581 CAAACTGGTAAAATGGATTGTGG - Intergenic
919991525 1:202710805-202710827 CAAAATGGCCATGGGGATGGGGG - Intergenic
922026774 1:221757086-221757108 CAAAATGGTGGTGGTGTTTGTGG - Intergenic
922053305 1:222015944-222015966 CAACATGGTGCTAGGCACTGGGG + Intergenic
922739943 1:228009107-228009129 CAAAGTGGTGGTGGGGATGGGGG - Intronic
923127270 1:231042833-231042855 CAAGATGGTGATGGGTATGGTGG - Intergenic
1062958634 10:1556900-1556922 AAAAATAGTGATAGGAATAGAGG - Intronic
1063753635 10:8980918-8980940 CAAAAGGGTGAAAGGGATCATGG - Intergenic
1064409267 10:15091325-15091347 CAAAATGGTGGTGGGAATTAGGG - Intergenic
1064625981 10:17261753-17261775 TAAACTGGTGGTAGGGATGGTGG + Intergenic
1065242269 10:23718815-23718837 CAACTTGGAGAGAGGGATTGAGG + Intronic
1065305640 10:24365904-24365926 CACAATGGTGATATGGATCATGG + Intronic
1065542146 10:26781061-26781083 CAAACAGGTCATAAGGATTGTGG - Intronic
1066951025 10:42116278-42116300 GAAAATGTAGTTAGGGATTGGGG - Intergenic
1066954749 10:42153838-42153860 GAAAATGTAGTTAGGGATTGGGG - Intergenic
1067205789 10:44211843-44211865 CAAAATCATGATTGAGATTGAGG + Intergenic
1067797383 10:49330593-49330615 GAAGATGGAGATAGGGATTCTGG - Intergenic
1067949828 10:50723215-50723237 CAAGTTGGTGATAGGTAGTGCGG - Intergenic
1068743155 10:60498031-60498053 CAATTTGGAGATAGAGATTGTGG - Intronic
1068962508 10:62879980-62880002 CAAAAACGTGTTAGGGATTCAGG + Intronic
1069600542 10:69703449-69703471 GAAAATGGAGACAGGGATTAGGG - Intergenic
1069894336 10:71671321-71671343 CCAGATGGTGACAGGGATTGGGG - Intronic
1070255486 10:74810093-74810115 CAAAATGTTGATAATGTTTGCGG + Intergenic
1070885135 10:79888247-79888269 CAAGTTGGTGATAGGTAGTGCGG - Intergenic
1071012684 10:80956114-80956136 CAAATTGGTAGTAGGGATAGAGG - Intergenic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1074178103 10:111031635-111031657 CAGAATGGTGATATAAATTGTGG - Intergenic
1078002475 11:7508793-7508815 CAGAATGGTGCTAAGTATTGAGG - Intronic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1082038761 11:47667459-47667481 CAAAAAGGGGATGGAGATTGGGG - Intronic
1084305768 11:68282463-68282485 CAAAATTGTGAAAGAGATGGGGG - Intergenic
1085088496 11:73689663-73689685 CAAAGTGGTGGTGGGGGTTGAGG - Intronic
1086653819 11:89324826-89324848 CAAAAAAGTGATAGGAAATGTGG - Intronic
1086790584 11:91033183-91033205 CAAAATTGCAATAGAGATTGGGG + Intergenic
1087045839 11:93843231-93843253 TAACCTGGTGCTAGGGATTGGGG - Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1088108405 11:106230826-106230848 AATAATGGTAATAGGAATTGAGG + Intergenic
1090000813 11:122955957-122955979 CAAAATGGTAATAGGAACAGTGG + Intronic
1090034878 11:123240423-123240445 CAGCTTGGTGCTAGGGATTGTGG - Intergenic
1090925129 11:131242913-131242935 CAAAAGGGTCAAAGGGATTAGGG - Intergenic
1091261765 11:134240096-134240118 CAAGATGGAGGTTGGGATTGAGG + Exonic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1092760236 12:11803644-11803666 CAAAATGGTGATTTAGTTTGGGG + Intronic
1093473181 12:19526976-19526998 AAAAATGGGGACAGGGATAGGGG + Intronic
1094738176 12:33259101-33259123 CAAAATGCTGTTAGTGAATGTGG + Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095803841 12:46296736-46296758 CACAATGGGGACAGGTATTGAGG - Intergenic
1095804106 12:46299509-46299531 TAACATGGTGATAGAGAATGTGG - Intergenic
