ID: 1135747767

View in Genome Browser
Species Human (GRCh38)
Location 16:25031878-25031900
Sequence TCCCTCTGTCTAGTGGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 1, 2: 3, 3: 7, 4: 265}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135747767_1135747771 8 Left 1135747767 16:25031878-25031900 CCCATGGCCACTAGACAGAGGGA 0: 1
1: 1
2: 3
3: 7
4: 265
Right 1135747771 16:25031909-25031931 TCACCTCCTGCTTTTCCACCTGG 0: 1
1: 0
2: 15
3: 96
4: 864
1135747767_1135747774 21 Left 1135747767 16:25031878-25031900 CCCATGGCCACTAGACAGAGGGA 0: 1
1: 1
2: 3
3: 7
4: 265
Right 1135747774 16:25031922-25031944 TTCCACCTGGAATTGCGACGCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1135747767_1135747775 22 Left 1135747767 16:25031878-25031900 CCCATGGCCACTAGACAGAGGGA 0: 1
1: 1
2: 3
3: 7
4: 265
Right 1135747775 16:25031923-25031945 TCCACCTGGAATTGCGACGCGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1135747767_1135747778 30 Left 1135747767 16:25031878-25031900 CCCATGGCCACTAGACAGAGGGA 0: 1
1: 1
2: 3
3: 7
4: 265
Right 1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG 0: 1
1: 0
2: 0
3: 0
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135747767 Original CRISPR TCCCTCTGTCTAGTGGCCAT GGG (reversed) Intergenic
900435009 1:2625918-2625940 TTCCTCTGTCCACTGGTCATAGG - Intronic
901023246 1:6265610-6265632 TCACTCTGTCTTGTGGCCCCTGG + Intronic
901686154 1:10944703-10944725 TCCCTCTGTCTCGTCTCCAAGGG + Intergenic
904435597 1:30492783-30492805 TTTCTCTGTCCAGTGCCCATAGG + Intergenic
907230584 1:52995030-52995052 CCCCTCTATGTAGTGGCCTTTGG - Intronic
907253087 1:53156261-53156283 TCCCTCTGCCTCGTGCCCCTCGG + Intergenic
910510097 1:87993839-87993861 TCCCTCTGTCTACTGCACAAAGG + Intergenic
911317269 1:96370370-96370392 TCACTCTGTCTTATGGCCCTTGG + Intergenic
913733594 1:121746160-121746182 TCATTCTGTCTAGTTTCCATAGG - Intergenic
913733834 1:121750576-121750598 TCATTCTGTCTAGTTTCCATAGG - Intergenic
913790962 1:122525677-122525699 TCATTCTGTCTAGTTTCCATAGG - Intergenic
913792431 1:122552537-122552559 TCCTTCTGTCTAGTTTCTATAGG - Intergenic
913792718 1:122557635-122557657 TCACTCTGTCTAGTTTCTATAGG - Intergenic
913794814 1:122595044-122595066 TCACTCTGTCTAGTTTCTATAGG - Intergenic
913798573 1:122661672-122661694 TCATTCTGTCTAGTGTCTATAGG - Intergenic
913800476 1:122696360-122696382 TCATTCTGTCTAGTTTCCATAGG - Intergenic
913803217 1:122745986-122746008 TCATTCTGTCTAGTTTCCATAGG - Intergenic
913811097 1:122887761-122887783 TCATTCTGTCTAGTGTCTATAGG - Intergenic
913811151 1:122888781-122888803 TCATTCTGTCTAGTTTCCATAGG - Intergenic
913814214 1:122943868-122943890 TCATTCTGTCTAGTTTCCATAGG - Intergenic
913822323 1:123088307-123088329 TCACTCTGTCTAGTTTCTATAGG - Intergenic
913823707 1:123113290-123113312 TCACTCTGTCTAGTTTCTATAGG - Intergenic
913836205 1:123336924-123336946 TCACTCTGTCTAGTTTCTATAGG - Intergenic
913837531 1:123360706-123360728 TCATTCTGTCTAGTTTCCATAGG - Intergenic
913840618 1:123416093-123416115 TCACTCTGTCTAGTGTTTATAGG - Intergenic
