ID: 1135745705

View in Genome Browser
Species Human (GRCh38)
Location 16:25014952-25014974
Sequence CGGTGTGGCGGAGGAGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 985
Summary {0: 1, 1: 0, 2: 4, 3: 68, 4: 912}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135745685_1135745705 24 Left 1135745685 16:25014905-25014927 CCCGAGGGCGATGCTCCCGGGGC 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1135745705 16:25014952-25014974 CGGTGTGGCGGAGGAGGCGGCGG 0: 1
1: 0
2: 4
3: 68
4: 912
1135745686_1135745705 23 Left 1135745686 16:25014906-25014928 CCGAGGGCGATGCTCCCGGGGCA 0: 1
1: 0
2: 1
3: 3
4: 81
Right 1135745705 16:25014952-25014974 CGGTGTGGCGGAGGAGGCGGCGG 0: 1
1: 0
2: 4
3: 68
4: 912
1135745692_1135745705 8 Left 1135745692 16:25014921-25014943 CCGGGGCAGGGACAATGGGCAGG 0: 1
1: 1
2: 3
3: 50
4: 437
Right 1135745705 16:25014952-25014974 CGGTGTGGCGGAGGAGGCGGCGG 0: 1
1: 0
2: 4
3: 68
4: 912
1135745691_1135745705 9 Left 1135745691 16:25014920-25014942 CCCGGGGCAGGGACAATGGGCAG 0: 1
1: 0
2: 6
3: 61
4: 455
Right 1135745705 16:25014952-25014974 CGGTGTGGCGGAGGAGGCGGCGG 0: 1
1: 0
2: 4
3: 68
4: 912
1135745683_1135745705 25 Left 1135745683 16:25014904-25014926 CCCCGAGGGCGATGCTCCCGGGG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1135745705 16:25014952-25014974 CGGTGTGGCGGAGGAGGCGGCGG 0: 1
1: 0
2: 4
3: 68
4: 912

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135745705 Original CRISPR CGGTGTGGCGGAGGAGGCGG CGG Intronic
900100657 1:960772-960794 GGCTGCGGCGGTGGAGGCGGCGG - Exonic
900172052 1:1273969-1273991 CGGGGTGGGGGATGGGGCGGGGG + Intergenic
900210007 1:1450770-1450792 CGGTGTGGGCGGGGAGGCCGGGG + Intronic
900215097 1:1477362-1477384 CGGTGTGGGCGAGGAGGCCGGGG + Intronic
900215812 1:1480956-1480978 GGCTGGGGCGGAGGTGGCGGGGG + Intronic
900220065 1:1503673-1503695 CGGTGTGGGTGGGGAGGCCGGGG + Intergenic
900222368 1:1516100-1516122 CGGTGTGGGTGGGGAGGCCGGGG + Intronic
900222949 1:1519010-1519032 GGCTGGGGCGGAGGTGGCGGGGG + Intronic
900339645 1:2181953-2181975 CGGTGCTGGGGAGGAGCCGGAGG - Intronic
900366778 1:2314834-2314856 TGGGGTAGCGGAAGAGGCGGCGG - Intergenic
900471148 1:2855580-2855602 CTGAGTGGAGGGGGAGGCGGAGG - Intergenic
900603422 1:3513013-3513035 TGGTGTGGCAGAGGGGGCAGCGG + Intronic
900643568 1:3698601-3698623 GGGTCTGGGGGAGGAGGCGGCGG + Intronic
900947082 1:5837137-5837159 CGGTGGGCAGGAGGAGGGGGAGG - Intergenic
901005776 1:6170924-6170946 TGCGGTGGCGGGGGAGGCGGAGG - Intronic
901414644 1:9108267-9108289 CGGTGAGCTGGAGGAGGAGGAGG - Intronic
901497418 1:9629923-9629945 GGGAGTGGGGGCGGAGGCGGAGG + Intergenic
901628973 1:10639028-10639050 CGAGGCGGCGGCGGAGGCGGCGG - Exonic
901633196 1:10657790-10657812 CGGTGGGGGGGTGGGGGCGGGGG + Intronic
901908376 1:12433964-12433986 GTGTGTGGAGGAGGAGGAGGAGG + Intronic
901938491 1:12644445-12644467 GAGTGAGGTGGAGGAGGCGGAGG + Intergenic
902234014 1:15046398-15046420 CTGAGTGGCTGAGGAGGAGGAGG + Intronic
902323650 1:15684505-15684527 CGGCGGGGCGGCGGCGGCGGTGG + Exonic
902853886 1:19185193-19185215 GGAGGTGGGGGAGGAGGCGGAGG + Exonic
903165151 1:21515041-21515063 TGGAGTGGAGGAGGAGGGGGTGG - Intronic
903177004 1:21587317-21587339 GGGGGTGGCGGTGGAGGTGGGGG + Intergenic
903179814 1:21599520-21599542 CAGCGTGGTGGAGGAGACGGAGG - Exonic
903212883 1:21828558-21828580 CGGTGTGGGGAGGGAGGCGCAGG + Intronic
903324743 1:22563452-22563474 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
903334186 1:22614016-22614038 CTGTGAGGGGGAGGAGGAGGAGG + Intergenic
903357431 1:22756568-22756590 AGGTGTGGGGGAAGTGGCGGGGG + Intronic
903475997 1:23619576-23619598 TGCTGTGGCGGCGGCGGCGGCGG - Intronic
904037480 1:27566675-27566697 GGGGGTGGAGGAGGAGGAGGAGG + Intronic
904309383 1:29617932-29617954 CAGTTTGGCGGGGGAGGGGGTGG + Intergenic
904457008 1:30653852-30653874 GGGTGTGGGGGAGGAGGTGAAGG + Intergenic
904686784 1:32266591-32266613 GGTGGTGGCGGAGGAGGAGGAGG - Intronic
905403616 1:37719318-37719340 AGGTGGGGTGGTGGAGGCGGTGG + Intronic
905414380 1:37794387-37794409 CGGGGCGGCGGCGGCGGCGGGGG - Exonic
905463079 1:38134022-38134044 CGGGGCGGCGGAGCAGGCGGAGG + Intergenic
905553086 1:38859541-38859563 CGGCGTGGAGGAGGAGGAAGAGG - Exonic
906238683 1:44228235-44228257 CGGTGGGGTGGAGGGGGCTGAGG - Intronic
906294013 1:44638014-44638036 CAGTGGAGCGGAGGAGGCTGAGG + Intronic
906992201 1:50751416-50751438 CTGGGAGGCGGAGGAGGCAGAGG - Intronic
907159775 1:52361545-52361567 GGATGTGGAGGAGGAGGAGGAGG - Exonic
907372622 1:54013047-54013069 GTGTGTGGGGGAGGCGGCGGGGG + Intronic
908110815 1:60895572-60895594 TGGTGTGGGGGCGGAGGGGGGGG - Intronic
908195362 1:61742381-61742403 CGGGGTGGCGCAGGGGGCGGGGG - Intergenic
908401220 1:63774386-63774408 CGCTGAGGCGGCGGCGGCGGCGG - Exonic
908696102 1:66843219-66843241 GGGTGGGGGGGAGGAGGAGGAGG + Intronic
908764174 1:67539490-67539512 TGGTGAGACGGAGGAGGTGGAGG + Intergenic
909001428 1:70221706-70221728 GGTGGTGGCGGCGGAGGCGGCGG + Exonic
910401694 1:86843716-86843738 CGGTGTGGCAGGGGTGGTGGGGG + Intergenic
910646936 1:89524706-89524728 AGCAGTGGCGGAGGAGGAGGAGG - Intergenic
911527544 1:99004758-99004780 GGGCGCGGCGGCGGAGGCGGCGG + Exonic
911871923 1:103108955-103108977 CGGTGTGGCCGATCAGGCGCTGG - Intergenic
912624214 1:111194387-111194409 CTGTGTGGAGGAAGAGGCAGTGG + Intronic
912771769 1:112470780-112470802 GGGTGTGGGGGAGGAAGGGGAGG + Intronic
913300847 1:117367310-117367332 CGGAGAGGAGGAGGAGGAGGAGG + Intergenic
913963194 1:143354562-143354584 CCTTGAGGCGGAAGAGGCGGCGG - Intergenic
914057550 1:144180148-144180170 CCTTGAGGCGGAAGAGGCGGCGG - Intergenic
914121596 1:144786218-144786240 CCTTGAGGCGGAAGAGGCGGCGG + Intergenic
914255345 1:145957814-145957836 GGGTGTGGCGGTGGCGGCCGCGG + Exonic
914673444 1:149889432-149889454 CGGGGTGGAGGAGGCGGTGGTGG - Intronic
914673445 1:149889435-149889457 GGGCGGGGTGGAGGAGGCGGTGG - Intronic
914725190 1:150321484-150321506 CGGCGTGGCGGCGGCGGTGGCGG + Exonic
915106177 1:153536314-153536336 CGGTCTGGCAGAGGAAGCAGGGG - Intergenic
915393160 1:155562451-155562473 CAGAGTGGCGGCGGTGGCGGCGG + Exonic
916240227 1:162632106-162632128 AGGTGTGGGGTAGGCGGCGGGGG + Intronic
916609182 1:166373660-166373682 TGGTGTGGTGGAGGAGGGGGAGG - Intergenic
919908835 1:202097442-202097464 GGGGGTGGCGGCGGTGGCGGCGG + Intergenic
920045041 1:203127633-203127655 GGGGGTGGGGGAGGAGACGGAGG + Exonic
920052435 1:203171999-203172021 AGGTCTGACGGAGGTGGCGGGGG + Exonic
920068908 1:203288518-203288540 CGGGATGGTGGAGGAGGTGGTGG + Intergenic
920684956 1:208102261-208102283 TGGGGTGGAGGCGGAGGCGGAGG - Intronic
920705010 1:208244299-208244321 CGCGGTGGCGGCGGCGGCGGCGG + Exonic
920868107 1:209769916-209769938 CTGTGTAGGGGAGGGGGCGGAGG - Intronic
921158902 1:212459013-212459035 GGGTGTGGCTGAGGGGGAGGAGG + Intergenic
921318782 1:213917353-213917375 CAGTGAGGAGGAGGAGGAGGAGG - Intergenic
922427722 1:225514855-225514877 GGGAGTGGTGGAGGAGGTGGAGG + Exonic
922554792 1:226524395-226524417 CTGTGTGACAGAGGAGGGGGTGG - Intergenic
922764653 1:228150652-228150674 CGGCGTGGCTGAGGAGGGGGAGG + Intronic
923008817 1:230072354-230072376 TGGTGGGGCGGGGGTGGCGGGGG + Intronic
923146503 1:231202261-231202283 GGTGGTGGCGGAGGAGGAGGAGG + Intronic
923482400 1:234397363-234397385 GGGTGAGGGGGAGGAGGCGGAGG + Intronic
923745188 1:236693584-236693606 TGGTGTGGGAGAGGAGGAGGGGG - Intronic
924289726 1:242524716-242524738 CGGGGCGGCGGCGGCGGCGGGGG + Intergenic
924446750 1:244140002-244140024 CCGTGTGGCCGAGGTGGCAGCGG + Intergenic
924708780 1:246518190-246518212 CGGTGAGGCAGAGGAGGCAGCGG - Intergenic
1063081681 10:2773259-2773281 CGATGTGCGGGAGAAGGCGGTGG + Intergenic
1063205874 10:3830144-3830166 GGGTGTGGTGGGGGAGGCAGCGG + Intergenic
1063647982 10:7904913-7904935 CAGTGTGGAGGAGGAGCGGGTGG - Intronic
1063664795 10:8054854-8054876 CAGAGAGGAGGAGGAGGCGGCGG - Exonic
1064765955 10:18671643-18671665 GGGTGAGGGGGAGGAGGAGGAGG - Intronic
1065025196 10:21534407-21534429 CGCTGAGGAGGAGGAGGAGGCGG + Exonic
1065025200 10:21534419-21534441 GGAGGAGGCGGAGGAGGCGGTGG + Exonic
1065025394 10:21535116-21535138 CGGGGTGGGGGCGGGGGCGGGGG + Intronic
1065323653 10:24531880-24531902 GGAGGTGGCGGAGGAGGAGGGGG - Exonic
1066501474 10:35999345-35999367 CGGGGGGGAGGAGGAGGAGGAGG - Intergenic
1067346920 10:45443872-45443894 CGGGGCGGGGGAGGAGGCAGCGG - Intronic
1068948336 10:62752166-62752188 AGGTGAGGAGGAGGAGGAGGAGG + Intergenic
1069307723 10:66992398-66992420 AGGAGTGGAGGAGGAGGAGGAGG - Intronic
1069750818 10:70744009-70744031 CGGGGTGGCGGTGGGGGCAGGGG + Intronic
1069772878 10:70910689-70910711 AGATGTGGCGCAGGAGGCTGAGG + Intergenic
1069818405 10:71212888-71212910 CGGCGAGGAGGAGGCGGCGGCGG + Exonic
1070290672 10:75111566-75111588 CGGAGTGGAGGCGGGGGCGGTGG - Intronic
1070824233 10:79381552-79381574 CGGTGATGGGGAGGAGGCAGGGG - Intergenic