1096754278 12:53785757-53785779 CAAAATGGTGAAAAAGACTGGGG + Intergenic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1097998166 12:65913174-65913196 CAAAATGGTGGAAGGAATGGAGG - Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099575715 12:84378585-84378607 CAACTTGGTAATAGGGAATGGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099915118 12:88883245-88883267 CAAAATGGTTATTTGGATTAAGG + Intergenic
1101344436 12:103873136-103873158 CAAAATGGTGAGGGAGAATGTGG + Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1103055571 12:117817652-117817674 AAATATGGGGACAGGGATTGGGG - Intronic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1104974155 12:132544743-132544765 GACAATGGTGATAGTGATTATGG + Intronic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105663058 13:22520820-22520842 CAAAAGGGTGAGAGGGTGTGAGG - Intergenic
1108327997 13:49353812-49353834 CCAAATGGAGATGGGGATAGGGG - Intronic
1109647257 13:65274757-65274779 CAAAATGGTGATGGGTATAGGGG - Intergenic
1110526385 13:76543233-76543255 CATCATGGTGATATGGAGTGGGG - Intergenic
1110685653 13:78370501-78370523 CAAGATGGTGACAGGGAATATGG - Intergenic
1110763443 13:79255051-79255073 CAAAATTGTGCTAGGCACTGGGG - Intergenic
1111580551 13:90217454-90217476 GAAAATGATGATAGGGATGACGG + Intergenic
1113062631 13:106339768-106339790 TAAAATTTTGATAGGTATTGAGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114917271 14:27284740-27284762 CAAAATGCTGATAAAGATTTTGG + Intergenic
1116629538 14:47312359-47312381 CAAAATGGTAAAAGTGCTTGTGG - Intronic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1117497767 14:56322805-56322827 CATAATGGTGAGAGGGCATGTGG - Intergenic
1117925639 14:60776501-60776523 AAAAATGATGATAGGTATAGTGG + Intronic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120995858 14:90418425-90418447 CAAAATGGGCACAGGGACTGTGG - Intergenic
1122135509 14:99630565-99630587 GACGATGGTGATAGGCATTGTGG + Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127643800 15:60940094-60940116 AAAAATGCTGATAGGGTTGGAGG - Intronic
1127876011 15:63112018-63112040 CAAAATGGAGATAGTGATGCAGG - Intergenic
1128721049 15:69948535-69948557 CAAAATGGAGGCAGGGGTTGGGG - Intergenic
1129165916 15:73777399-73777421 CAAAATGGAGATAGCAATAGGGG - Intergenic
1129955701 15:79634916-79634938 CAGGATGGTGATAGGAAATGGGG + Intergenic
1135406817 16:22204536-22204558 AAATATGGTGCTAGGAATTGGGG - Intergenic
1135744850 16:25008149-25008171 CAAAATGGTGATAGGGATTGTGG - Intronic
1136696891 16:32088877-32088899 GAAAATGTAGTTAGGGATTGGGG - Intergenic
1136797391 16:33032167-33032189 GAAAATGTAGTTAGGGATTGGGG - Intergenic
1136939195 16:34504377-34504399 GAAAATGTAGTTAGGGATTGGGG - Intergenic
1136960625 16:34844184-34844206 GAAAATGTAGTTAGGGATTGGGG + Intergenic
1137084785 16:36105576-36105598 GAAAATGTAGTTAGGGATTGGGG - Intergenic
1137219411 16:46431869-46431891 GAAAATGTAGTTAGGGATTGGGG - Intergenic
1139091396 16:63652296-63652318 CACAATGGTGCTAGGGATAGCGG - Intergenic
1141588803 16:85053427-85053449 CAACATGTTGATAGAGAATGTGG - Intronic
1141823621 16:86464171-86464193 GAAAATGGTGATAGTGATGGTGG + Intergenic
1145326810 17:21838949-21838971 GAAAATGTAGTTAGGGATTGCGG + Intergenic
1145689790 17:26728128-26728150 GAAAATGTAGTTAGGGATTGGGG + Intergenic
1146025938 17:29320984-29321006 CAGAATGGTGGTAGAGGTTGGGG - Intergenic