913843132 1:123460784-123460806 TCACTCTGTCTAGTTTCTATAGG - Intergenic
913844212 1:123480497-123480519 TCATTCTGTCTAGTTTCCATAGG - Intergenic
913849358 1:123573631-123573653 TCACTCTGTCTAGTTTCTATAGG - Intergenic
913855149 1:123677645-123677667 TCACTCTGTCTAGTTTCTATAGG - Intergenic
913856333 1:123699059-123699081 TCACTCTGTCTAGTTTCTATAGG - Intergenic
913858401 1:123736274-123736296 TCACTCTGTCTAGTTTCTATAGG - Intergenic
913861408 1:123789307-123789329 TCACTCTGTCTAGTTTCTATAGG - Intergenic
913868689 1:123920312-123920334 TCATTCTGTCTAGTTTCCATAGG - Intergenic
913869071 1:123927109-123927131 TCATTCTGTCTAGTGTCTATAGG - Intergenic
913869092 1:123927449-123927471 TCACTCTGTCTAGTTTCTATAGG - Intergenic
913873446 1:124005956-124005978 TCACTCTGTCTAGTTTCTATAGG - Intergenic
913881113 1:124142883-124142905 TCATTCTGTCTAGTTTCCATAGG - Intergenic
913887432 1:124256011-124256033 TCACTCTGTCTAGTTTCTATAGG - Intergenic
913888861 1:124281335-124281357 TCACTCTGTCTAGTTTCTATAGG - Intergenic
913894606 1:124384355-124384377 TCACTCTGTCTAGTTTCTATGGG - Intergenic
913897374 1:124434149-124434171 TCACTCTGTCTAGTTTCTATAGG - Intergenic
913906410 1:124595926-124595948 TCATTCTGTCTAGTTTCCATAGG - Intergenic
913909272 1:124647594-124647616 TCACTCTGTCTAGTTTCTATAGG - Intergenic
913915071 1:124751599-124751621 TCATTCTGTCTAGTTTCCATAGG - Intergenic
913915482 1:124758741-124758763 TCACTCTGTCTAGTTTCTATAGG - Intergenic
917276540 1:173337511-173337533 TTCCTCTGTCAACTGGTCATTGG - Intergenic
918446492 1:184622334-184622356 TCCAGCTGCCTAGTGGCCAGTGG + Exonic
1064441668 10:15359498-15359520 ACCCTCTGTCCAATGGCCAGAGG - Intronic
1065857482 10:29842131-29842153 GCCCTCTGTTTGGTTGCCATGGG + Intergenic
1071364428 10:84884191-84884213 TCCCTCTGTCAACTGATCATAGG + Intergenic
1072301421 10:94065841-94065863 TGACTCTGTCAAATGGCCATGGG - Intronic
1074154642 10:110787474-110787496 TGGCTCTGTCTGCTGGCCATAGG + Intronic
1077555124 11:3222299-3222321 TTCCCCTGTCTAAGGGCCATTGG + Intergenic
1077894056 11:6440715-6440737 TCCCTAGGACTAGTGCCCATGGG - Exonic
1080008169 11:27431102-27431124 TTCCTCTGTCTAGTTATCATTGG + Intronic
1081609103 11:44548194-44548216 TTCCTCTGTCAACTGACCATAGG - Intergenic
1085483688 11:76843676-76843698 CTCCTCTGTCTAGTGGAAATAGG - Intergenic
1086141594 11:83505887-83505909 TTCCTCTGTCTACTGATCATAGG + Intronic
1089651775 11:119919276-119919298 TGCCACTCTCTAGTTGCCATAGG - Intergenic
1090481504 11:127072854-127072876 TCCCTCTGTCTTGTCGACAGTGG + Intergenic
1091859347 12:3765427-3765449 TCCCTCTGTCCTGTTGTCATTGG - Intergenic
1092180353 12:6442672-6442694 TCCTTTTGTCTAGAGGCCCTGGG - Intergenic
1095528283 12:43154035-43154057 TCCCTCTCTTTACTGCCCATTGG + Intergenic
1096684174 12:53276955-53276977 TCCCTTCATCTTGTGGCCATGGG + Intronic
1097821307 12:64131588-64131610 TTCCTCTGTCAAGTGATCATAGG + Intronic
1098998598 12:77150297-77150319 TCCCTCTGTTTACTGGACACAGG + Intergenic
1099017854 12:77366253-77366275 TACCTCAGTATAGTGGCCCTTGG - Intergenic
1099508610 12:83507504-83507526 TTCCTCTGTCAACTGGTCATAGG - Intergenic