1070877386 10:79826378-79826400 CGGCGGGGCGGCGGCGGCGGCGG + Intergenic
1070877387 10:79826381-79826403 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
1071199873 10:83209401-83209423 GGGGGTGAGGGAGGAGGCGGTGG - Intergenic
1071503940 10:86221901-86221923 GGGTGAGGAGGAGGAGGAGGAGG - Intronic
1071643881 10:87342422-87342444 CGGCGGGGCGGAGGCGGCGGCGG + Intergenic
1071695296 10:87863518-87863540 CGGCGCGGCGGCGGAGGGGGCGG + Exonic
1071841653 10:89477865-89477887 CGGGGTGGGGGTGGGGGCGGGGG - Intronic
1071968048 10:90872564-90872586 CGGAGTGGAGGTGGAGGAGGAGG + Intronic
1072021842 10:91410305-91410327 CGGAGTGGCGGCGGCAGCGGCGG + Exonic
1072221954 10:93334166-93334188 CAGTGTGATGGAGGAGGTGGTGG + Intronic
1072555990 10:96513921-96513943 GAGTGTGGCGGTGGCGGCGGTGG + Intergenic
1072562227 10:96586884-96586906 GGCGGCGGCGGAGGAGGCGGCGG - Exonic
1072926316 10:99620287-99620309 CGGTGTGGCGGGGGGGCCGGCGG - Exonic
1073196262 10:101694604-101694626 CGGGGAGGAGGAGGAGGAGGAGG - Exonic
1074040007 10:109779203-109779225 CGGGGTGGCGGCGGGGGCAGGGG - Intergenic
1074815709 10:117139818-117139840 CGGGGTGGCGGCGGAGGCAGGGG - Intergenic
1074843282 10:117375435-117375457 CGGTGTGGCGGCGGCGGCAGCGG + Exonic
1074998019 10:118774361-118774383 GGGTGTGGAGGTGGGGGCGGTGG + Intergenic
1075077319 10:119359970-119359992 TGGGGAGGCTGAGGAGGCGGAGG + Intronic
1075629321 10:123991696-123991718 GGCGGCGGCGGAGGAGGCGGTGG + Intergenic
1075802113 10:125160267-125160289 AGGTGAGGCGGGGGCGGCGGCGG + Intronic
1076065878 10:127447519-127447541 TGGTGTGGAGGGGGAGGTGGAGG - Exonic
1076374046 10:129971857-129971879 CGCTGAGAGGGAGGAGGCGGCGG - Intergenic
1076387380 10:130067102-130067124 GGGTGTGGAGGAGAAGGCGCTGG - Intergenic
1076866194 10:133167578-133167600 CGGTGAGGCGGCGGTGGCGGTGG + Exonic
1076871490 10:133197155-133197177 AAGCGCGGCGGAGGAGGCGGCGG - Intronic
1076986979 11:245013-245035 CCGTGAGGCGGAGGTTGCGGTGG - Intronic
1077074671 11:694957-694979 CGCTGTGGCGGCGGCGGCCGCGG - Exonic
1077094873 11:795058-795080 CGGGGTGGAGGTGGAGGTGGAGG + Exonic
1077191115 11:1256276-1256298 CGGTCTGGGGGAGCAGGAGGAGG + Intronic
1077300688 11:1845742-1845764 CGGGGTGGTGGAGGAGGCTGAGG + Intergenic
1077360374 11:2138080-2138102 CGGGGGGGAGGAGGAGGAGGAGG - Intronic
1077889792 11:6410864-6410886 CGGGGAGGCCGAGGAGGAGGAGG - Exonic
1078390571 11:10932165-10932187 TGGTGGGGGGGAGGAGGTGGTGG + Intergenic
1078390580 11:10932182-10932204 TGGTGGGGGGGAGGAGGTGGTGG + Intergenic
1078631876 11:13010461-13010483 AGAGGTGGCGGCGGAGGCGGAGG + Intergenic
1078631879 11:13010470-13010492 GGCGGAGGCGGAGGAGGCGGCGG + Intergenic
1079035198 11:17014427-17014449 GGGTGGGGGGGAGGGGGCGGGGG + Intronic
1079191017 11:18276463-18276485 CGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1079985941 11:27201039-27201061 GGGTGTGGAGGTGGAGGTGGAGG - Intergenic
1080107531 11:28526154-28526176 AGGTGTGGCGGGAGAGGCGCAGG - Intergenic
1080458442 11:32434951-32434973 GGGGGTGGCGGCGGAGCCGGTGG + Exonic
1080503118 11:32888539-32888561 AGGTGTGGAGGGAGAGGCGGGGG - Intergenic
1080540099 11:33257313-33257335 CGGTGGCGCTGCGGAGGCGGTGG + Intronic
1081492790 11:43580450-43580472 CGGTTTCGGGGAGGATGCGGAGG + Intronic
1081636695 11:44726780-44726802 GGGGTTGGAGGAGGAGGCGGAGG + Intronic
1082787478 11:57324802-57324824 CGGTCGGGCGAAGGAGGGGGCGG - Intronic
1083448545 11:62727162-62727184 GCGGGAGGCGGAGGAGGCGGCGG - Exonic
1083571369 11:63763737-63763759 CGGGGCGGGGGCGGAGGCGGGGG + Exonic
1083678451 11:64340630-64340652 CGGGGAGGCGGAGGACTCGGAGG + Exonic
1083753725 11:64778151-64778173 TGGGGAGGCGGAGGGGGCGGCGG + Exonic
1083753729 11:64778163-64778185 GGGGGCGGCGGCGGAGGCGGCGG + Exonic
1084003898 11:66313433-66313455 GGGGGTCGCGGAGGGGGCGGAGG - Intergenic
1084028446 11:66467035-66467057 CGCCGGGGCGGAGGGGGCGGGGG + Intronic
1084284291 11:68121481-68121503 CGGTGTGGCGAGGGCGGCGGCGG - Intergenic
1084471764 11:69365758-69365780 TGGGGAGGAGGAGGAGGCGGTGG + Intronic
1084546974 11:69819439-69819461 TGGTCTGGGGGAGGGGGCGGGGG - Intergenic
1084872694 11:72108838-72108860 CAGTGTGGTGGAGGCGGCAGCGG - Exonic
1085071160 11:73547162-73547184 CGGGGGGGAGGAGGAGGAGGAGG + Intronic
1085410639 11:76288469-76288491 CTGTGTGGTCGGGGAGGCGGGGG - Intergenic
1087014625 11:93543241-93543263 CGGCGCGGCGGCGGCGGCGGCGG - Intronic
1088625526 11:111727625-111727647 CGGTGTGTGGGTGGAGGTGGGGG - Exonic
1088932738 11:114368478-114368500 TGGGGTGGCGGGGGGGGCGGGGG - Intergenic
1089056007 11:115585401-115585423 CTGTGTCCAGGAGGAGGCGGAGG + Intergenic
1089346987 11:117796995-117797017 CGGCTGGGCGGCGGAGGCGGCGG - Intronic
1089496080 11:118909356-118909378 CGGGGAGGGGGAGGCGGCGGGGG - Intronic
1089684499 11:120138146-120138168 CTGTGAGGAGGAGGAGGGGGAGG + Exonic
1090238284 11:125165153-125165175 CGGCGAGGCGGCGGCGGCGGCGG - Intronic
1090367892 11:126223089-126223111 AGGTGGGGCGGGGGAGGGGGGGG + Intronic
1090699294 11:129279573-129279595 AGGCGGAGCGGAGGAGGCGGAGG - Intergenic
1090817783 11:130314439-130314461 CGGCGAGGCGGCGGCGGCGGCGG + Exonic
1091122009 11:133064730-133064752 CCGTGTGGCTGCGGAGGCAGAGG - Intronic
1091498303 12:991239-991261 TGCTGTGGCGGCGGCGGCGGCGG + Intronic
1091550288 12:1530983-1531005 CGGGGCGGCGGCGGCGGCGGCGG - Intronic
1091688194 12:2578553-2578575 CAGTGAGGATGAGGAGGCGGTGG + Intronic
1092788187 12:12048862-12048884 GGGTGCGGAGGAGGAAGCGGAGG + Intergenic
1093464918 12:19439661-19439683 CGGTGGGGAGGAGGAGGAGGAGG + Exonic
1093464989 12:19439892-19439914 GGGGGCGGCGGAGGCGGCGGCGG + Exonic
1093662662 12:21774909-21774931 CGTTGTCGCGGAGTAGGGGGCGG + Intronic
1094203478 12:27816580-27816602 GAGTGTGGAGGAGGAGGTGGTGG + Intergenic
1094454009 12:30611969-30611991 CGATGAGGAGGAGGAGGAGGAGG + Intergenic
1095118596 12:38385557-38385579 GGGTGGGGTGGAGGAGGCAGTGG - Intergenic
1095392052 12:41719287-41719309 GTGTGTGGCGGGGGAGGAGGGGG - Intergenic
1096007388 12:48184048-48184070 CGGGGTGGGGGAGGGGGTGGAGG - Exonic
1096529515 12:52234113-52234135 CGGTGGGGCGGGGGAGGGGGGGG + Intronic
1096710506 12:53452225-53452247 GGGGGTGGAGGAGGAGGAGGAGG - Exonic
1097031094 12:56090072-56090094 CCGGGAGGCAGAGGAGGCGGAGG - Intronic
1097057328 12:56257961-56257983 CGGTGTGGGGGTGGGGGTGGGGG + Intronic
1097166417 12:57088852-57088874 GGGTGTGGAGCAGGAGGCGGGGG - Intergenic
1097259982 12:57713673-57713695 GGGTGGGGCGGTGGAGGGGGAGG - Intronic
1097879607 12:64675046-64675068 CGGGGTGGCGGGGGGGGGGGGGG - Intronic
1097938386 12:65278507-65278529 CGGTGCAGAGGAGGAGGAGGAGG + Intergenic
1098498801 12:71166578-71166600 AGGTGTGGCGGGAGAGGCGCGGG - Intronic
1099152315 12:79129770-79129792 CAGGGTTGGGGAGGAGGCGGTGG + Intronic
1100309048 12:93377796-93377818 AGGTGTGGCGGGGGAGGTAGGGG - Intergenic
1100611402 12:96194357-96194379 CGGGGCGGCGGGGGAGGCGCGGG + Intergenic
1100837731 12:98582994-98583016 CGGGGAGGTGGAGGAGGCGGAGG + Intergenic
1101144753 12:101830721-101830743 CGCTGAGGCGGCGGCGGCGGCGG - Exonic
1101662356 12:106776952-106776974 CGGTGGGGGGGAGGAGATGGAGG - Intronic
1101783793 12:107864241-107864263 CGCTGAGGCCGAGGAGGCGCCGG - Intergenic
1101935358 12:109052617-109052639 CGGTCCGGCGGCGGCGGCGGCGG + Exonic
1102322465 12:111949004-111949026 TGGGGTGGCGGGGGTGGCGGGGG + Intronic
1102394411 12:112574722-112574744 AGGTGTGGTGGAGGAGGGAGAGG + Intronic
1102394425 12:112574765-112574787 GGGTGTGGTGGAGGAGGGAGGGG + Intronic
1102854054 12:116277795-116277817 CGGAGTGGCGGCGGCGGCGGCGG + Intergenic
1103080930 12:118023438-118023460 GGGTGAGGAGGAGGAGGGGGAGG + Intronic
1103363937 12:120369117-120369139 CGGAGCGGCGGCGGCGGCGGCGG + Exonic
1103764097 12:123269680-123269702 CTCTGGGGCGGGGGAGGCGGGGG + Intronic
1103807473 12:123584562-123584584 CGGGGCGGCGGCGGCGGCGGCGG + Exonic
1104968000 12:132518059-132518081 CTGTGTGCCGGAGGAGGGGTGGG - Intronic
1105389050 13:19958708-19958730 GGAGGAGGCGGAGGAGGCGGCGG - Exonic
1105389053 13:19958717-19958739 TGGTGAGGAGGAGGAGGCGGAGG - Exonic
1105472072 13:20703738-20703760 CGGGGCGGCGGCGGCGGCGGGGG + Intronic
1106241998 13:27920262-27920284 GGGTGCGGCGGCGGCGGCGGGGG - Exonic
1107508704 13:41060854-41060876 AGGTGCGGCGAAGGAGGCAGAGG - Intronic
1107654126 13:42574400-42574422 TGGTGCGGCGCAGGCGGCGGCGG - Exonic
1107684974 13:42887558-42887580 CGGTGAGGCGGAGGGGACAGAGG + Exonic
1107986954 13:45783940-45783962 CGTGGTGGCGGAGGTGGTGGTGG + Exonic
1108192773 13:47959467-47959489 AGGAGGGGCGGAGGAGGAGGGGG + Intronic
1111103293 13:83613766-83613788 AGGTGTGGAGGGAGAGGCGGGGG - Intergenic
1111445792 13:88345328-88345350 GGGTGCTGCGGAGGAGGGGGCGG + Intergenic
1111676809 13:91398648-91398670 CCGGGCGGCGGAGGCGGCGGCGG + Intergenic
1112328865 13:98462064-98462086 CTCTGTGAGGGAGGAGGCGGGGG - Intronic
1112438373 13:99407854-99407876 TGGGGTGGAGGAGGAGGAGGAGG + Intergenic