1146461531 17:33049857-33049879 CAAAATGGTGAGGGGCATGGGGG - Intronic
1146640906 17:34540684-34540706 CAAAATGGTGATAGGGAAGCTGG - Intergenic
1149216291 17:54358184-54358206 CAAAATGCTGATAAGCATTATGG - Intergenic
1203190993 17_KI270729v1_random:189531-189553 GAAAATGTAGTTAGGGATTGGGG + Intergenic
1154236736 18:12612931-12612953 CATAATGGTGGTAGTGATGGTGG - Intronic
1154516207 18:15168227-15168249 GAAAATGTAGTTAGGGATTGGGG - Intergenic
1155104083 18:22643245-22643267 CTAAATGCTGATTGGAATTGTGG - Intergenic
1155931040 18:31708803-31708825 CAAAATGGTGATGGCAATGGGGG + Intergenic
1156135068 18:34027682-34027704 CCAAATGGTCATAGGTAGTGAGG + Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156335030 18:36163049-36163071 CAAAAAGGTGGGAGGGGTTGAGG - Intronic
1159568643 18:70085906-70085928 CGTAATGGTGGTGGGGATTGGGG - Intronic
1160538185 18:79606547-79606569 CGAAATGGTGAAAGGGTGTGGGG + Intergenic
1163447925 19:17358420-17358442 CAAAATGGTCATAGGCACAGTGG + Intronic
1163585822 19:18162896-18162918 AAAAAAGGGGACAGGGATTGAGG + Intronic
1165293997 19:34911437-34911459 AAGAATGGTGATAGGGATAAGGG + Intergenic
1167213035 19:48145478-48145500 CAAAATGGGGACAAGGGTTGGGG + Intronic
1202669237 1_KI270709v1_random:35966-35988 GAAAATGTAGTTAGGGATTGGGG + Intergenic
925210866 2:2044832-2044854 CAAAATAGAGGTAGGGGTTGAGG - Intronic
928756704 2:34534996-34535018 CAAAATTGTGGTGGGGATTAAGG + Intergenic
929686778 2:44041969-44041991 CCAAATGTTGATAATGATTGAGG - Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
931446984 2:62335021-62335043 CAAAGAGGTGATTAGGATTGGGG + Intergenic
931562008 2:63572168-63572190 CAGTATGGTGGTAGGGAGTGAGG - Intronic
932234187 2:70108057-70108079 CAGAATGGAGATAAGGATTTGGG + Intergenic
933127412 2:78626607-78626629 GAAAATGTTGATATAGATTGTGG + Intergenic
934252059 2:90363880-90363902 GAAAATGTAGTTAGGGATTGGGG - Intergenic
934257382 2:91439076-91439098 GAAAATGTAGTTAGGGATTGGGG + Intergenic
934656790 2:96120546-96120568 CAGAAAGGTGATGGGGCTTGGGG - Intergenic
935131802 2:100266228-100266250 CACAATGGTGGCAGGGATGGAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937268779 2:120633784-120633806 CAAAATGGTGATGAGGAGAGGGG + Intergenic
937871030 2:126786407-126786429 CACAGTGGTGAAAGGGATTTGGG + Intergenic
938186492 2:129236775-129236797 CAAAATGTTGATAGGAATCTGGG + Intergenic
938516540 2:132013243-132013265 GAAAATGTAGTTAGGGATTGGGG - Intergenic
939545280 2:143544655-143544677 CAAAAGTGTGCTAGGCATTGGGG - Intronic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940956403 2:159732861-159732883 TGAAATGGTGATAGTGATAGCGG + Intronic
944180664 2:196889356-196889378 AAAAAAGATGATAGGCATTGTGG - Intronic
944986225 2:205180845-205180867 CAAGATGGTAATAGGGATGGAGG + Intronic
945195592 2:207234589-207234611 AGAAATGGTGATAGGGATGGTGG - Intergenic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
948258912 2:236588840-236588862 CAACATGGTGAGAAGGATTCTGG + Intergenic
1169847379 20:10009128-10009150 CCAAAGGGTGATAGGGAATCTGG + Intronic
1170220404 20:13935892-13935914 GGAAATGGTGATAGTGGTTGTGG + Intronic
1170383009 20:15782601-15782623 GAAAATGGTTATAGGGCTTTTGG - Intronic
1171246382 20:23613329-23613351 CAAAAGGGTGATGTGGGTTGGGG + Intergenic
1177209838 21:18057438-18057460 CAGAATGTTGATATGGAATGAGG - Intronic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1181379630 22:22490975-22490997 TTAAATGGTGATAGGGCTTTGGG - Intronic