1105097352 13:16393545-16393567 TGTTTCTGTCTAGTGGTCATGGG - Intergenic
1105098697 13:16415384-16415406 TGCTTCTGTCTAGTGGTTATGGG - Intergenic
1105102437 13:16476422-16476444 TGCTTCTGTCTAGTGGTTATGGG - Intergenic
1105108862 13:16581324-16581346 TCTTTCTGTCTAGTGGTTATGGG - Intergenic
1105109880 13:16597695-16597717 TGCTTCTGTCTAGTGGTTATGGG - Intergenic
1105110706 13:16611332-16611354 TGCTTCTGTCTAGTGGTTATGGG - Intergenic
1105111368 13:16622250-16622272 TGCTTCTGTCTAGTGGTTATGGG - Intergenic
1105112909 13:16648012-16648034 TGTTTCTGTCTAGTGGCTATGGG - Intergenic
1105117701 13:16725765-16725787 TGCTTCTGTCTAGTGGTTATGGG - Intergenic
1105127551 13:16886436-16886458 TGCTTCTGTCTAGTGGTTATGGG - Intergenic
1105132459 13:16966930-16966952 TTTATCTGTCTAGTGGCTATGGG - Intergenic
1105138527 13:17066184-17066206 TGCTTCTGTCTAGTGGTTATGGG - Intergenic
1105146894 13:17202291-17202313 TCTTTCTGTCTAGTGGTTATGGG - Intergenic
1105154812 13:17331932-17331954 TGCTTCTGTCTAGTGGTTATGGG - Intergenic
1105156504 13:17359407-17359429 TGCTTCTGTCTAGTGGTTATGGG - Intergenic
1105158925 13:17398806-17398828 TGCTTCTGTCTAGTGGTTATGGG - Intergenic
1105159175 13:17402900-17402922 TGCTTCTGTCTAGTGGTTATGGG - Intergenic
1105198636 13:18020481-18020503 TCCTTCTGTCTAGTTTTCATGGG - Intergenic
1105279101 13:18952933-18952955 TCCACCTGTCTGCTGGCCATGGG - Intergenic
1107828626 13:44353701-44353723 TCCTTCTGGCTAGTGGGCACGGG + Intergenic
1108716501 13:53084098-53084120 AACCTCTGTCTAGTGGACAATGG - Intergenic
1113173194 13:107529879-107529901 TCCCTTCATCTAGTGGCCATGGG + Intronic
1114001882 14:18262258-18262280 TCCTTCTGTCTAGTTTCTATGGG + Intergenic
1114257212 14:21013296-21013318 TCCCCCTTGCTAGTGGCAATGGG - Intergenic
1117473439 14:56069832-56069854 TCCCTCTTCCCAGTGGCAATTGG - Intergenic
1117634180 14:57724690-57724712 TTCCTCTGTCAACTGACCATAGG - Intronic
1119034759 14:71220203-71220225 TGCCTCTGTTGAGTGTCCATGGG + Intergenic
1120101691 14:80451669-80451691 TCTCTCTGTCCTGTTGCCATGGG + Intergenic
1120997702 14:90428867-90428889 TCCTTCTGTCTCCTTGCCATTGG - Intergenic
1126777836 15:52114365-52114387 TCCCTCAGTCAACTGGACATAGG - Intergenic
1131471883 15:92704667-92704689 TCCCTATGTGTAATTGCCATAGG + Intronic
1132414970 15:101613235-101613257 TACCTTTCTCTAGTGGCCCTCGG + Intergenic
1135747767 16:25031878-25031900 TCCCTCTGTCTAGTGGCCATGGG - Intergenic
1135757723 16:25111881-25111903 TCCCTCTGCCTAGTGGCCATGGG - Exonic
1137097770 16:36331887-36331909 TCCTTCTGTCTAGTTTTCATGGG - Intergenic
1138152745 16:54674276-54674298 CCCCTCAGTCTAGTGGATATTGG + Intergenic
1140481319 16:75264384-75264406 TCCCTCTGCCCAGTGCCCACAGG + Exonic
1143666987 17:8368486-8368508 CTCCTTTCTCTAGTGGCCATCGG - Intergenic
1144454997 17:15411678-15411700 TTGCTCTGTCTTGTGGCCTTTGG + Intergenic
1146310613 17:31765552-31765574 TCCCTCAGCATAGTGGACATGGG - Intergenic
1149851656 17:60039904-60039926 GCCCTCTGTCTAGCCCCCATGGG - Intergenic
1152431030 17:80248418-80248440 TCCCACTGTGTGGGGGCCATGGG + Intronic