1112506936 13:99981149-99981171 AGTTGTGCCGGAGGAGGAGGCGG - Intergenic
1113438496 13:110310963-110310985 CGGTGTGGAGGAAGAGGCCTGGG - Intronic
1113567241 13:111326401-111326423 TGGTGGGGTGGAGGAGACGGTGG + Intronic
1114270522 14:21097990-21098012 GGATGTGGCGGGGGAGGTGGCGG - Intronic
1114318052 14:21525228-21525250 GGGGGTGGTGGAGGAGGAGGGGG + Exonic
1114668937 14:24398832-24398854 CGGCGGGGGGGAGGAGGGGGCGG - Exonic
1115028150 14:28766487-28766509 CGGGGTGGAGGGGGTGGCGGGGG + Intergenic
1115316081 14:32026440-32026462 GGGTGTGTCGGGGGAGGGGGAGG + Intergenic
1115320808 14:32077322-32077344 GAGAGTGGAGGAGGAGGCGGCGG + Exonic
1115490221 14:33951186-33951208 CGGAGGGGCAGAGCAGGCGGGGG - Intronic
1115761312 14:36581062-36581084 CCGTGCGGCGGCGGCGGCGGTGG - Exonic
1116426564 14:44798851-44798873 AGGTGGGGAGGCGGAGGCGGTGG - Intergenic
1116657791 14:47674078-47674100 AGGTGGAGAGGAGGAGGCGGCGG + Intronic
1116916739 14:50532575-50532597 TGGTGCGGCGGCGGCGGCGGCGG - Exonic
1116941311 14:50793737-50793759 AGTTGTGGCGGTGGAGGTGGTGG - Intronic
1117183685 14:53217864-53217886 AGGTGTGGCGGGAGAGGCGGGGG - Intergenic
1117500878 14:56350113-56350135 AGGTGGGGAGGAGGAGGAGGAGG + Intergenic
1117690344 14:58299198-58299220 CCGCGTGGGGGAGGGGGCGGGGG - Intronic
1117899109 14:60515038-60515060 CGGTGTCGGGGAGGAGGCGGCGG + Intronic
1118001536 14:61527776-61527798 GGGTATGGTGGAGGAGGCTGAGG - Intronic
1119438051 14:74611011-74611033 CGGGTTGGCGGAGGTGTCGGGGG - Intronic
1119836489 14:77754597-77754619 CGGAGGGGAGGAGGAGGAGGAGG + Intronic
1120429802 14:84399773-84399795 AGGTGTGGCGGGAGAGGCGCGGG - Intergenic
1120789100 14:88563025-88563047 CGGAACGGAGGAGGAGGCGGTGG + Exonic
1122081697 14:99271319-99271341 AGGTGCGGCGGCGGCGGCGGCGG - Intronic
1122543290 14:102509468-102509490 GCGTGTGCCGGAGGAGGAGGGGG + Intronic
1122558295 14:102592969-102592991 CGAGGCGGCGGCGGAGGCGGCGG - Exonic
1122635398 14:103127345-103127367 CGGCGTGGCGGAGGCGGCCGAGG + Exonic
1122688528 14:103521149-103521171 CGGCGAGGAGGAGGAGGAGGAGG - Intronic
1122802846 14:104240207-104240229 CTGTGTGGGCGAGGAGGCTGGGG + Intergenic
1122918956 14:104871735-104871757 CGGTGAGGAGGGGGAGGCTGTGG + Intronic
1122975251 14:105168327-105168349 CGGGGCGGCGGGGGCGGCGGGGG - Intronic
1124420753 15:29519379-29519401 CGGGGTGGCAGAGGAGGAAGAGG - Intronic
1124696850 15:31870674-31870696 CGGAGCGCGGGAGGAGGCGGGGG - Intronic
1124971128 15:34490502-34490524 CGGGGCGGCGGGGGCGGCGGCGG - Intergenic
1125320699 15:38484480-38484502 GGGTGGGGGGGAGGAGGAGGAGG + Exonic
1125402841 15:39322387-39322409 CAGTGTGGCGGAGGGAGTGGGGG - Intergenic
1125852819 15:42920728-42920750 CGGTGGGGACGAGGCGGCGGCGG - Intronic
1126099680 15:45111747-45111769 TGGTGAGGCGGGGAAGGCGGCGG - Exonic
1126103852 15:45135290-45135312 CGGTGAGGCGGGGAAGGCGGCGG + Exonic
1126172302 15:45704937-45704959 CGTTGGGGCGGAGGTGGGGGCGG - Intergenic
1126615437 15:50574056-50574078 GGGGGTGGGGGAGGGGGCGGGGG + Intronic
1126849867 15:52790364-52790386 CGCTGCGGCGGCGGCGGCGGCGG - Intronic
1126852392 15:52805365-52805387 CGCTTTGCCGGACGAGGCGGCGG + Intergenic
1127674768 15:61228819-61228841 GAGTGGGGCGGGGGAGGCGGCGG - Intronic
1127884778 15:63189580-63189602 CGGGGAGCCAGAGGAGGCGGTGG - Exonic
1128056474 15:64703237-64703259 CGGGGCGGCGGCGGCGGCGGCGG - Exonic
1128067768 15:64775319-64775341 TGGTGCGGGGGAGGGGGCGGCGG + Exonic
1128067833 15:64775518-64775540 GGGTGCGGCGGGGGAGGCAGTGG + Exonic
1128119224 15:65133501-65133523 TGGGGCGGCGGAGGAGGCAGCGG + Exonic
1128161004 15:65422881-65422903 CGGGGAGGCGGCGGCGGCGGCGG - Exonic
1128269134 15:66293551-66293573 CGGAGTGGCGGGCGCGGCGGAGG - Exonic
1128374518 15:67065708-67065730 CGGTGAGGCCGCAGAGGCGGAGG + Intronic
1128741766 15:70088879-70088901 CGGGGTGGGGGTGGGGGCGGGGG - Intronic
1128841477 15:70854252-70854274 CGGGGTGGTGGCGGCGGCGGCGG - Intronic
1129082267 15:73052015-73052037 AGGCGAGGAGGAGGAGGCGGGGG + Intronic
1129254206 15:74324964-74324986 TAGTGTGGAGGAGGAGGAGGTGG - Intronic
1129503238 15:76059895-76059917 CGGAGGGGCGGAGGGAGCGGCGG + Exonic
1130564421 15:84981686-84981708 CGGGGAGGCGGCGGCGGCGGCGG + Intronic
1130891656 15:88138560-88138582 CAGTGTGGCTGAAGAGGAGGAGG - Intronic
1131475383 15:92734212-92734234 CGGCGGGGCGGAGGCGGAGGCGG - Intronic
1131701550 15:94942642-94942664 CGGGGGGGGGGAGGAGGAGGAGG - Intergenic
1131912548 15:97224237-97224259 AGGTGTGGCGGAAGAGGCGCGGG + Intergenic
1132040574 15:98521920-98521942 GGGTGAGGAGGAGGAGGAGGAGG - Intergenic
1132653158 16:1030680-1030702 CGGGGGGGCGGAGGAGGCAGTGG - Intergenic
1132727536 16:1345462-1345484 TGGGGAGGCGGAGGAGGCTGGGG - Intronic
1132727556 16:1345507-1345529 TGGGGTTGCGGAGGAGGCCGGGG - Intronic
1132727607 16:1345642-1345664 TGGGGTTGCGGAGGAGGCCGGGG - Intronic
1132747675 16:1443732-1443754 CGCCGTGGAGGCGGAGGCGGCGG + Intronic
1132931795 16:2462441-2462463 TGCTGTGGAGGTGGAGGCGGAGG + Exonic
1133582591 16:7160756-7160778 GGGGGAGGCGGAGGAGGAGGAGG - Intronic
1133784353 16:8963359-8963381 CGGGGCGGCGGCGGCGGCGGCGG + Exonic
1133890329 16:9873188-9873210 GGGTGTGAGGGAGGAGGCTGAGG + Intronic
1134024634 16:10944608-10944630 GGATGCGGCGGCGGAGGCGGTGG - Exonic
1134057299 16:11178573-11178595 CGGTGAGGCTGCGGAGGCTGTGG - Exonic
1134446914 16:14337951-14337973 AGGGGTGGCGGGGGCGGCGGTGG - Intergenic
1134849766 16:17470543-17470565 CGAGGAGGAGGAGGAGGCGGCGG - Exonic
1135023800 16:18983993-18984015 CGGGGAGGCGGCGGCGGCGGCGG + Exonic
1135607348 16:23836086-23836108 CGGGGAGGCGCGGGAGGCGGCGG - Exonic
1135745705 16:25014952-25014974 CGGTGTGGCGGAGGAGGCGGCGG + Intronic
1136076275 16:27819549-27819571 CAGCTTGGCGGAGGAGACGGTGG + Intronic
1136365454 16:29807176-29807198 GGGGGTGGCGGAGGGGGCGCCGG - Exonic
1136403636 16:30031146-30031168 CGGTGGGGAGGGGGAGGGGGAGG + Exonic
1136458476 16:30395548-30395570 CGGGGTGGCGGAGCCGGAGGCGG + Exonic
1136537826 16:30910672-30910694 CTGTGGGGCGGAGCAGGGGGCGG - Intergenic
1136547886 16:30965712-30965734 AGGTAGGGAGGAGGAGGCGGCGG - Exonic
1136547922 16:30965820-30965842 GGGGGTGGTGGAGGAGGTGGGGG - Exonic
1136602160 16:31299770-31299792 GGGGGAGGCGGAGGAGGAGGAGG - Intronic
1136712795 16:32253765-32253787 GGGTGGGGCTGAGGAGGAGGCGG - Intronic
1136755121 16:32675664-32675686 GGGTGGGGCTGAGGAGGAGGCGG + Intronic
1136812992 16:33194705-33194727 GGGTGGGGCTGAGGAGGAGGCGG - Intronic
1136819468 16:33304785-33304807 GGGTGGGGCTGAGGAGGAGGCGG - Intronic
1136826031 16:33361320-33361342 GGGTGGGGCTGAGGAGGAGGCGG - Intronic
1136831097 16:33460091-33460113 GGGTGGGGCTGAGGAGGAGGCGG - Intronic
1137261244 16:46831428-46831450 CGGTCTGGCGGAGGGGGGGGAGG - Intergenic
1137617788 16:49857301-49857323 CGTGGTGGCGGCGGCGGCGGCGG + Intronic
1138421608 16:56902774-56902796 AAGTGTGGAGGAGGAGGAGGAGG - Intronic
1138561338 16:57802458-57802480 CGGGCTGGCCGAGGAGGAGGCGG - Exonic
1138619217 16:58198100-58198122 AGGAGAGGAGGAGGAGGCGGAGG + Intergenic
1138635040 16:58331480-58331502 TGGTGAGGCGGTGGAGGAGGGGG + Intronic
1139136082 16:64206226-64206248 CGGAGTGGTGGAGGGGGTGGGGG + Intergenic
1139806168 16:69566530-69566552 CGGGGTGACGGTGGAGGGGGCGG + Intronic
1139946265 16:70644692-70644714 GGGTGAGGAGGAGGAGGAGGGGG + Intronic
1140209182 16:72957814-72957836 CGGGGCGGCGGCGGCGGCGGTGG - Exonic
1140927764 16:79599916-79599938 CGGAGCGGCGGCGGCGGCGGCGG - Exonic
1141209697 16:81965708-81965730 CGGAGTGGGGAAGAAGGCGGTGG + Intergenic
1141418854 16:83898994-83899016 CGGTGGGGGCGAGGCGGCGGGGG - Intergenic
1141468435 16:84222333-84222355 CGGTGTTTTGGAGGTGGCGGAGG + Exonic
1141650544 16:85390670-85390692 CGGTGGGGGGGACAAGGCGGGGG - Intergenic
1141652403 16:85400091-85400113 CGGTGTGGCGGCGAAGACGCAGG - Intergenic
1141721132 16:85755992-85756014 CGGTGTGGGGCATGAGGAGGGGG - Intergenic
1141837678 16:86553419-86553441 CGGTGTGGAGGGAGAGGCGCGGG + Intronic
1142236300 16:88924140-88924162 CGGTGGGGCGGGGCAGGTGGTGG + Intronic
1142240181 16:88941383-88941405 CGGCGGGGGGCAGGAGGCGGAGG - Intronic
1142248972 16:88982556-88982578 GGCTGTGGGGGAGGAGGCTGTGG - Intergenic
1142248978 16:88982571-88982593 GGCTGTGGGGGAGGAGGCTGTGG - Intergenic
1202991569 16_KI270728v1_random:17675-17697 GGGTGGGGCTGAGGAGGAGGCGG - Intergenic
1203057263 16_KI270728v1_random:936003-936025 GGGTGGGGCTGAGGAGGAGGCGG + Intergenic
1142638224 17:1270701-1270723 GGGCGAGGCGGAGGAGCCGGCGG + Exonic
1142764330 17:2057108-2057130 CGGGGCGGCGGCGGCGGCGGCGG + Exonic
1142871618 17:2824818-2824840 CAGAGAGGAGGAGGAGGCGGCGG + Intronic
1143099872 17:4499083-4499105 CGGCGCGGAGGAGGAGGAGGCGG + Exonic
1143340731 17:6208773-6208795 TGGTCTGGTGGAGGAGGAGGAGG + Intergenic
1143447712 17:7018915-7018937 GGGTGTGTCGGAAGAGGGGGTGG - Intergenic
1143539757 17:7561990-7562012 AGGAGTGGCGGCGGCGGCGGTGG + Exonic
1143590886 17:7885329-7885351 CGGGGTGGCGGCGGCGGCGGCGG - Intronic
