ID: 1135747768

View in Genome Browser
Species Human (GRCh38)
Location 16:25031879-25031901
Sequence CTCCCTCTGTCTAGTGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 189}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135747768_1135747774 20 Left 1135747768 16:25031879-25031901 CCATGGCCACTAGACAGAGGGAG 0: 1
1: 0
2: 1
3: 12
4: 189
Right 1135747774 16:25031922-25031944 TTCCACCTGGAATTGCGACGCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1135747768_1135747771 7 Left 1135747768 16:25031879-25031901 CCATGGCCACTAGACAGAGGGAG 0: 1
1: 0
2: 1
3: 12
4: 189
Right 1135747771 16:25031909-25031931 TCACCTCCTGCTTTTCCACCTGG 0: 1
1: 0
2: 15
3: 96
4: 864
1135747768_1135747779 30 Left 1135747768 16:25031879-25031901 CCATGGCCACTAGACAGAGGGAG 0: 1
1: 0
2: 1
3: 12
4: 189
Right 1135747779 16:25031932-25031954 AATTGCGACGCGGGCGACGAGGG 0: 1
1: 0
2: 0
3: 0
4: 6
1135747768_1135747778 29 Left 1135747768 16:25031879-25031901 CCATGGCCACTAGACAGAGGGAG 0: 1
1: 0
2: 1
3: 12
4: 189
Right 1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG 0: 1
1: 0
2: 0
3: 0
4: 18
1135747768_1135747775 21 Left 1135747768 16:25031879-25031901 CCATGGCCACTAGACAGAGGGAG 0: 1
1: 0
2: 1
3: 12
4: 189
Right 1135747775 16:25031923-25031945 TCCACCTGGAATTGCGACGCGGG 0: 1
1: 0
2: 0
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135747768 Original CRISPR CTCCCTCTGTCTAGTGGCCA TGG (reversed) Intergenic
900429870 1:2596434-2596456 CTCCCTCTGTCTGGTGAGCTGGG + Intronic
901686153 1:10944702-10944724 TTCCCTCTGTCTCGTCTCCAAGG + Intergenic
901824003 1:11848649-11848671 CTCCATCGGTCAAGTTGCCACGG - Intergenic
902113507 1:14102536-14102558 CTTCCTCCGTCCAATGGCCATGG + Intergenic
902470691 1:16646140-16646162 GTGCCTCTGTGTAGTGGCCCAGG - Intergenic
902488113 1:16761320-16761342 GTGCCTCTGTGTAGTGGCCCAGG + Intronic
902752246 1:18525044-18525066 CTCCCTGTGTCTTGTCCCCAGGG - Intergenic
902816399 1:18918945-18918967 CTCCCTCTCACTTGTGTCCAAGG - Intronic
904545144 1:31264289-31264311 CTCCATCTGTCTAGACTCCATGG + Intronic
904920632 1:34005209-34005231 CTCCCTCTGCCTCTTGGCCAAGG - Intronic
905474692 1:38217772-38217794 CTCCCCCAGCCCAGTGGCCAAGG - Intergenic
907593798 1:55701264-55701286 CTTCCTTTGTCTATTTGCCAAGG + Intergenic
907854712 1:58291257-58291279 CTCCCCCTGTCTCCAGGCCATGG - Intronic
908458140 1:64323993-64324015 CTCCCACTGTCCCGTGGGCAGGG + Intergenic
914489390 1:148141840-148141862 CTGCTTCTGTCTTGTGGGCAGGG - Intronic
915490970 1:156249895-156249917 CTCCCTCTGTCTAGCTTCCAGGG - Exonic
916656511 1:166881089-166881111 CTCCTTCTTTACAGTGGCCAGGG + Intergenic
917632759 1:176905991-176906013 ATCCCTCGGCCTAGTGGCCATGG - Intronic
921030029 1:211328369-211328391 CTGCCTCTGTCCAGGAGCCAGGG - Intronic
921195677 1:212754990-212755012 CTCCCTCTGTCTAGTAGGTTTGG - Intronic
922756670 1:228100839-228100861 CTCCCTCTGTGTCCTGCCCATGG - Exonic
924142607 1:241041559-241041581 TTCTCCCTGTCTAGTGGCAAAGG + Intronic
1066662291 10:37748309-37748331 CTTCCTCTGTATGGTGTCCAAGG - Intergenic
1067945799 10:50687217-50687239 CTCCCTTTGTCACTTGGCCAAGG - Intergenic
1069888925 10:71641001-71641023 CTCCCTCAGTCTGGTCTCCATGG + Intronic
1072301422 10:94065842-94065864 CTGACTCTGTCAAATGGCCATGG - Intronic
1072410254 10:95195577-95195599 CTCCCTCTGTCAAGTGGGGCTGG + Intronic
1073190601 10:101648059-101648081 ATCCCTTTGCCTAGTGGACAGGG - Intronic
1073198047 10:101711132-101711154 CCCCATCTTTCAAGTGGCCAAGG - Intergenic
1073549228 10:104382144-104382166 TTCCCTTTGTCCAGAGGCCAGGG - Intronic
1074219476 10:111422128-111422150 CTCCCTCTCTCTTCTGGCCGTGG + Intergenic
1075644012 10:124085890-124085912 CTCCCCCTCTCCAGTGGCCGGGG + Intronic