1154550321 18:15671957-15671979 TGCTTCTGTCTAGTTGGCATGGG - Intergenic
1154561303 18:15832277-15832299 TGCTTCTGTCTAGTTGCTATGGG - Intergenic
1154565941 18:15896407-15896429 TGCCTCTGTCTAGTTGTTATGGG - Intergenic
1154618734 18:16619266-16619288 TGCCTCTGTCTAGTTGTTATGGG - Intergenic
1154637238 18:16873061-16873083 TGCCTCTGTCTAGTTGTTATGGG - Intergenic
1154664870 18:17252327-17252349 TGCCTCTGTCTAGTTGTTATGGG - Intergenic
1154670626 18:17330844-17330866 TGCTTCTGTCTAGTTGCTATGGG - Intergenic
1154681429 18:17478457-17478479 TGCTTCTGTCTAGTGGTTATGGG - Intergenic
1154682304 18:17490334-17490356 TCCTTCTGTCTAGTTGTTATGGG - Intergenic
1154704311 18:17792277-17792299 TGCTTCTGTCTAGTTGCTATGGG - Intergenic
1154713453 18:17917957-17917979 TGCTTCTGTCTAGTGGTTATGGG - Intergenic
1154731446 18:18164198-18164220 TGCCTCTGTCTAGTTGTTATGGG - Intergenic
1154733528 18:18192863-18192885 TGCTTCTGTCTAGTTGCTATGGG - Intergenic
1154740119 18:18283097-18283119 TCCTTCTGTCTAGTTGTTATGGG - Intergenic
1154743002 18:18322282-18322304 TGCCTCTGTCTAGTTGTTATGGG - Intergenic
1154747340 18:18381817-18381839 TGCCTCTGTCTAGTTGTTATGGG - Intergenic
1154756900 18:18513488-18513510 TGCTTCTGTCTAGTTGCTATGGG - Intergenic
1154761975 18:18582507-18582529 TGCTTCTGTCTAGTTGCTATGGG - Intergenic
1154807971 18:19214393-19214415 TCCTTCTGTCTAGTTGTTATGGG - Intergenic
1154813808 18:19294781-19294803 TCCTTCTGTCTAGTTGTTATGGG - Intergenic
1154814203 18:19300208-19300230 TGCTTCTGTCTAGTTGCTATGGG - Intergenic
1154850645 18:19802604-19802626 TGCTTCTGTCTAGTTGCTATGGG - Intergenic
1154855722 18:19873156-19873178 TGCTTCTGTCTAGTGGTTATGGG - Intergenic
1154859526 18:19925541-19925563 TGCTTCTGTCTAGTTGCTATGGG - Intergenic
1157792748 18:50547026-50547048 TACCTCTGTCTTTTGGCAATAGG + Intergenic
1159618790 18:70613084-70613106 TTCCTATGCTTAGTGGCCATGGG + Intergenic
1160856868 19:1221683-1221705 TCCATCTGCCCAGTGGCCTTGGG + Intronic
1161242390 19:3229564-3229586 TCCCTGCGTCTTGTGGCCTTGGG + Intronic
1164518829 19:28961166-28961188 TGCCTCTGGGTAGGGGCCATAGG - Intergenic
1164521993 19:28986431-28986453 TCTTACTGTCTAGTGGCCACAGG - Intergenic
1165072271 19:33262207-33262229 TCCCTCTGTCTCCTGACCTTGGG + Intergenic
1168137563 19:54361514-54361536 TCCCTCTGGAAAGTGGCCCTGGG - Intronic
925938835 2:8795221-8795243 TCCCAATGTCTACTGGCCACAGG + Intronic
930239083 2:48917133-48917155 TCACTCTGTCCATTGGCCGTAGG - Intergenic
934472044 2:94555433-94555455 TCCTTCTGTCTAGTTTCTATGGG + Intergenic
938534409 2:132223453-132223475 TCCTTCTGTCTAGTTTCTATGGG - Intronic
938891858 2:135713256-135713278 TTCATCTGTTTAATGGCCATTGG - Intronic
938993605 2:136654758-136654780 TCCTTCTATCTACTGGCCAAAGG + Intergenic
1169068376 20:2707172-2707194 TCCCCCAGCCCAGTGGCCATGGG - Intronic
1169301871 20:4449469-4449491 TATCTCTGAATAGTGGCCATAGG + Intergenic
1171586626 20:26533907-26533929 TGCTTCTGTCTAGTTGCTATGGG - Intergenic
1171639765 20:27333033-27333055 TCCTTCTGTCTAGTTTTCATGGG - Intergenic
1171686268 20:28030246-28030268 TCCTTCTGTCTAGTTTTCATGGG - Intergenic