1143625818 17:8109689-8109711 CGGTGAGGCTGCGGGGGCGGGGG + Intronic
1143627904 17:8121635-8121657 CTGTGAGGCGGCGGTGGCGGCGG + Exonic
1143680910 17:8475362-8475384 TGATGTGGCTGAGGAGTCGGGGG + Exonic
1143750497 17:9023399-9023421 GGGTGCGGCGGCGGAGCCGGCGG + Intronic
1145261208 17:21355842-21355864 GGGTGTGGGGGAGGTGGCAGTGG - Intergenic
1145786506 17:27597314-27597336 GGGTGTGGAGGAGGTGGTGGAGG - Exonic
1145936356 17:28717150-28717172 GGGTGTGGGCGAGGAGGAGGCGG - Intronic
1145999300 17:29121810-29121832 GGGTGTGGGGGAGGAGGCTCAGG - Intronic
1146015081 17:29226659-29226681 TGGGGTGGGGGTGGAGGCGGGGG + Intergenic
1146095912 17:29930111-29930133 CGGGGAGGAGGAGGAGGCCGCGG + Exonic
1146276169 17:31517186-31517208 CGGTGCGGGGGGGGGGGCGGTGG + Intronic
1146356936 17:32142485-32142507 GGCTGTGGCGGCGGCGGCGGCGG - Exonic
1146630150 17:34463807-34463829 TGCTGTGACGGAGGTGGCGGGGG - Intergenic
1146922476 17:36722760-36722782 CGCTGTGCGGGAGGAGGCGGAGG + Intergenic
1147123940 17:38352662-38352684 CCGGGTCGCGGAGGAGGAGGGGG + Exonic
1147181365 17:38687981-38688003 CAGAGTGGCGGAGGAGAGGGAGG - Intergenic
1147185652 17:38711868-38711890 GGGGGAGGCGGAGGAGGCGCTGG + Exonic
1147285913 17:39402291-39402313 GGGGGAGGCGGGGGAGGCGGCGG - Intronic
1147285916 17:39402300-39402322 CACTGGGGCGGGGGAGGCGGGGG - Intronic
1147486755 17:40822521-40822543 CGCAGTGGAGGAGGAGGAGGAGG - Exonic
1147658591 17:42105083-42105105 GAGTGTGGCGGAGGAGGGGCTGG - Exonic
1147662753 17:42125739-42125761 CATTCAGGCGGAGGAGGCGGGGG + Exonic
1147792497 17:43022188-43022210 CGGCGAGGCGGCGGCGGCGGCGG + Exonic
1147865062 17:43546389-43546411 CGGTGTGGCGGGGCGGGGGGTGG - Exonic
1147971148 17:44219608-44219630 TGCTGTGGCGGCGGCGGCGGCGG + Intronic
1147971538 17:44220993-44221015 CGGGGTGGCCCGGGAGGCGGCGG - Intronic
1148081453 17:44969340-44969362 GGGGGCGGCGGAGGAGGCTGGGG - Intergenic
1148084204 17:44984478-44984500 GGTTGTGGCGGCGGAGGTGGTGG + Intergenic
1148084218 17:44984532-44984554 GGTTGTGGCGGCGGAGGTGGTGG + Intergenic
1148084225 17:44984559-44984581 GGTTGTGGCGGCGGAGGTGGTGG + Intergenic
1148084239 17:44984613-44984635 GGTTGTGGCGGCGGAGGTGGTGG + Intergenic
1148084246 17:44984640-44984662 GGTTGTGGCGGCGGAGGTGGTGG + Intergenic
1148084253 17:44984667-44984689 GGTTGTGGCGGCGGAGGTGGTGG + Intergenic
1148084288 17:44984802-44984824 GGTTGTGGCGGCGGAGGTGGTGG + Intergenic
1148084302 17:44984856-44984878 GGTTGTGGCGGCGGAGGTGGTGG + Intergenic
1148084309 17:44984883-44984905 GGTTGTGGCGGCGGAGGTGGTGG + Intergenic
1148084316 17:44984910-44984932 GGTTGTGGCGGCGGAGGTGGTGG + Intergenic
1148084323 17:44984937-44984959 GGTTGTGGCGGCGGAGGTGGTGG + Intergenic
1148084330 17:44984964-44984986 GGTTGTGGCGGCGGAGGTGGTGG + Intergenic
1148437171 17:47693979-47694001 GGAGGAGGCGGAGGAGGCGGCGG + Intergenic
1148471430 17:47896241-47896263 CTCGGTGGCGGCGGAGGCGGCGG + Exonic
1148555841 17:48578078-48578100 GGGGGTGGTGGCGGAGGCGGCGG + Exonic
1148555844 17:48578081-48578103 GGTGGTGGCGGAGGCGGCGGGGG + Exonic
1148664097 17:49361918-49361940 CGGGGCGGCGGAGGCGGAGGCGG - Intronic
1149431698 17:56599331-56599353 GGGTGTGGGGGAGGAAGTGGGGG - Intergenic
1149512758 17:57256622-57256644 CGGGGGGGAGGAGGAGGGGGAGG + Exonic
1149678511 17:58487780-58487802 CGCGGTGGCGGCGGAGGCCGAGG + Exonic
1149772309 17:59331682-59331704 CGGAGTGGCGGCCGCGGCGGTGG + Exonic
1149893691 17:60412411-60412433 CGGTGGGGCGGGGGAGCAGGTGG + Intronic
1149905838 17:60525946-60525968 GGAGGAGGCGGAGGAGGCGGAGG - Exonic
1149991323 17:61385131-61385153 GAGCGTGGCTGAGGAGGCGGGGG - Intronic
1150428921 17:65100577-65100599 GGGGGTGGAGGAGGAGGTGGAGG - Intergenic
1150747329 17:67825998-67826020 CGGGGGGGGCGAGGAGGCGGGGG + Exonic
1151230521 17:72681734-72681756 CGCTGTGGAGGAGGAGGAAGAGG - Intronic
1151362076 17:73595198-73595220 AGGTGAGGAGGAGGAGGAGGAGG + Intronic
1151380009 17:73719413-73719435 CTGTGAGGCGGGGGAGGCGGGGG - Intergenic
1151525967 17:74668386-74668408 GGGTGTGGGGGGGGGGGCGGCGG - Intergenic
1151558691 17:74859880-74859902 CGATGCGGCGGCGGCGGCGGCGG + Intronic
1151806844 17:76411028-76411050 TGGTGTGGTGGGGGAGGGGGTGG + Intronic
1151961455 17:77407991-77408013 TGGTGTGGCTGAGGAGCCGGAGG - Intronic
1152321409 17:79610436-79610458 GGCTGTGGCGGCGGCGGCGGCGG - Intergenic
1152378691 17:79931146-79931168 AGGTGGGGTGGGGGAGGCGGAGG + Intergenic
1152565121 17:81096920-81096942 AGCTGTGGAGGAGGAGGAGGTGG + Intronic
1152718577 17:81911505-81911527 AGGCGGGGCGGGGGAGGCGGGGG - Intergenic
1152721878 17:81927467-81927489 CGGCGCGGCGGGGGCGGCGGGGG - Intronic
1152744147 17:82031482-82031504 CGGGGTCGCGCTGGAGGCGGGGG + Intergenic
1152945636 17:83196072-83196094 GGGTCTGGGGGAGGAGGCTGGGG - Intergenic
1153942247 18:9988372-9988394 CTGTGTGGGGGAGGAGAAGGAGG - Intergenic
1155654331 18:28177043-28177065 CGAAGAGCCGGAGGAGGCGGCGG + Exonic
1155953916 18:31941366-31941388 CTGGGAGGCGGAGGTGGCGGTGG + Intronic
1156171619 18:34493548-34493570 CGGAGTGGGGGAGGGCGCGGGGG + Intronic
1156213840 18:34976944-34976966 CGGAGCGGCGGCGGCGGCGGCGG + Intronic
1157251296 18:46098372-46098394 CAGAGTGGCGGCGGGGGCGGGGG - Intronic
1157276063 18:46311874-46311896 GGATGTGGCGGAGGAGGAGGAGG + Intergenic
1157294642 18:46433601-46433623 GGGTGTGGCGGAGACGGGGGCGG + Intronic
1157461239 18:47896665-47896687 GGGTCTGGAGGAGCAGGCGGAGG - Exonic
1158446274 18:57524683-57524705 AGGAGTGGAGGAGGAGGAGGAGG + Intergenic
1158963820 18:62606979-62607001 GGGGGAGGAGGAGGAGGCGGTGG + Intergenic
1159260525 18:66006325-66006347 AGGTGTGGAGGGAGAGGCGGGGG - Intergenic
1160516992 18:79484103-79484125 TGGGGTGGCTGACGAGGCGGGGG + Intronic
1160625530 18:80201782-80201804 CGCTGGGGTGAAGGAGGCGGAGG + Intronic
1160769179 19:822533-822555 CGGCGCGGCGGAGGGGGCGAGGG - Intergenic
1160779646 19:872136-872158 CGGTGTGGCTGGGGCGGCGGGGG + Intronic
1160819732 19:1052403-1052425 GGTTGAGGCGGAGGAGGAGGGGG + Intronic
1160835704 19:1123579-1123601 GGCTGAGGAGGAGGAGGCGGAGG - Exonic
1160844376 19:1160024-1160046 CCGCGTGGCGGGGCAGGCGGGGG - Intronic
1160909638 19:1468724-1468746 CGGTGTGGCGCGGGGGCCGGGGG - Exonic
1160930466 19:1567640-1567662 CGGGGCGGCGGCGGCGGCGGGGG + Exonic
1160967777 19:1754116-1754138 CGCTGCGGCGGGGGTGGCGGGGG - Exonic
1161319351 19:3633849-3633871 GGCTGTGGAGGAGGAGGAGGAGG - Intronic
1161447476 19:4326767-4326789 GTGTGTGGGGGAGGGGGCGGGGG - Intronic
1161450669 19:4343733-4343755 CGGTGCGGGCGAGGAGGCGCCGG + Exonic
1161733650 19:5977647-5977669 CCGGGTGGCGGAGGACGAGGGGG + Intronic
1161976591 19:7611038-7611060 GGGAGAGGCGGAGGAGGAGGTGG + Intronic
1162110092 19:8395387-8395409 GGGTGTGGTGGTGGAGGCTGAGG - Intronic
1162292769 19:9792116-9792138 CGGTGAGGGGGAGGCGGGGGCGG - Intronic
1162315603 19:9936474-9936496 CGGCGAGGCGGGGGAGGCGGCGG - Exonic
1162486041 19:10961126-10961148 CGGAGGGGCGGGGGAGGCGCCGG + Exonic
1162506815 19:11090487-11090509 ATGTGAGGCGGTGGAGGCGGAGG + Intronic
1162800644 19:13108682-13108704 CTGGGAGGAGGAGGAGGCGGTGG - Intronic
1162999322 19:14356206-14356228 AGGTGTGGCTGGGGAGGTGGTGG + Intergenic
1163023482 19:14496069-14496091 CGGGGAGGCGGAGGCAGCGGCGG - Exonic
1163064809 19:14785146-14785168 AGGTGTGGCTGGGGAGGTGGTGG - Intergenic
1163314944 19:16535421-16535443 GTGTCTGGCCGAGGAGGCGGCGG + Intronic
1163442437 19:17328716-17328738 CGGGGCGCCGGAGGAGGAGGAGG - Exonic
1163508025 19:17719693-17719715 GGGTGGGGCGGCGGCGGCGGCGG + Intronic
1163607095 19:18281485-18281507 CGGCGCGGCGGGGGAGGCGGAGG - Exonic
1163804146 19:19386003-19386025 CGCTGTGGCGGCGGCGGCAGCGG - Exonic
1164834621 19:31349473-31349495 CGGGGGGGAGGAGGAGGCAGAGG + Exonic
1165204518 19:34172451-34172473 CGGCGCGGCGGCGGCGGCGGCGG - Intergenic
1165331435 19:35142960-35142982 AGGGGCGGCGGAGGGGGCGGTGG - Exonic
1165510968 19:36266524-36266546 CGGGGCGGCGGTGGCGGCGGTGG - Intergenic
1165745623 19:38228518-38228540 GGGCCTGGTGGAGGAGGCGGAGG - Intronic
1165772233 19:38386438-38386460 CTGGGGGGCGGCGGAGGCGGCGG - Exonic
1165830567 19:38728437-38728459 AGGTGGGGGGGAGGAGGAGGAGG - Intronic
1165893987 19:39130699-39130721 CAGTGTGGCTGAGCAGGGGGTGG + Intronic
1166067257 19:40367055-40367077 GTGTGTGGAGGAGGAGGGGGCGG - Intronic
1166219058 19:41353693-41353715 CGCAGTGGCGGGGGCGGCGGCGG + Exonic
1166304261 19:41928604-41928626 CGGCGCGGGGGAGGGGGCGGGGG + Intronic
1166358623 19:42242365-42242387 GGCGGAGGCGGAGGAGGCGGCGG - Exonic
1166876649 19:45901871-45901893 CGGTCTGGGAGAGGCGGCGGCGG - Intronic
1166983966 19:46648996-46649018 CGGCGTGGCCGTGGAGGCCGAGG + Exonic
1167040606 19:47020784-47020806 CGGCGCGGGGGAGGCGGCGGCGG + Intronic
1167076175 19:47250905-47250927 TGGGGAGGCGGGGGAGGCGGGGG - Intergenic
1167269678 19:48499789-48499811 CGGGGTGGGGGTGGCGGCGGTGG + Exonic
1167322994 19:48807679-48807701 GGGTCTGGCGGAGGAGGGGCTGG - Intronic