1182731772 22:32501699-32501721 AAAAATAATGAAAGGGATTGAGG + Intergenic
1185164389 22:49251813-49251835 CAAACTGGAGATAGAGACTGGGG + Intergenic
1203325410 22_KI270738v1_random:9364-9386 GAAAATGTAGTTAGGGATTGGGG - Intergenic
949185780 3:1189918-1189940 CAAAATGATGATATGAATTTAGG + Intronic
949733457 3:7142711-7142733 CAAAATGTTGACAGGGATCAAGG + Intronic
950419584 3:12890840-12890862 CAAAGTGGTCAATGGGATTGTGG + Intergenic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
952303494 3:32125161-32125183 CAATGTGGTGGGAGGGATTGGGG - Intronic
953473205 3:43184174-43184196 CAAACAGGCCATAGGGATTGGGG + Intergenic
956908836 3:73795797-73795819 CAAAATGGAGTTAGGAACTGAGG + Intergenic
958163232 3:89845540-89845562 AAAAATGGTGAAAGGGAGGGAGG + Intergenic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958825050 3:99020300-99020322 CAAATTTGTCCTAGGGATTGAGG + Intergenic
959225365 3:103575304-103575326 AAAAATGGTGATAGTCATTTAGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959512339 3:107227914-107227936 CAAAATGGTGAAGAGGCTTGAGG + Intergenic
959927955 3:111945917-111945939 CAAAGTGGTGATGGGGACTGGGG - Intronic
960024033 3:112988214-112988236 CAACATGGTGATAGGGAAGTGGG - Intergenic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963467691 3:145703264-145703286 GAAAATGGAGGTAGAGATTGGGG + Intergenic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
963697321 3:148577548-148577570 CCAACTGCTGATAGGAATTGGGG - Intergenic
964270780 3:154954032-154954054 TAAAATGGGGATAGGGATTGGGG - Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
966364906 3:179174515-179174537 CAAAGTTGTGAGAGGGAATGGGG - Intronic
966720800 3:183061146-183061168 CAACATGGTGGTAGGGTATGGGG + Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
970968466 4:21954107-21954129 TAAAATGATGATAGTGATTAAGG - Intergenic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971972478 4:33637752-33637774 CAAAATGCTGATAGAGAATAAGG - Intergenic
972835738 4:42867963-42867985 GAAAATGGGAATAGGGAATGAGG + Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
974575578 4:63715748-63715770 CAAGAGAGTGATAGGGAGTGGGG + Intergenic
975819658 4:78257024-78257046 CAAAATGGTGGTAGTGATGGTGG - Intronic
976211626 4:82677137-82677159 CAAACAGGTGATAGAGACTGAGG - Intronic
976909456 4:90283224-90283246 CAAAATGGTGCATGGGATCGGGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977724013 4:100273216-100273238 CAACTTGAGGATAGGGATTGTGG + Intergenic
978355176 4:107864455-107864477 CAAAAGGATGAAAAGGATTGGGG + Intronic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981659008 4:147144636-147144658 CAATATGGTGGCAGGAATTGAGG + Intergenic
981741251 4:148004384-148004406 TTAAATAGTGATAGTGATTGTGG + Intronic
981883057 4:149639131-149639153 AAAAATGAAGACAGGGATTGGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
988001145 5:25350468-25350490 CAAAAAGGTAATAGAGAGTGGGG - Intergenic
988876866 5:35456644-35456666 CAAAATGCTGATGGTGATAGGGG + Intergenic
988882263 5:35516504-35516526 CAAACTGGGGGTAGGGAATGGGG + Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991139744 5:63226531-63226553 TAACATGCTGATTGGGATTGGGG - Intergenic
991989464 5:72323231-72323253 CAAAATATTGATAATGATTGAGG + Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