1172056918 20:32160432-32160454 TCCCTCTGGGAACTGGCCATTGG + Intronic
1173773509 20:45684166-45684188 TCTCTCTCTCTTGTGGCCTTAGG + Intergenic
1173886163 20:46461010-46461032 TGCCTCTGTCTACTGCCAATTGG - Intergenic
1175446481 20:59023732-59023754 TCCCTCCGTGTAGTGGCCTTTGG - Exonic
1179335334 21:40446375-40446397 TCCTTGTGCCCAGTGGCCATAGG - Intronic
1180426387 22:15193053-15193075 TCCTTCTGTCTAGTTTCTATGGG + Intergenic
1180503197 22:15958396-15958418 TTCCTCTGTCTAGTTTTCATGGG + Intergenic
1182831823 22:33310402-33310424 TCCCTCTGTCCCTTTGCCATTGG + Intronic
1203335378 22_KI270739v1_random:64116-64138 TTCCTCTGTCTAGTTTTCATGGG - Intergenic
952605394 3:35141698-35141720 TTCCTCTGTCAACTGGTCATAGG + Intergenic
953404464 3:42653769-42653791 TCCCTCTGTCTCCTGGCCCTGGG + Exonic
953849253 3:46453580-46453602 TCACTTTCTCTAGTGGCCCTGGG + Intronic
954942956 3:54391863-54391885 TCCCTCTTTCTGGTGGCCTGTGG + Intronic
961618061 3:128199493-128199515 TCACTCTGTTTAGTGGCTGTAGG + Intronic
961640761 3:128363544-128363566 TCCCTCTTCCCAGGGGCCATAGG - Intronic
963258650 3:143171373-143171395 TGCCTCTCTCTAGTGGCCTCAGG + Intergenic
963312268 3:143721860-143721882 TACCTCTGTCTGATGTCCATTGG - Intronic
966386792 3:179407835-179407857 TCCCTCTGTCTGGAGGGGATAGG - Intronic
966445736 3:179998873-179998895 TTCCTCTGTCAACTGACCATAGG - Intronic
973093317 4:46165308-46165330 TCTCTCTGTGTACTGGACATCGG + Intergenic
973788851 4:54360096-54360118 TGCTTTTCTCTAGTGGCCATTGG - Intergenic
974335978 4:60544815-60544837 TCCCTCATTCTAGTTGCCCTAGG + Intergenic
975632302 4:76416184-76416206 GCCCCCTGTCCAGTGGACATGGG + Intronic
977204755 4:94155951-94155973 TTCCTCTGTCAACTGGCCATAGG - Intergenic
977898751 4:102394902-102394924 TTCCTCTGTCAACTGGTCATAGG - Intronic
989919280 5:49778024-49778046 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989919429 5:49780240-49780262 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989919737 5:49784671-49784693 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989921090 5:49804609-49804631 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989921402 5:49809039-49809061 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989921555 5:49811255-49811277 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989922447 5:49824372-49824394 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989922742 5:49828799-49828821 TGCCTCTGTCTAGTTGTTATAGG - Intergenic
989923469 5:49839867-49839889 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989927369 5:49897273-49897295 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989927674 5:49901702-49901724 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989927962 5:49905960-49905982 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989928863 5:49919243-49919265 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989929157 5:49923670-49923692 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989929306 5:49925883-49925905 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989930017 