1167454453 19:49591226-49591248 CGCAGAGGAGGAGGAGGCGGCGG + Intergenic
1167456977 19:49601562-49601584 GGCTGTGGCGGCGGAGGGGGTGG - Exonic
1167466560 19:49653443-49653465 AGGTGGGGCGGAGGAGGAGGAGG + Exonic
1167576536 19:50320500-50320522 GGGGATGGGGGAGGAGGCGGTGG - Intronic
1167577154 19:50323193-50323215 GGGTGGGGCGGGGGTGGCGGGGG + Exonic
1168076349 19:53982601-53982623 GGGGGCGGCGGCGGAGGCGGCGG + Exonic
1168153591 19:54461506-54461528 CGGTGTGGCGGCGGAGGATCTGG - Exonic
1168185961 19:54699432-54699454 CAGGGTGGAGGAGGAGGCAGAGG - Intronic
1168238227 19:55076511-55076533 GGGTGTGGGTGAGGAGGCGAGGG - Intronic
1168276946 19:55284048-55284070 CGGAGAGGAGGAGGAGGCGGAGG + Intronic
1168339693 19:55615871-55615893 CGGGCTGGCGGGGGAGGTGGGGG + Exonic
925142463 2:1559436-1559458 CTCTGTGGCTGAGGAGGAGGGGG - Intergenic
925308907 2:2868129-2868151 CGGGGAGGCGCAGGAGGCAGGGG - Intergenic
925786078 2:7432191-7432213 CAGTGTGGGGGTGGGGGCGGGGG - Intergenic
925948916 2:8893065-8893087 GGGGGTGGGGGAGGAGGCAGGGG + Intronic
925948930 2:8893090-8893112 GGGGGTGGGGGAGGAGGCAGGGG + Intronic
925995563 2:9289949-9289971 CGGGGTGTTGGAGAAGGCGGAGG + Intronic
926089880 2:10043203-10043225 CGGCGGGGCGGCGGGGGCGGCGG - Intronic
927168710 2:20350757-20350779 CGGTGGTTCGGAGGAGGAGGGGG - Intronic
927810691 2:26178878-26178900 GGGAGGGGAGGAGGAGGCGGAGG + Intronic
928131575 2:28655522-28655544 AGGTGTATAGGAGGAGGCGGGGG - Intergenic
928143577 2:28751841-28751863 CGGTGCCGAGGAGGAGGAGGTGG + Exonic
928778621 2:34794058-34794080 TGGTGTGGTGGAGATGGCGGGGG - Intergenic
929452731 2:42047929-42047951 CGGAGGGGCGGGGGAGGGGGCGG + Intergenic
929701825 2:44169031-44169053 GGCTGCGGCGGAGGAGGTGGCGG + Exonic
929941237 2:46335644-46335666 CGGTGTGGTAGAGGAGGCAGTGG + Intronic
930634237 2:53787120-53787142 GGAGGTGGAGGAGGAGGCGGCGG - Exonic
931235116 2:60406435-60406457 GGGTGTGGGGGAGGAAGAGGCGG - Intergenic
931256907 2:60581891-60581913 CCGCGGGGCGGTGGAGGCGGCGG - Intergenic
931356117 2:61538561-61538583 AGGGGTGGAGGAGGAGGAGGTGG + Intronic
932137706 2:69245330-69245352 CAGTGGGGCGCAGGAGGTGGGGG - Exonic
932496589 2:72148634-72148656 CGATGGGGCGGCGGCGGCGGCGG + Intergenic
932498745 2:72161550-72161572 CGGGGTGGTGGGGGGGGCGGTGG - Intergenic
932827929 2:74958676-74958698 CGGGATGGCGGCGGCGGCGGCGG + Exonic
933666714 2:84970832-84970854 CGGCGCGGCGGCGGCGGCGGCGG + Intergenic
933772778 2:85754568-85754590 CTCTGGGGCGCAGGAGGCGGCGG - Exonic
933847534 2:86337678-86337700 CGTTCTGGCGGCGGCGGCGGCGG + Intronic
933908278 2:86914897-86914919 CCGGGCGGCGGCGGAGGCGGCGG + Intronic
934079115 2:88452455-88452477 CGGGGCGGCGGCGGTGGCGGCGG + Exonic
934261192 2:91478104-91478126 CGGGGCGGCGGCGGCGGCGGCGG - Intergenic
934278195 2:91589835-91589857 CCTTGAGGCGGAAGAGGCGGCGG - Intergenic
934678449 2:96266015-96266037 CGGGGAGCCGGAGGAGGCGGAGG - Intergenic
935201018 2:100856707-100856729 CGGGGTGGGGGCGGGGGCGGGGG + Intronic
935592157 2:104853837-104853859 AGATGTGGCGGAGGGGGCGGCGG + Intergenic
935592555 2:104855607-104855629 GGGGGTGGCGGCGGCGGCGGCGG + Exonic
935592667 2:104856030-104856052 TGGTGTGGGGGCGGCGGCGGGGG - Exonic
936038538 2:109130564-109130586 CGGTGTGGCTAAGGAGGGGAGGG + Intronic
936939617 2:117871014-117871036 GGGGGAGGAGGAGGAGGCGGTGG - Intergenic
936939666 2:117871141-117871163 GGAGGTGGAGGAGGAGGCGGTGG - Intergenic
937221814 2:120346303-120346325 CCGGGTGGCGGGGGTGGCGGCGG - Exonic
937284494 2:120741607-120741629 CGGGGGCGGGGAGGAGGCGGAGG - Intronic
937408144 2:121649413-121649435 TGGGGTGGAGGAGAAGGCGGCGG - Exonic
938018394 2:127885990-127886012 CGGCGGGGCGGCGGCGGCGGCGG + Intergenic
938018395 2:127885993-127886015 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
940279465 2:151974710-151974732 CGGTGTGGAGCAGCAGGTGGAGG - Intronic
942116787 2:172735894-172735916 CCGCGCGGCGGACGAGGCGGGGG + Exonic
942302499 2:174575305-174575327 GGATTTGGCGGAGGAGGTGGTGG - Exonic
942446157 2:176080282-176080304 CGGGGTGGCGGTGGCGGCGGCGG - Exonic
942454905 2:176130709-176130731 GGAGGTGGCGGCGGAGGCGGAGG - Exonic
943060632 2:183038412-183038434 AGGTGTGGCGGCGGCGGCGGCGG + Exonic
943185318 2:184598930-184598952 GGCTGCGGCGGAGGAGGCGGCGG + Exonic
943222798 2:185132599-185132621 AGGTGTGGAGGAAGAGGCGCGGG + Intergenic
943342102 2:186694005-186694027 CCGGGAGGCGGAGGGGGCGGAGG - Exonic
944523485 2:200595295-200595317 GGCTGTGGAGGAGGAGGCTGTGG + Exonic
944675908 2:202034114-202034136 GGGTGTGGAGGAGGAGGCGAAGG + Intergenic
944743670 2:202635353-202635375 CGGAGCGGCGGCGGCGGCGGCGG + Exonic
944822094 2:203441241-203441263 GGGAGTGGGGGAGGAGGGGGTGG + Exonic
944822105 2:203441268-203441290 GGGGGTGGTGGAGGAGGAGGTGG + Exonic
944822113 2:203441289-203441311 GGGGGTGGCGGAGGAGGTAGAGG + Exonic
945870263 2:215219390-215219412 GGGTGTGGTGGAGTAGGGGGTGG - Intergenic
946354918 2:219178460-219178482 CAGTGAGGCAGAGGAGGAGGCGG + Exonic
946609486 2:221441952-221441974 CAGTGTGGGGGAGCAGTCGGAGG - Intronic
947035623 2:225851120-225851142 CAGTGTGGCAGAGGTGGAGGAGG + Intergenic
947714595 2:232333306-232333328 GGGGGTGGGGGAGGAGGAGGAGG - Intronic
947741724 2:232487821-232487843 CGCGGCGGCAGAGGAGGCGGCGG - Exonic
947765586 2:232635058-232635080 CAGGGAGGCAGAGGAGGCGGAGG - Intronic
948052416 2:234988622-234988644 CAGGGCGGTGGAGGAGGCGGAGG - Intronic
948124317 2:235553895-235553917 CGGGGTGGGGTGGGAGGCGGAGG - Intronic
948375645 2:237518664-237518686 CGAGGTGGCTGAGGAGGGGGTGG - Intronic
1168757195 20:325844-325866 GGGGGTGGGGGAGGAGGCAGCGG - Exonic
1168757400 20:326559-326581 CGGGGAGGCGGCGGCGGCGGCGG - Exonic
1168757402 20:326565-326587 CGGTGTCGGGGAGGCGGCGGCGG - Exonic
1169204581 20:3732628-3732650 CGGCCTGGGGGAGGGGGCGGCGG + Intergenic
1169207380 20:3748101-3748123 GGGTGTGATGGAGGAGGAGGTGG + Intronic
1169997307 20:11572526-11572548 GGGTGTGGCGGGGGAGGGGAGGG + Intergenic
1170150449 20:13221549-13221571 TGGTGCGGCGGCGGCGGCGGCGG + Intergenic
1170630367 20:18059386-18059408 CGGTGAGCCGGAGGAGGAGGAGG + Intergenic
1170756803 20:19212485-19212507 CGGCGCGGCGGGGGCGGCGGGGG - Intergenic
1171173635 20:23035570-23035592 GGCGGAGGCGGAGGAGGCGGTGG + Exonic
1172013820 20:31861547-31861569 CGGCCCGGCGGAGGAGGCCGAGG + Exonic
1172295934 20:33811327-33811349 CGGGGCGGAGGCGGAGGCGGAGG + Exonic
1172644521 20:36461529-36461551 CGGACTGGCGGCGGCGGCGGCGG - Intronic
1172644587 20:36461705-36461727 CGGGGAGGAGGAGGAGGAGGAGG - Intronic
1172644877 20:36462751-36462773 CTGTCTGGCGGAGGAGGGAGTGG + Intronic
1172951216 20:38724499-38724521 CGGAGCGGCGGCGGCGGCGGTGG - Exonic
1173350411 20:42239996-42240018 CAGTGTAGCTGAGGAGGAGGTGG - Intronic
1173843793 20:46175510-46175532 TGGTGTGGCAGAGGAGGGTGAGG - Intronic
1174246877 20:49188229-49188251 CGGAGTGGCCGTGGAGGAGGCGG + Exonic
1174494730 20:50931308-50931330 CGGGCCGGCGGAGGCGGCGGCGG + Intergenic
1174713127 20:52728260-52728282 AGGTGTGGAGGAAGAGGCGCTGG - Intergenic
1174736797 20:52972692-52972714 CGGCGAGGAGGAGGAGGAGGAGG + Exonic
1175074089 20:56359088-56359110 CGGCGGGGCGCAGGGGGCGGTGG - Exonic
1175210491 20:57350934-57350956 CGGGGGGGCGGGGGGGGCGGGGG + Intergenic
1175262558 20:57684016-57684038 CGGTGTTGCGGAGCCGGGGGTGG - Intronic
1175332040 20:58171894-58171916 CGGTGTGGGGGTGGATGGGGCGG - Intergenic
1175521341 20:59604377-59604399 CGGGGTGGGGGAGGAGGGGCTGG - Intronic
1175847105 20:62065001-62065023 CGGGGCGGCGGCGGGGGCGGCGG + Exonic
1175922981 20:62458697-62458719 CTGTGTGGAGGAGGGGGCGTGGG + Intergenic
1176089206 20:63311553-63311575 GGGGGTGGCGGGGGAGGCAGAGG + Intronic
1176161724 20:63652034-63652056 GGGTGTCCAGGAGGAGGCGGAGG + Intronic
1176445191 21:6815588-6815610 CGGGGTGGGGGTGGAGGTGGGGG + Intergenic
1176548520 21:8212041-8212063 CGGGGGGGCGGACGAGGAGGCGG - Intergenic
1176548880 21:8213180-8213202 CGGTGTGGTGGTGGGGGAGGAGG + Intergenic
1176556414 21:8256249-8256271 CGGGGGGGCGGACGAGGAGGCGG - Intergenic
1176556775 21:8257393-8257415 CGGTGTGGTGGTGGGGGAGGAGG + Intergenic
1176557287 21:8258955-8258977 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
1176567451 21:8395076-8395098 CGGGGGGGCGGACGAGGAGGCGG - Intergenic
1176567811 21:8396215-8396237 CGGTGTGGTGGTGGGGGAGGAGG + Intergenic
1176575353 21:8439291-8439313 CGGGGGGGCGGACGAGGAGGCGG - Intergenic
1176575714 21:8440434-8440456 CGGTGTGGTGGTGGGGGAGGAGG + Intergenic
1176576229 21:8441990-8442012 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
1176823358 21:13680621-13680643 CGGGGTGGGGGTGGAGGTGGGGG + Intergenic
1176952662 21:15064948-15064970 GGCGGCGGCGGAGGAGGCGGCGG - Exonic
1177821296 21:26033527-26033549 CAGTATGGTGGAGGAGGGGGTGG + Intronic
1178259817 21:31088573-31088595 AGGTGTGGAGGAAGAGGCGCGGG - Intergenic
1178351004 21:31873250-31873272 CGGCGAGGCGGAGGCTGCGGAGG + Intergenic
1178673909 21:34614960-34614982 CGGGGCCGCGGCGGAGGCGGCGG - Exonic