995461657 5:112410159-112410181 GAAAAAGGTGAGAGGGAATGTGG + Intronic
995601016 5:113796293-113796315 CAAAATGGTAATGGAGATAGTGG - Intergenic
997499360 5:134359751-134359773 GAAAATGGGGATAGGGAATAGGG - Intronic
998477904 5:142436816-142436838 GAAAATGGAGAAAGGGATGGAGG - Intergenic
999575016 5:152966442-152966464 CACACTGGTAATAGAGATTGTGG - Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1001365066 5:171129072-171129094 GAGAATGGTGATGGGGGTTGGGG - Intronic
1003731263 6:8827585-8827607 CAAGATGATGCTAGGGATGGTGG + Intergenic
1005199540 6:23327573-23327595 CAAGATGGTGATAGTGATGGTGG - Intergenic
1006996746 6:38268143-38268165 CAAAATGGTGTTGGGGCTAGGGG - Intronic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008338552 6:50336439-50336461 CAAAATAATGACAGAGATTGAGG - Intergenic
1008445664 6:51587080-51587102 CAAAATGTTGATAGTGAATATGG - Intergenic
1009861066 6:69332925-69332947 CAACATGGTGATTGGCATTTTGG + Exonic
1010052360 6:71521913-71521935 CAAAAAGGAGATAGAGATTGGGG - Intergenic
1010273112 6:73937402-73937424 CAAAATGGTGGCAGGGATTCAGG - Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1011489765 6:87878985-87879007 CAAAATTTTGATAGTGATGGTGG - Intergenic
1012003437 6:93683452-93683474 CAAAATGGTGATTGAGGTGGGGG - Intergenic
1012015689 6:93847182-93847204 CAAAATGCTGATAGAAATTAAGG + Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1013354997 6:109338936-109338958 TAAAATGGTGATAGAAACTGGGG - Intergenic
1014457258 6:121650258-121650280 CAAAATAGTAATAAGGATTTGGG + Intergenic
1014768493 6:125434498-125434520 AAAAGTGGTGAGAGGAATTGGGG + Intergenic
1016096001 6:140038103-140038125 CAACATGGGGATAGAGCTTGTGG + Intergenic
1016537821 6:145127815-145127837 AAAAAAGGTGTTAAGGATTGTGG + Intergenic
1016786474 6:148016117-148016139 CAAAATGGGTATAAGGAATGAGG - Intergenic
1016806827 6:148219893-148219915 CAAAATGGTGCATGGTATTGAGG + Intergenic
1018223373 6:161604410-161604432 CACCATGGTGATATGGATGGGGG + Intronic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019765896 7:2849957-2849979 GACAATGGTGATAGTGATGGTGG - Intergenic
1020388889 7:7637198-7637220 AAAAATGGAGATATGGATTATGG + Intronic
1020703010 7:11506887-11506909 CAAAATTGTGAAAAGTATTGGGG - Intronic
1020724179 7:11788432-11788454 CAAAATGGGCATGAGGATTGGGG - Intronic
1020914439 7:14174763-14174785 GATAATGGTGATAGTGATGGTGG - Intronic
1021205678 7:17777025-17777047 AAAACTGGGGATAGGGAATGAGG - Intergenic
1022254607 7:28643659-28643681 CAAAGTAGTGATGGTGATTGTGG - Intronic
1022989352 7:35693324-35693346 AAAAATGTTGAAAGGGGTTGTGG + Intronic
1023856902 7:44189577-44189599 CACCATGGTGATGGGGATGGAGG - Intronic
1024806951 7:53152666-53152688 GAAAATGTAGTTAGGGATTGGGG - Intergenic
1025151609 7:56558425-56558447 CAATATCCTTATAGGGATTGGGG - Intergenic
1025319749 7:58083515-58083537 GAAAATGTAGTTAGGGATTGAGG + Intergenic
1025478058 7:60952552-60952574 GAAAATGTAGTTAGGGATTGGGG + Intergenic
1025560816 7:62373317-62373339 GAAAATGTAGTTAGGGATTGGGG + Intergenic
1025840825 7:65144413-65144435 CAAAATGGTGAAATGAAATGAGG + Intergenic
1025877889 7:65505673-65505695 CAAAATGGTGAAATGAAATGAGG - Intergenic
1025882224 7:65551573-65551595 CAAAATGGTGAAATGAAATGAGG - Intergenic
1025891218 7:65651029-65651051 CAAAATGGTGAAATGAAATGAGG + Intergenic