5:49936783-49936805 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989930463 5:49943427-49943449 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989931204 5:49954498-49954520 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989931951 5:49965571-49965593 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989932701 5:49976640-49976662 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989933002 5:49981071-49981093 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989933465 5:49987713-49987735 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989933748 5:49992142-49992164 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989934650 5:50005435-50005457 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989934802 5:50007653-50007675 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989934947 5:50009867-50009889 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989935537 5:50018729-50018751 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
989936446 5:50032017-50032039 TGCTTCTGTCTAGTTGTCATAGG - Intergenic
993387286 5:87275121-87275143 TCTCTCTCTTTACTGGCCATTGG + Intronic
993573565 5:89572703-89572725 CCCCTCTGTCTCCTGGCCCTGGG - Intergenic
994112209 5:96019413-96019435 TCCCTCTGTATTATAGCCATTGG + Intergenic
996432631 5:123398561-123398583 CCCCTCTGTGTAGTCCCCATGGG + Intronic
997581440 5:135019844-135019866 ACCCTCTGTCAAGCGGGCATTGG - Intergenic
999261061 5:150239226-150239248 TGCCTCTGTCTAGGGTCCAGTGG - Intronic
1000089578 5:157918653-157918675 TCCCTCTGCCTTGTGCCCTTCGG - Intergenic
1000651688 5:163825984-163826006 TCCCTTTGTCTTGTGGCAATTGG + Intergenic
1002279565 5:178122486-178122508 TCCCACTGACCACTGGCCATGGG - Exonic
1003097602 6:3154874-3154896 TCCCTCTGTGTAGTGGCCCTTGG + Exonic
1003101188 6:3177593-3177615 TCCCTCTGTGTAGTGGCCCTTGG + Intergenic
1003107142 6:3225762-3225784 TCCCTCTGTGTAGTGGCCCTTGG + Exonic
1004362844 6:14986366-14986388 TCCCTCTGTCTTATGCCCCTCGG - Intergenic
1005965449 6:30723367-30723389 GCCCTCTGTGTAGTGGCCTTTGG - Exonic
1007188429 6:39993119-39993141 CCCTTCTGTGTAGTGGCCTTTGG - Intergenic
1007434447 6:41798725-41798747 TCCCTCTGTGTTGTAGCAATAGG + Exonic
1007953970 6:45899663-45899685 TCTGTCTGTGGAGTGGCCATGGG + Exonic
1009336825 6:62501522-62501544 TCCCTCCATCTGGAGGCCATAGG + Intergenic
1011698002 6:89930564-89930586 TCCCTCGCTCCAGTGGCCTTGGG - Exonic
1012225782 6:96701937-96701959 TCACTTTGTCTAGTGACCTTAGG - Intergenic
1013175423 6:107672845-107672867 CTCCTCAGTCTAGTGGCCTTGGG - Intergenic
1019061966 6:169263221-169263243 TCCCTCTGGATCCTGGCCATGGG + Intergenic
1019133502 6:169894134-169894156 GCTCTGTGTCTAGTGGCCACCGG + Intergenic
1019501718 7:1368213-1368235 CCCATCTGTCAAGTGGCCACGGG + Intergenic
1023108375 7:36785481-36785503 TTCCACTGTCTACAGGCCATTGG - Intergenic
1023541690 7:41273044-41273066 TCCTTCTGTCACGTGGCCTTTGG - Intergenic
1023823103 7:43990973-43990995 TCCCTCTGTCATGTGGACCTGGG - Intergenic
1023888005 7:44374692-44374714 CCCCTTTATCTAGTGGCCAAGGG + Intergenic