1178725546 21:35048356-35048378 CAGTGTGGGGCAGGAGGCGGAGG - Intronic
1178824566 21:36004834-36004856 AGGCGGGGGGGAGGAGGCGGGGG + Intergenic
1179081813 21:38178577-38178599 CGAGGAGGAGGAGGAGGCGGTGG + Intronic
1179175484 21:39005062-39005084 CGGGGGGGGGGGGGAGGCGGGGG + Intergenic
1179209549 21:39313598-39313620 CGGTATGGCGGCGGCGGCGGCGG - Exonic
1179297332 21:40075062-40075084 TGGTTGTGCGGAGGAGGCGGCGG - Exonic
1179949058 21:44699513-44699535 CGGTGTGTTGGAGGAGCTGGGGG - Intronic
1180068639 21:45425161-45425183 TGGTGTGAGGAAGGAGGCGGTGG - Intronic
1180081575 21:45489958-45489980 GGGTGTGGGGGAGGAGGTGTGGG - Intronic
1180081594 21:45489999-45490021 GGGTGTGGGGGAGGAGGTGTGGG - Intronic
1180088760 21:45523425-45523447 TGGTGTGGCCGTGGAGGCTGTGG - Intronic
1180876666 22:19178112-19178134 CGGTGAGGAGGGGGAGGCCGCGG - Exonic
1181147391 22:20858685-20858707 CGGGGAGGCGGAGGCGGAGGCGG - Exonic
1181299197 22:21867454-21867476 CAGCGCGGCGGAGGCGGCGGCGG - Exonic
1181711855 22:24696168-24696190 AGGGGTGGGGGAGGAGGAGGAGG - Intergenic
1181768817 22:25111415-25111437 CGGGGAGGCGGAGGCGGTGGCGG - Intronic
1182073457 22:27478926-27478948 CGGTGGGGAGGAGGAGAGGGAGG + Intergenic
1182475475 22:30574471-30574493 CGCTGAGGCGGAGGAGGACGGGG - Intronic
1182551897 22:31105127-31105149 CGCTGAGGCGGAGGAGGGGCGGG + Exonic
1183048939 22:35245216-35245238 AGGTGGAGCAGAGGAGGCGGAGG - Intergenic
1183349095 22:37324835-37324857 CGGTGCGGGGGAGGGGGCGTGGG - Intergenic
1183370123 22:37427481-37427503 CGGCGGGGAGGAGGGGGCGGCGG - Intergenic
1183618868 22:38961304-38961326 AGGTGGGGCTGGGGAGGCGGGGG - Intronic
1183624071 22:38991249-38991271 AGGTGGGGCTGGGGAGGCGGGGG - Intronic
1183649202 22:39144683-39144705 CGGTGTGGAGGAGCACGCTGTGG - Intronic
1183731833 22:39622593-39622615 CGGTGTGGGGGGGGCGGTGGGGG + Intronic
1183780433 22:39995537-39995559 CGGTGTGGGGGCGAAGGCGGGGG - Intronic
1184162417 22:42704881-42704903 GGGGGGGGCGGCGGAGGCGGGGG + Intronic
1184408695 22:44314193-44314215 CGGTGGGGCGGGGGTGGGGGTGG + Intergenic
1184738934 22:46415950-46415972 CGGCGTGGAGCACGAGGCGGCGG + Intronic
1184840030 22:47047143-47047165 GGGTGTGGCGGAGGAGGGCTCGG + Intronic
1184891028 22:47379264-47379286 GGAGGAGGCGGAGGAGGCGGAGG + Intergenic
1184891033 22:47379279-47379301 GGCGGAGGCGGAGGAGGCGGAGG + Intergenic
1184891042 22:47379306-47379328 GGCGGCGGCGGAGGAGGCGGCGG + Intergenic
1184891047 22:47379321-47379343 GGCGGCGGCGGAGGAGGCGGCGG + Intergenic
1184891052 22:47379336-47379358 GGCGGCGGCGGAGGAGGCGGCGG + Intergenic
1185042308 22:48511366-48511388 CAGTGAGGAGGAGGAGGAGGAGG - Intronic
1185055289 22:48575927-48575949 GCGGGCGGCGGAGGAGGCGGCGG + Intronic
1203253404 22_KI270733v1_random:128346-128368 CGGGGGGGCGGACGAGGAGGCGG - Intergenic
1203253765 22_KI270733v1_random:129488-129510 CGGTGTGGTGGTGGGGGAGGAGG + Intergenic
1203254279 22_KI270733v1_random:131048-131070 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
1203261458 22_KI270733v1_random:173424-173446 CGGGGGGGCGGACGAGGAGGCGG - Intergenic
1203261821 22_KI270733v1_random:174567-174589 CGGTGTGGTGGTGGGGGAGGAGG + Intergenic
1203262335 22_KI270733v1_random:176127-176149 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
950136534 3:10585013-10585035 GGGTGTGGCAGGGGAGGAGGAGG - Intronic
950215283 3:11154476-11154498 GGGTGTCGCGGGGGCGGCGGCGG - Intronic
950238060 3:11341057-11341079 CGGGGTGGGGGACGGGGCGGGGG - Intronic
950539140 3:13599622-13599644 GGGGGTGGTGGAGGAGGAGGTGG + Intronic
950710565 3:14810617-14810639 CGGGGCGGGGGAGGAGGAGGGGG - Intergenic
951072599 3:18349615-18349637 TGCTGTGGCTGTGGAGGCGGCGG + Exonic
952354385 3:32570824-32570846 GGCGGTGGCGGTGGAGGCGGCGG + Exonic
953025676 3:39143597-39143619 CGGTGGGGAGGAGGAGGAAGAGG - Exonic
954130103 3:48556471-48556493 AGGTGTGGCAGAGCAGGGGGCGG - Intronic
954210412 3:49093933-49093955 GGGTGCAGCGGAGGCGGCGGCGG - Exonic
954316487 3:49804309-49804331 CTGTGTGGAGGAGGAGGAAGAGG + Exonic
954326297 3:49866102-49866124 TGGTGAGGAGGAGGAGGAGGAGG - Intronic
954420704 3:50417636-50417658 CAGTGAGGAGGAGGAGGAGGAGG - Intronic
954752397 3:52821076-52821098 CAGTGTGGCAGAGCAGGAGGCGG - Exonic
954779074 3:53046023-53046045 CGCTCCGGCGGAGGCGGCGGCGG + Exonic
955060696 3:55489430-55489452 GGGTGTGGGGGTGGAGGTGGGGG - Intronic
955916493 3:63912716-63912738 CGCTGGGGCTGCGGAGGCGGCGG - Exonic
956100179 3:65760159-65760181 CGGGGAGGAGGAGGAGGAGGAGG - Intronic
956633155 3:71335924-71335946 GGGGGTGGAGGCGGAGGCGGAGG + Intronic
957078621 3:75619586-75619608 CGGCGAGGAGGCGGAGGCGGAGG - Intergenic
957630906 3:82715320-82715342 AGGTGTGGAGGAAGAGGCGCGGG + Intergenic
960159601 3:114335793-114335815 GGGAGTGGGGGAGGAGGTGGAGG - Intergenic
960680641 3:120243928-120243950 TGGTGTTGGGGAGGAGGAGGTGG - Intronic
961006708 3:123410351-123410373 CTGTGTTGAGGAGGAGGAGGAGG - Intronic
961481714 3:127184670-127184692 CGGTGCGGGGGAGGAGGGGACGG - Intergenic
961626119 3:128264893-128264915 AGGTGGGGCGGAGCAGGCAGTGG - Intronic
961746757 3:129068639-129068661 AGGTGTGGAGGGAGAGGCGGGGG - Intergenic
961919192 3:130408264-130408286 CGGTGTGGGGGTGGTGGCAGGGG + Intronic
962204455 3:133423545-133423567 TGGGGTGGTGGGGGAGGCGGCGG + Intronic
962311286 3:134328807-134328829 TGTTGTGGGGGAGGTGGCGGAGG + Intergenic
962498398 3:135965659-135965681 GGGTGGGGCCGAGGAGGAGGAGG + Exonic
962793992 3:138835007-138835029 CGCGGTGGCGGCGGCGGCGGCGG + Intergenic
963554624 3:146772336-146772358 AGGTGTGGAGGGAGAGGCGGGGG + Intergenic
963583305 3:147154077-147154099 AGGTGTGGAGGGAGAGGCGGGGG + Intergenic
963673541 3:148280888-148280910 AGGTGTGGCGGGAGAGGCGCGGG - Intergenic
964358355 3:155870546-155870568 CGGTTTGGCGGCGGCTGCGGAGG + Exonic
964570775 3:158105798-158105820 GGCGGCGGCGGAGGAGGCGGAGG - Exonic
964570782 3:158105819-158105841 GGCGGCGGCGGAGGAGGCGGAGG - Exonic
965562846 3:170078303-170078325 GGGGCTGGGGGAGGAGGCGGAGG - Intronic
965590666 3:170357783-170357805 CGGCGACGCGGCGGAGGCGGCGG + Intronic
966350836 3:179032014-179032036 CTGTGTGGAGGGGGAGGGGGAGG - Intronic
966998314 3:185307539-185307561 CGGGGTGGCGGGGGAGGGGGTGG - Intronic
967553791 3:190831393-190831415 GGGAGTGGTGGAGGAGGTGGAGG - Intergenic
968434126 4:576248-576270 CGGGGTCGCGGCGGCGGCGGCGG - Intergenic
968652890 4:1767125-1767147 CGGGCGGGCGGAGGGGGCGGTGG - Intergenic
968850582 4:3075033-3075055 CCGGGTGGCGGCGGGGGCGGCGG - Exonic
969032553 4:4226492-4226514 CCTTGAGGCGGAAGAGGCGGCGG + Exonic
969685988 4:8674598-8674620 CGGTGTGGCCGGGGAGGTGGTGG - Intergenic
970194624 4:13542403-13542425 AGGCGTCGCGGAGGAGGAGGAGG - Exonic
970195567 4:13547561-13547583 AGGTGTGGAGGAGGAGGGGAGGG - Intergenic
970202895 4:13627526-13627548 GGCTGCGGCGGGGGAGGCGGCGG + Exonic
970332882 4:15003259-15003281 TGGAGCGGCGGAGGCGGCGGCGG - Exonic
970332883 4:15003262-15003284 CAGTGGAGCGGCGGAGGCGGCGG - Exonic
970967883 4:21948863-21948885 CGGGGTGGCGGGGGAGGCCGAGG + Intergenic
971043383 4:22778950-22778972 AGGTGTGGAGGAAGAGGCGCGGG - Intergenic
971195736 4:24470920-24470942 GGGTGATGCGGAGGCGGCGGCGG + Intergenic
971627878 4:28946657-28946679 TGGTGTGACGGAGGTGGCAGAGG + Intergenic
972778575 4:42265930-42265952 AGGTGTGGAGGAAGAGGCGCAGG + Intergenic
975342638 4:73258800-73258822 CGGAGCGGCGGCGGCGGCGGCGG - Intergenic
975715879 4:77205511-77205533 CGGGGTAGGGGAGGAGGGGGCGG - Intronic
975847637 4:78541753-78541775 CTCTGTGGCTGAGGAGGCAGAGG - Intronic
975949896 4:79757474-79757496 TGGGGTGGCGGAGGACGGGGGGG - Intergenic
976102461 4:81580441-81580463 AGGTGTGGAGGGAGAGGCGGGGG + Intronic
976630960 4:87235893-87235915 CGGTGGGGAGGAGGGTGCGGGGG + Intronic
976990575 4:91359832-91359854 TGGTGTGGCAGAGGTGGTGGTGG + Intronic
977257547 4:94757913-94757935 CGCGGTGGCGGCGGCGGCGGCGG + Intergenic
977257649 4:94758270-94758292 CCGTGGGGCGGTGGCGGCGGCGG + Intronic
977537398 4:98270781-98270803 AGGTGTGGCAGAGGTGGAGGAGG - Intronic
978072551 4:104491350-104491372 CGCCGAGGAGGAGGAGGCGGAGG + Exonic
978072578 4:104491435-104491457 GGGGGTGGCGGCGGCGGCGGCGG - Exonic
979608979 4:122670207-122670229 AGGTGTGGAGGAAGAGGCGTGGG + Intergenic
980321927 4:131290694-131290716 CGGTGGGGCGGGGGGGGGGGGGG + Intergenic
980328421 4:131379358-131379380 AGGTGTGGAGGAGGAGGCGCGGG + Intergenic
980930173 4:139177142-139177164 CGGTGGGGCGGCGCGGGCGGGGG - Exonic
980968261 4:139544832-139544854 GTGTGTGGAGGGGGAGGCGGAGG + Intronic
980969551 4:139556101-139556123 CGAGATGGTGGAGGAGGCGGTGG - Exonic
981315450 4:143336355-143336377 CGGGGTGGGGGAGGCGGCGGGGG + Intergenic
982199132 4:152943160-152943182 GGGGGTGGAGGAGGAGGTGGAGG - Exonic
983077476 4:163343867-163343889 CGGTGGGGAAGAGGGGGCGGGGG - Intronic
983577146 4:169271435-169271457 CCGGGGGGAGGAGGAGGCGGCGG - Intergenic
984711865 4:182892511-182892533 GGGTGTGGCAGGGGAGGCTGAGG + Intronic