1028298972 7:89172405-89172427 AAAAATGTTGAGAGTGATTGTGG + Intronic
1028696424 7:93718030-93718052 TAAAATGGTGATAGCAATTTTGG + Intronic
1028737552 7:94234795-94234817 TGACATGGTGATAGAGATTGAGG - Intergenic
1028741878 7:94284823-94284845 AAAAATGGTGGTAGTGGTTGTGG - Intergenic
1029340882 7:99943768-99943790 AAAGTTGGTGATGGGGATTGGGG + Intergenic
1030437700 7:109545772-109545794 AAAACTGGTGAAAGAGATTGTGG + Intergenic
1030667351 7:112294069-112294091 CAAAGTGGTGACAGGGATGAAGG - Intronic
1030818239 7:114063300-114063322 AAAAAGGGTGAGAGGGAGTGAGG - Intronic
1031260876 7:119518425-119518447 AAAAATGGTAAAAGGGGTTGAGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1032849894 7:135785102-135785124 CAAAATAGTGCTATGGAGTGGGG + Intergenic
1032894315 7:136233933-136233955 CAAAGTAGTGGTAGGGGTTGGGG + Intergenic
1035937042 8:3852529-3852551 GTAGATGGTGTTAGGGATTGAGG + Intronic
1036714660 8:11109621-11109643 AAAAATGGTGGTAGGGTTGGGGG - Intronic
1038593729 8:28866362-28866384 CAAAATGGTGACATTTATTGCGG - Intronic
1039442798 8:37607044-37607066 GAAGAGGGTGATAGGGAGTGGGG + Intergenic
1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG + Intergenic
1040616812 8:49045949-49045971 CAATATGGAGAAAGGGATGGAGG + Intergenic
1041347042 8:56910185-56910207 GAAAATGGTGAGAGGGGTTGGGG + Intergenic
1042561624 8:70076233-70076255 CTATATTGTGATAGGGATTGAGG - Intergenic
1042602741 8:70514010-70514032 CAAAATGATGAAAGGGAAAGAGG - Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044728774 8:95213879-95213901 GAAAATGGGGACAGAGATTGGGG + Intergenic
1045567379 8:103334666-103334688 CAAAATTATTAGAGGGATTGAGG - Intergenic
1045833762 8:106495734-106495756 CAAACTGCTGAAGGGGATTGTGG - Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1047231676 8:123002880-123002902 CAAAGTGGTGATATGAACTGAGG - Intergenic
1050798054 9:9570375-9570397 CACAGTGGTGACAGGGCTTGGGG - Intronic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1052234618 9:26195029-26195051 AAAAATGGTTGTAGGGGTTGTGG - Intergenic
1058010506 9:99971724-99971746 CAAAATTGAGATGGGGGTTGGGG + Intergenic
1058532624 9:105921777-105921799 CAAAATAGTGAAAGGGAATTAGG + Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1203654845 Un_KI270752v1:13832-13854 CAAAATGATTGTAGGGATAGGGG - Intergenic
1186085588 X:5987087-5987109 TAAAATGGACATAGGGACTGTGG + Intronic
1186193340 X:7087269-7087291 GAAAATGGAGACAGAGATTGGGG + Intronic
1189332213 X:40151265-40151287 CCAAGTGCTGACAGGGATTGGGG + Intronic
1189972774 X:46434812-46434834 CAAAATGGTGAATGGGAATATGG - Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1193202191 X:78704626-78704648 CAAAATGGTGATGGTGTTGGTGG + Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194355481 X:92878735-92878757 CAAAATGGTGATATGTTTTGTGG + Intergenic
1195282189 X:103347464-103347486 CATAATGGTGATAATGAATGAGG + Intergenic
1197623697 X:128780369-128780391 CAAAATGGTGAAAGGGAGACAGG + Intergenic
1198586403 X:138127332-138127354 GAAAATGCTGGTGGGGATTGAGG - Intergenic
1198713434 X:139530500-139530522 CAGAATGGAGATAGGCATAGTGG - Intergenic
1200663835 Y:5995729-5995751 CAAAATGGTGATATGTTTTGTGG + Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201761581 Y:17545256-17545278 CAAAATGTTGATGGAGAATGAGG + Intergenic
1201839971 Y:18360734-18360756 CAAAATGTTGATGGAGAATGAGG - Intergenic