1024661536 7:51500067-51500089 TCCCTCTGGCTTGTGGTCACTGG + Intergenic
1025041023 7:55645923-55645945 CCCCTCTGTGTAGTGGCATTTGG - Intergenic
1029751367 7:102544411-102544433 TCCCTCTGTCATGTGGACCTGGG - Intronic
1029769319 7:102643505-102643527 TCCCTCTGTCATGTGGACCTGGG - Intronic
1029961299 7:104691363-104691385 TCCCTCTGTCAACTGATCATAGG - Intronic
1031682083 7:124687672-124687694 TTCCTCTGTCAACTGACCATAGG - Intergenic
1032078947 7:128849168-128849190 TCTCTCTTTCCAGTGTCCATTGG + Exonic
1034511827 7:151541892-151541914 TCCCCCTGTCACGTGGCGATTGG + Intergenic
1034567096 7:151924115-151924137 TCCCTCGGTCCAGTGGCCCAGGG - Intergenic
1035327258 7:158073199-158073221 TGCTTCTGTCGAGTTGCCATGGG + Intronic
1038563586 8:28601089-28601111 ACCCTCTGCCTAGTAGCCAGGGG - Intronic
1038757149 8:30352312-30352334 GCCCTCTGTGTAGTGGCCTTTGG - Intergenic
1040143052 8:43949116-43949138 TCCTTCTGTCTAGTTTTCATAGG - Intergenic
1040150368 8:44109702-44109724 TGCTTCTGTCTAGTTTCCATAGG - Intergenic
1040177954 8:44518043-44518065 TGCTTCTGTCTAGTTTCCATAGG - Intergenic
1040180861 8:44561231-44561253 TGCTTCTGTCTAGTTTCCATAGG - Intergenic
1040182068 8:44579068-44579090 TGCTTCTGTCTAGTTTCCATAGG - Intergenic
1040182152 8:44580261-44580283 TGCTTCTGTCTAGTTTCCATAGG - Intergenic
1040191792 8:44722896-44722918 TGCTTCTGTCTAGTTTCCATAGG - Intergenic
1040192297 8:44730381-44730403 TGCTTCTGTCTAGTTTCCATAGG - Intergenic
1040194028 8:44755889-44755911 TGCTTCTGTCTAGTTTCCATAGG - Intergenic
1040215644 8:45076330-45076352 TGCTTCTGTCTAGTTTCCATAGG - Intergenic
1040232303 8:45322114-45322136 TGCTTCTGTCTAGTTTCCATAGG - Intergenic
1040232671 8:45327560-45327582 TGCTTCTGTCTAGTTTCCATAGG - Intergenic
1040234204 8:45350104-45350126 TGCTTCTGTCTAGTTTCCATAGG - Intergenic
1040236143 8:45378633-45378655 TGCTTCTGTCTAGTTTCCATAGG - Intergenic
1040249086 8:45569569-45569591 TGCTTCTGTCTAGTTTCCATAGG - Intergenic
1040251526 8:45605573-45605595 TGCTTCTGTCTAGTTTCCATAGG - Intergenic
1040267111 8:45835705-45835727 TCCTTCTGTCTAGTTTCTATAGG - Intergenic
1040271711 8:45955319-45955341 TCCTTCTGTCTAGTTTTCATAGG - Intergenic
1040803724 8:51371016-51371038 TTGCTCCGTGTAGTGGCCATGGG - Intronic
1041377043 8:57215743-57215765 TCCCTCTGCCTTGTGCCCCTCGG - Intergenic
1044343968 8:91081488-91081510 CCCCTCTGTTTTGTGGCCACAGG + Intronic
1058861637 9:109122410-109122432 TCACTGAGTCTAGTGCCCATCGG + Intergenic
1058976432 9:110129061-110129083 TACCTCTGGCAAGTGGCCAGAGG + Intronic
1060416274 9:123432858-123432880 TCCCTCTGCCTGGTGGCACTGGG + Intronic
1186585502 X:10869022-10869044 TCCCTCTGTCCAATGGCAAGGGG - Intergenic
1190767159 X:53484870-53484892 TTCCTCAGTCAAGTGGTCATAGG + Intergenic
1191941214 X:66483553-66483575 TTCCTCTGTAAAGTGGTCATAGG + Intergenic
1194179554 X:90695626-90695648 TCTCTCTGTCAAGTGATCATAGG + Intergenic
1199275677 X:145939447-145939469 TCACTCTGTCTAGTGAACTTAGG - Intergenic
1199555981 X:149109268-149109290 TACCTCTGGGTAGAGGCCATAGG - Intergenic
1200526214 Y:4277799-4277821 TCTCTCTGTCAAGTGATCATAGG + Intergenic