985269262 4:188178969-188178991 AGGTGTGGAGGAAGAGGCGAGGG + Intergenic
985374706 4:189322772-189322794 CGGTTTGGCGGGGTAGGGGGTGG + Intergenic
985771941 5:1817360-1817382 CGGTGTGGGGAGGGAGGCTGAGG + Intergenic
986402793 5:7396053-7396075 CGCGGTGGCGGTGGCGGCGGCGG + Intergenic
986591603 5:9376250-9376272 CGATATGGAGGAGGAGGTGGAGG - Intronic
986608634 5:9546199-9546221 CGGGGAGGAGGAGGAGGAGGAGG - Intergenic
986608635 5:9546202-9546224 CGGCGGGGAGGAGGAGGAGGAGG - Intergenic
986912572 5:12574844-12574866 CGGTGTGGAGGGAGAGGCGCAGG - Intergenic
988999464 5:36745331-36745353 CGGTGGCGGGGAGGAGGAGGAGG + Intergenic
989777349 5:45225624-45225646 AGGTGTGGAGGAAGAGGCGCGGG + Intergenic
990545132 5:56815280-56815302 CTGGGAGGCGGAGGGGGCGGGGG - Intergenic
991216977 5:64166260-64166282 AGGTGTGGCGGAGGAGGCCGGGG + Intronic
991443651 5:66677793-66677815 AGGTTTGGAGGAGGAGGTGGTGG + Intronic
992050324 5:72935229-72935251 AGGTGTGGAGGGAGAGGCGGGGG + Intergenic
993654631 5:90562435-90562457 AGGTGTGGCAGAGGAGGAGAAGG + Intronic
995199400 5:109409951-109409973 GGCTGTGGCGGCGGCGGCGGCGG + Exonic
996232750 5:121087010-121087032 CAGTGTGGCTGAGGAGGCCTCGG + Intergenic
996297443 5:121938381-121938403 CGGTGTGGGGGACGAGGGGAAGG - Intergenic
996404205 5:123090277-123090299 GGAGGAGGCGGAGGAGGCGGAGG - Exonic
997228887 5:132228574-132228596 CTGGGTGGGGGCGGAGGCGGGGG + Intronic
997745829 5:136299373-136299395 GTGTGTGGTGGAGGAGGAGGAGG + Intronic
997999039 5:138609692-138609714 TGGAGAGGCGGAGGAGGTGGGGG + Intergenic
998366878 5:141637610-141637632 CGGTGAGGCGGCGAAGGGGGAGG + Exonic
1001070313 5:168579582-168579604 CAGTGCGGCGGCGGCGGCGGTGG - Exonic
1001296724 5:170503986-170504008 GGGGGCGGCGGAGGGGGCGGCGG - Intronic
1001296730 5:170503998-170504020 CGGAGCGGCGGAGGGGGCGGCGG - Intronic
1001482303 5:172096605-172096627 CGGTGGGGTGGAAGAGGCTGGGG + Intronic
1001936499 5:175709441-175709463 AGGTGTTGCGGAGGCGGCAGTGG - Intergenic
1002029305 5:176416303-176416325 CGGTGCCCCGGAGGCGGCGGAGG - Exonic
1002100625 5:176855855-176855877 TGGGGTGGAGGAGGAGGCTGGGG - Intronic
1002140298 5:177133760-177133782 GTGTGAGGAGGAGGAGGCGGCGG + Intronic
1002186040 5:177455287-177455309 CGGTGTGGTGGTGGCTGCGGCGG - Exonic
1002491082 5:179577759-179577781 TGGTCGGGCGGCGGAGGCGGTGG + Intronic
1002580938 5:180209135-180209157 CGGTCGGGCGGCGGCGGCGGCGG - Intronic
1002621966 5:180494432-180494454 GGGCGCGGAGGAGGAGGCGGCGG + Exonic
1002897959 6:1390051-1390073 CGGGGCGGCGGCGGCGGCGGCGG - Exonic
1002904800 6:1439529-1439551 CAGTGTTGACGAGGAGGCGGAGG + Intergenic
1003018429 6:2487917-2487939 AGGTGTGGGGGAGTAGGAGGTGG + Intergenic
1003125940 6:3356048-3356070 AGGGGAGGGGGAGGAGGCGGGGG + Intronic
1003781999 6:9439669-9439691 GGGAGTGGAGGAGGAGGTGGTGG - Intergenic
1004043933 6:12009109-12009131 CCGCGTGGCGGTGGCGGCGGCGG + Intronic
1004044747 6:12012611-12012633 CGGCGGGGCGGAGGGGGGGGGGG + Intronic
1004864318 6:19838109-19838131 TGGTGTGGCGGCGCGGGCGGTGG - Exonic
1004906236 6:20239286-20239308 CGGAGTGGCGGGGGAGGCGCAGG - Intergenic
1005385198 6:25279120-25279142 CGGTGCTGCGGTGGCGGCGGCGG - Intronic
1005947033 6:30602481-30602503 CGGAATGGAGGAGGAGGAGGAGG + Exonic
1006268860 6:32948928-32948950 CTTTGTGGGGGAGGAGGAGGAGG - Intronic
1006304071 6:33208470-33208492 GGGTGTAGCGGAGGAGCAGGCGG + Intergenic
1006337545 6:33428238-33428260 CGCGGTGGCGGCGGCGGCGGCGG + Intronic
1006576280 6:35048831-35048853 TGGTGAGGCTGAGGAGGCTGCGG + Intronic
1006614872 6:35319454-35319476 CGTGGGGGCGGAGGAGGAGGGGG - Intronic
1006645486 6:35512063-35512085 CGGGGTGGGGGAGGAGGGGGCGG - Intronic
1006817496 6:36862348-36862370 GGCTGTGGAGGAGGAGGCTGGGG - Intronic
1006907063 6:37539625-37539647 CTGTGAGGAGGAGGAGGAGGAGG + Intergenic
1006984283 6:38167002-38167024 TGGTGTGGCGGAGGAGGGGGAGG - Intergenic
1007371150 6:41427740-41427762 CGGGTGGGCGGAGGAGGAGGCGG + Intergenic
1007496520 6:42263492-42263514 TGTGGTGGCGGCGGAGGCGGAGG + Exonic
1007520894 6:42451483-42451505 TGGGGTGGTGGAGGAGGTGGTGG - Intronic
1007569606 6:42880098-42880120 CGCTGTGGCGGAGGAGGGAGGGG + Intronic
1007626068 6:43247063-43247085 CAGTGTGGCGGAGGAGGAAGAGG + Intronic
1007785234 6:44276027-44276049 CGCTGCGGCGGGGCAGGCGGCGG + Exonic
1008013321 6:46491187-46491209 CGATGCGCCGGCGGAGGCGGAGG + Exonic
1008160353 6:48068730-48068752 CGGAGTGGGTGGGGAGGCGGCGG - Intergenic
1008369184 6:50714135-50714157 GTGTGTGGCGGCGGCGGCGGTGG + Intronic
1008383426 6:50859570-50859592 AGGTGGGGGGGAGGAGGAGGAGG - Intergenic
1008572578 6:52829555-52829577 AGGTGTGGAGGGGGAGGCGCAGG - Intergenic
1011517130 6:88166586-88166608 CGCGGCGGCGGAGGAGGAGGAGG - Intergenic
1012457586 6:99424857-99424879 CATGGGGGCGGAGGAGGCGGGGG - Intronic
1013173994 6:107662121-107662143 CGGGGTGGCTGAGGAGGGGAAGG - Intergenic
1013507592 6:110815339-110815361 CGCCGTCGCGGAGGAGGAGGAGG - Intronic
1014755871 6:125301728-125301750 CGGCGTGGCGGACGCGGCGCAGG + Intronic
1014832703 6:126121846-126121868 CTGTGTGGCGGAGTGGGGGGTGG - Intergenic
1015220630 6:130801468-130801490 CGGGGTGGCGGCGGCGGTGGCGG + Intergenic
1015404898 6:132826020-132826042 TGGTGTTGGGGAGGAGGCAGTGG + Intergenic
1015603916 6:134936520-134936542 GGGTGTGGGGCAGGAGGGGGTGG + Intronic
1015935739 6:138404522-138404544 CGGGGCGGCCGAGGACGCGGCGG + Exonic
1016648199 6:146434413-146434435 AGGTGCTGCGGAGGTGGCGGGGG - Exonic
1016923483 6:149317918-149317940 CGTGGTGGCGGAGGCGACGGTGG + Intronic
1017164159 6:151391554-151391576 CGGCGCGGCGGCGGCGGCGGCGG + Intergenic
1017672010 6:156777815-156777837 CGGCGCGGCGGCGGCGGCGGCGG + Intergenic
1018091259 6:160348321-160348343 GGGTGGCGCGGGGGAGGCGGCGG + Exonic
1018727845 6:166627340-166627362 GGGCGGGGCGGAGGAGGAGGAGG - Intronic
1018876562 6:167826987-167827009 CGGCGCGGCCGCGGAGGCGGAGG + Exonic
1019275017 7:171633-171655 GGGTGTCGGGGAGGAGGCCGGGG - Intergenic
1019343560 7:519435-519457 CGGTGTGGCGGCGGCGGCGGCGG - Intronic
1019731506 7:2631922-2631944 CGGGGGTGCGGAGGGGGCGGCGG + Intergenic
1020046725 7:5046097-5046119 GGAGGTGGCGGAGGTGGCGGCGG + Exonic
1020137056 7:5593512-5593534 CGTCGTGGCGCAGGAAGCGGTGG - Exonic
1021594890 7:22304559-22304581 CCGAGTGGCGGAGAAGGAGGTGG + Intronic
1021721196 7:23506237-23506259 GGGGGTGGTGGAGGAGGCGGCGG - Exonic
1021958796 7:25852578-25852600 CGGGGGCGCGGAGGACGCGGGGG - Intergenic
1022113734 7:27246073-27246095 CGAGGCGGCGGCGGAGGCGGCGG - Exonic
1022207635 7:28179852-28179874 CGCAGTGGCGGCGGCGGCGGCGG + Intronic
1023000435 7:35801826-35801848 GGCTGTGGTGGAGGCGGCGGCGG + Intronic
1023000942 7:35807256-35807278 CGGGGAGGCGGAGGCTGCGGTGG - Intronic
1023638829 7:42238034-42238056 GGGAGGGGCGGAGGAGGAGGAGG - Intergenic
1024043860 7:45574556-45574578 CCGCGCGGCGGAGGCGGCGGCGG + Exonic
1024809593 7:53192236-53192258 CGGGGTGGCGGAGGCGGGGTGGG + Intergenic
1024957080 7:54933412-54933434 GAGAGTGGAGGAGGAGGCGGCGG + Intergenic
1024971728 7:55077989-55078011 GGGTGTGGAGGGGGAGGCAGTGG + Intronic
1025739056 7:64182058-64182080 CGCTGCGGGGGCGGAGGCGGAGG - Intronic
1026319339 7:69255348-69255370 CTGTGTGGAGGAGGAAGAGGAGG + Intergenic
1026472426 7:70705630-70705652 CTGTGGGGTGGAGGAGGCGAAGG - Intronic
1027043543 7:74976552-74976574 TGGTGAGGAGGAGGAGGAGGAGG - Intronic
1027121872 7:75527836-75527858 CGAAGTGGCGGCGGAGGCGAAGG - Intergenic
1027134798 7:75616579-75616601 GGGTGGGGAGGAGGAGGAGGAGG + Intronic
1028485565 7:91353664-91353686 CGGGGTGGGGGAGGTGGAGGGGG + Intergenic
1029629873 7:101743682-101743704 CGAGGAGGAGGAGGAGGCGGCGG - Intergenic
1029709774 7:102293261-102293283 CGGCATGGGGGAGGGGGCGGCGG - Intronic
1029738648 7:102479075-102479097 CGGGGTGGCGGGGGCGGGGGGGG - Intergenic
1030685699 7:112485023-112485045 GGGTGTGGTGGAGGGGGAGGGGG + Intronic
1033033216 7:137846764-137846786 CGGGCTGGCGGCGGCGGCGGCGG + Exonic
1033085358 7:138336325-138336347 CGGGGTGGCAGAGGAGGAAGAGG - Intergenic
1033689681 7:143724771-143724793 TGGAGTGGCGAAGGAGGTGGAGG - Exonic
1034402806 7:150876977-150876999 GGGTGGTGGGGAGGAGGCGGGGG - Intergenic
1034427010 7:151019242-151019264 TGGTGTAGCGCAGGATGCGGTGG + Exonic
1034441153 7:151086683-151086705 CGGCGCGGCGGAGGCGGCGGCGG - Intronic
1034462553 7:151205900-151205922 CTGTGGGGCTCAGGAGGCGGGGG - Intergenic
1034465639 7:151226999-151227021 CGGGGTGGGGGAGGACCCGGGGG - Intronic
1035035956 7:155893883-155893905 CAGTGGGGAGGAGGAGGCAGCGG - Intergenic
1035121633 7:156573203-156573225 GGGTGTGAGGGAGGAGGCCGAGG - Intergenic
1035282537 7:157787022-157787044 AGGTGCGGCGGGGGACGCGGGGG + Intronic
1035282555 7:157787067-157787089 GGGTGCGGCGGGGGACGCGGGGG + Intronic
1035282573 7:157787112-157787134 GGGTGCGGCGGGGGACGCGGGGG + Intronic
1035282591 7:157787157-157787179 GGGTGCGGCGGGGGACGCGGGGG + Intronic
1035303543 7:157915445-157915467 GTGTGTGGCGGGGAAGGCGGGGG - Intronic
1035612181 8:973901-973923 CGGGGTGGCGGCGGTGGCGGTGG - Intergenic
1035683644 8:1507607-1507629 CGCCGAGGCGGAGGAGGCGCCGG + Intronic
1035725726 8:1823975-1823997 CGGGGTCGCGGGGGACGCGGGGG + Exonic
1036295191 8:7529178-7529200 AGGAGTGGAGGAGGAGGAGGAGG - Intergenic
1036327379 8:7791840-7791862 AGGAGTGGAGGAGGAGGAGGAGG + Intergenic
1036528280 8:9556024-9556046 CTGAGTGGGGGAGGAGGTGGCGG - Exonic
1036708208 8:11060404-11060426 CGGGGCTGCGGAGGAGGCAGGGG - Intronic
1036763836 8:11533574-11533596 CTGTCTGCCGGAGGAGGAGGAGG + Intronic
1036941727 8:13058476-13058498 CTGTGGGGCGCTGGAGGCGGGGG - Intergenic
1037273908 8:17157119-17157141 GGGTGTGGCCGAGGCGGCGGCGG - Intronic
1037535229 8:19817438-19817460 CGCGGTGGCGGCGGCGGCGGCGG + Exonic
1038042628 8:23737970-23737992 GGGTGGGGAGGAGGAGGAGGAGG - Intergenic
1039457420 8:37716713-37716735 CAGTGAGGGGGAGGAGGAGGAGG + Intergenic
1039839994 8:41286357-41286379 TTGTGCGGCGGGGGAGGCGGTGG - Intronic
1039884369 8:41646905-41646927 GGGAGAGGGGGAGGAGGCGGCGG - Intronic
1040071922 8:43195611-43195633 GGGTGTGGAGGAGGATGGGGTGG + Intronic
1040071942 8:43195674-43195696 GGGTGTGGATGAGGAGGAGGAGG + Intronic
1041281085 8:56211551-56211573 CGGTGGGGCGGGGGAAGAGGGGG + Intergenic
1042130397 8:65582263-65582285 CTCTGTGGAGGAGGAGGAGGAGG + Intergenic
1042591823 8:70403866-70403888 CGGAGACGCGGAGGAGGAGGAGG - Intergenic
1042987956 8:74604447-74604469 AGGTGGGGTGGAGGAGGAGGAGG + Intronic
1042987957 8:74604450-74604472 TGGGGTGGAGGAGGAGGAGGAGG + Intronic
1045235628 8:100350752-100350774 CGAGGTGGAGGTGGAGGCGGAGG - Intronic
1045306010 8:100957243-100957265 CGGTGGGGCGGGGGAGGCTCAGG + Intergenic
1045582962 8:103499888-103499910 CGGAGGGGCGGAGGAGGTGCTGG + Intergenic
1046912101 8:119639601-119639623 GGGCGGGGCGGAGGAGGGGGCGG + Intronic
1047203242 8:122783043-122783065 CTGGGAGGCGGAGGAGGAGGTGG + Intronic
1047308182 8:123670194-123670216 AGGTGGGGAGGAGGAGGAGGAGG - Intergenic
1047812382 8:128424803-128424825 AGGAGTGGAGGAGGAGGAGGAGG - Intergenic
1048000942 8:130379234-130379256 AGGTATGGGGGAGGGGGCGGTGG - Intronic
1048214268 8:132480872-132480894 CGGGGCGGCGGCGGCGGCGGCGG + Exonic
1048329954 8:133464648-133464670 GTGTGTGCCGGAGGAGGCTGGGG + Intronic
1048581386 8:135732153-135732175 CCCTGTGGAGGTGGAGGCGGAGG - Intergenic
1049235019 8:141508089-141508111 CCGGGTCGCGGAGCAGGCGGCGG - Intergenic
1049405259 8:142449558-142449580 CGGGGAGGAGGAGGAGGCCGAGG - Exonic
1049583520 8:143423031-143423053 CTGGGAGGCGGAGGAGGTGGGGG - Intronic
1049718903 8:144106683-144106705 GGAGGTGGGGGAGGAGGCGGGGG - Intronic
1049783604 8:144440084-144440106 AGATGAGGAGGAGGAGGCGGAGG - Exonic
1049792636 8:144478992-144479014 GGGGGTGGAGGTGGAGGCGGGGG + Intronic
1050360854 9:4829692-4829714 CAGTGTGGCAGTGGTGGCGGTGG + Intronic
1050415991 9:5418514-5418536 GGGGGTGGCGGAGGAGGAGCAGG - Intronic
1051174220 9:14347232-14347254 CGAGGTGGGGGAGGAGGGGGCGG + Intronic
1051347180 9:16162652-16162674 TGGTGGGGGGGAGGGGGCGGGGG + Intergenic
1051774860 9:20622296-20622318 AGGGGGGGCGGAGGAGGGGGGGG - Exonic
1052048531 9:23821691-23821713 CGGAGAGGCGGTGGCGGCGGCGG + Intronic
1053000741 9:34576114-34576136 CTGTGTGTCTGAGGAGGCGGGGG - Intronic
1053016608 9:34665617-34665639 CGAGGTGGCGCTGGAGGCGGAGG - Exonic
1053173414 9:35906554-35906576 GGGTGTGGCGGGGGTGGTGGTGG - Exonic
1053475207 9:38377567-38377589 AGGTGTGGAGGAAGAGGCGCGGG + Intergenic
1054731426 9:68705606-68705628 CGGGAGGGCGGAGGGGGCGGCGG - Intronic
1055315246 9:75028171-75028193 GGCTGCGGGGGAGGAGGCGGTGG - Exonic
1056143573 9:83707680-83707702 GGCTGTGGCGGCGGCGGCGGCGG + Exonic
1056316302 9:85393798-85393820 TGGGGTGGGGGGGGAGGCGGAGG + Intergenic
1056350224 9:85741894-85741916 AGGCGAGGCGGAGGCGGCGGCGG + Intronic
1057053809 9:91946449-91946471 GGGTGTGGAAGAGGAGGAGGAGG + Intronic
1057173141 9:92975777-92975799 TGGTGAGGAGGAGGAGGAGGAGG + Intronic
1058745527 9:107986805-107986827 CTGTGTGGAGGATGAGGCGGAGG + Intergenic
1058745531 9:107986814-107986836 GGATGAGGCGGAGGAGGCTGGGG + Intergenic
1059483713 9:114611528-114611550 CGGGGTGGCGGCGGCGGCGGCGG + Exonic
1060106726 9:120877248-120877270 CGGGGAGGAGGGGGAGGCGGCGG + Exonic
1060263166 9:122093181-122093203 CGGAGCGGCGGCGGCGGCGGCGG - Exonic
1060355733 9:122905316-122905338 TGGTGAGGAGGAGGAGGAGGAGG - Intronic
1060770223 9:126326981-126327003 CGCTGGGGCGGCGGCGGCGGTGG - Exonic
1060823480 9:126674371-126674393 GGGTGGGGTGGAGGAGGCTGGGG + Intronic
1060894762 9:127210535-127210557 TAGTGTGGCCGAGGAGGCTGGGG + Intronic
1061128070 9:128689320-128689342 AGGGGAGGCGGAGGCGGCGGCGG - Intronic
1061128071 9:128689323-128689345 CGGAGGGGAGGCGGAGGCGGCGG - Intronic
1061200687 9:129136789-129136811 TGGTGGGCTGGAGGAGGCGGAGG + Intronic
1061242626 9:129383336-129383358 ACGGGTGGCGGGGGAGGCGGGGG + Intergenic
1061321615 9:129834672-129834694 CGGGGAGGAGGAGGAGGCGGCGG - Intronic
1061838996 9:133347045-133347067 GGGCGTGGCGAAGGTGGCGGCGG - Intronic
1061859464 9:133460463-133460485 CGGGGGGGCGGCGGGGGCGGGGG + Intronic
1062098324 9:134714266-134714288 GGTGGTGGCGGAGGAGGTGGTGG + Intronic
1062332245 9:136049903-136049925 CGGCGTGGCGGTGGCCGCGGGGG - Exonic
1062450140 9:136611735-136611757 CGGTGTGGCTGCGAAGTCGGAGG + Intergenic
1062507670 9:136886464-136886486 CGGAGCGGCGGCGGCGGCGGCGG + Intronic
1062533353 9:137011153-137011175 CCGTGGGGCGGGGAAGGCGGTGG - Intronic
1062551137 9:137087117-137087139 CGATGAGGCGGCGGCGGCGGCGG - Exonic
1062567314 9:137168958-137168980 CGGCGGTGCGGAGGCGGCGGCGG + Exonic
1062609374 9:137367151-137367173 CTGTGGGGCAGAGGAGGTGGGGG - Intronic
1062653542 9:137590470-137590492 CGCGGTGGCGGTGGCGGCGGCGG - Exonic
1203770909 EBV:49655-49677 GGCTGCGGCGGCGGAGGCGGCGG - Intergenic
1203524004 Un_GL000213v1:68937-68959 CGGGGTGGGGGTGGAGGTGGGGG - Intergenic
1203469804 Un_GL000220v1:111493-111515 CGGGGGGGCGGACGAGGAGGCGG - Intergenic
1203470165 Un_GL000220v1:112636-112658 CGGTGTGGTGGTGGGGGAGGAGG + Intergenic
1203470680 Un_GL000220v1:114192-114214 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
1203477625 Un_GL000220v1:155465-155487 CGGGGGGGCGGACGAGGAGGCGG - Intergenic
1203477986 Un_GL000220v1:156608-156630 CGGTGTGGTGGTGGGGGAGGAGG + Intergenic
1203478501 Un_GL000220v1:158164-158186 CGGGGCGGCGGCGGCGGCGGCGG + Intergenic
1185603552 X:1354839-1354861 TGGAGAGGAGGAGGAGGCGGGGG + Intronic
1185791022 X:2928522-2928544 TGGTGGGGCCGAAGAGGCGGGGG + Intronic
1186402852 X:9275540-9275562 TGGAGTGGCGGAGGACGGGGCGG + Intergenic
1186768055 X:12791449-12791471 CGCGGCGGCGGAGGAGGTGGCGG - Exonic
1186841044 X:13485000-13485022 CGGGGTGGGGGAGTTGGCGGGGG - Intergenic
1187181409 X:16946775-16946797 AGCTGAGGCCGAGGAGGCGGTGG + Exonic
1187357981 X:18596318-18596340 AGGTGTGGGGGTGGAGGTGGGGG + Intronic
1187363895 X:18651128-18651150 GGGTGTGGCGGGGGGTGCGGTGG - Intronic
1187518096 X:19990804-19990826 CGGGGTGGCGGATGGGGCAGCGG - Intergenic
1187975764 X:24703350-24703372 AGGTGGGGCGGAGGTGGGGGCGG + Intronic
1189054617 X:37685892-37685914 CTGTGTGGCTGTGGCGGCGGCGG - Exonic
1189333380 X:40156100-40156122 CGGTTTCTCGGAGGAGGGGGAGG - Intronic
1189785917 X:44558788-44558810 CTGGGAGGCGGAGGAGGTGGAGG - Intergenic
1190062218 X:47218923-47218945 GGCTGAGGAGGAGGAGGCGGCGG - Intronic
1190285374 X:48957714-48957736 CTCGGCGGCGGAGGAGGCGGCGG + Intronic
1190298668 X:49043320-49043342 TGGCTTAGCGGAGGAGGCGGCGG - Exonic
1190713624 X:53086763-53086785 CGGGGTGGGGGGGGTGGCGGGGG + Intronic
1190984430 X:55488530-55488552 GGGGGTGGCGGCGGGGGCGGGGG + Exonic
1191253555 X:58270401-58270423 CAGTGAGGCCGAGGAGGCTGGGG - Intergenic
1191979504 X:66910492-66910514 AGATGTGGCCGGGGAGGCGGTGG + Intergenic
1193420861 X:81280423-81280445 TGGTCTGGTGGAGGAGGTGGAGG - Intronic
1194077685 X:89417118-89417140 AGGTGTGGAGGGGGAGGCGCAGG + Intergenic
1195350281 X:103989169-103989191 TGGTGTGGCAGAGGCAGCGGGGG - Intergenic
1195803024 X:108734432-108734454 GGGGGTGGAGGAGGAGGTGGTGG + Exonic
1196085843 X:111681587-111681609 AGGAGGGGCGGAGGACGCGGAGG - Intronic
1197096561 X:122603826-122603848 CTGTGTGGTGGGGGAGGGGGAGG - Intergenic
1197203041 X:123765250-123765272 CCGAGTGGCGGCGGCGGCGGCGG - Intergenic
1198205354 X:134460237-134460259 CGGAGCAGAGGAGGAGGCGGAGG - Exonic
1198518552 X:137430461-137430483 CGGGGCGGGGGAGGGGGCGGGGG + Intergenic
1199091203 X:143694708-143694730 CTGTGTGGTGGTGGAGGAGGAGG - Intergenic
1199612694 X:149631604-149631626 GGGTGCGGGGGAGGAGGAGGAGG - Exonic
1199772396 X:150983435-150983457 CGCTGCGGCGGCGGCGGCGGCGG - Intronic
1200160365 X:154004667-154004689 TGGTGTGGAGGAGGAGGAGGAGG + Intergenic
1200173766 X:154097639-154097661 CGGCGCGGCGGCGGCGGCGGCGG + Exonic
1200256485 X:154585555-154585577 CCAGGTGGGGGAGGAGGCGGGGG + Intronic
1200261284 X:154618848-154618870 CCAGGTGGGGGAGGAGGCGGGGG - Intronic