1077058943 11:609400-609422 CTCCCTCTGGATGGCGGCCACGG - Exonic
1077894057 11:6440716-6440738 CTCCCTAGGACTAGTGCCCATGG - Exonic
1077909005 11:6558193-6558215 CTGCTTCTGTGTACTGGCCAGGG - Exonic
1083393463 11:62372314-62372336 CAGCGTCTGTCTAGTTGCCAAGG - Intronic
1086076917 11:82864547-82864569 CTGCCTCTGCCTTGTGACCATGG - Intronic
1088678934 11:112222480-112222502 CTCCCTCTGTCTAGCTTCTAGGG - Intronic
1088804405 11:113338920-113338942 CCGCCGCTGCCTAGTGGCCAAGG - Intronic
1089629091 11:119772693-119772715 CCCCCTCTGTCTACTCCCCATGG - Intergenic
1094285969 12:28793961-28793983 ATCACTCTGGCTAGTGTCCATGG - Intergenic
1094366132 12:29683871-29683893 CTCCCTCTGTCACCTAGCCATGG + Intronic
1096684173 12:53276954-53276976 CTCCCTTCATCTTGTGGCCATGG + Intronic
1099115217 12:78615690-78615712 TCCCTTCTGTCTGGTGGCCAAGG - Intergenic
1100864859 12:98846387-98846409 CTCCCTCTTTCTCTTGGCCTAGG + Intronic
1101523276 12:105504488-105504510 CACTCTGTGTTTAGTGGCCAGGG - Intergenic
1101836779 12:108301415-108301437 CTCACTCTGTCTAGTTCCCCAGG + Intronic
1104437352 12:128766589-128766611 CTCTCTCTCTCTAGTGCCTAAGG + Intergenic
1107616244 13:42171307-42171329 CCTGCTCTGTCTAGTGTCCAGGG + Intronic
1107828625 13:44353700-44353722 CTCCTTCTGGCTAGTGGGCACGG + Intergenic
1112873343 13:104002543-104002565 CTCCATCTGGACAGTGGCCATGG + Intergenic
1113173193 13:107529878-107529900 ATCCCTTCATCTAGTGGCCATGG + Intronic
1113443699 13:110349357-110349379 CTCCCTCTGCCTGGTGGCACAGG + Intronic
1117653377 14:57929230-57929252 CTCTCTTTGTCCAGTGGTCAAGG + Intronic
1119034758 14:71220202-71220224 CTGCCTCTGTTGAGTGTCCATGG + Intergenic
1121494649 14:94383798-94383820 ATCCCACTATTTAGTGGCCAGGG + Intronic
1125504524 15:40259248-40259270 CTCCCTCAGCCCAGTGGCCTTGG + Intronic
1125882115 15:43204070-43204092 CTCCCTCTGCCCAGTGTCCCTGG + Intronic
1133790983 16:9008941-9008963 CTCGCACCCTCTAGTGGCCACGG + Intergenic
1135747768 16:25031879-25031901 CTCCCTCTGTCTAGTGGCCATGG - Intergenic
1135757724 16:25111882-25111904 TTCCCTCTGCCTAGTGGCCATGG - Exonic
1136569757 16:31089524-31089546 CTGCCTCTGTCTTGGGGTCAGGG - Intronic
1139468781 16:67167427-67167449 CTCCCTGTGCCTACAGGCCAAGG + Intronic
1140990329 16:80204940-80204962 CTCACCCTCTCTAGTGGCCTTGG + Intergenic
1141250265 16:82349790-82349812 CTTCCTCTTTCTAGTGCCCCTGG - Intergenic
1142200684 16:88759860-88759882 CCCCCTCTGTCTGCTGTCCAAGG - Intronic
1143640334 17:8192717-8192739 CTCCATCTTCCCAGTGGCCAAGG + Intergenic
1143884022 17:10052756-10052778 CTTGCTCTGTCTAGTGGGCCAGG + Intronic
1145904268 17:28507777-28507799 CTGCCTGTGTCTTGTGGTCAGGG - Intronic
1146259496 17:31412301-31412323 CTCCCTCTGTTTGCTGGACACGG - Intronic
1147041870 17:37725774-37725796 CTCCCGCTGTCTGCTGCCCAGGG + Intronic
1147457829 17:40549488-40549510 TTCCCTCTTGCTAGTGGGCACGG + Intergenic
1150503390 17:65673270-65673292 CTCCCTCTTTAAAGTGGCAATGG + Intronic
1152431029 17:80248417-80248439 CTCCCACTGTGTGGGGGCCATGG + Intronic
1152484587 17:80582019-80582041 CTCTCCCTCTCTAGTGCCCAGGG - Intronic
1156385277 18:36599007-36599029 CTTTCTCTTTCTGGTGGCCAGGG + Intronic
1159618789 18:70613083-70613105 CTTCCTATGCTTAGTGGCCATGG + Intergenic
1161400146 19:4063705-4063727 CTCCCACTGTGTGGTGGCCCAGG - Intronic
1161595224 19:5147904-5147926 CGCCCGCTGTGTGGTGGCCAAGG + Intronic
1162192798 19:8960297-8960319 CTCCCTCAGTCTAGGGCTCAGGG + Exonic
1164206766 19:23065591-23065613 CTGCCTCTGTCTTGTCCCCAGGG - Intergenic
1165072270 19:33262206-33262228 CTCCCTCTGTCTCCTGACCTTGG + Intergenic
1166797390 19:45435318-45435340 CTCCCTCTGTAAAATGGGCATGG - Intronic
1168411766 19:56144706-56144728 CACCCTCTGCCTTGTGGTCAAGG + Intronic
1168707885 19:58480108-58480130 CTCCCTCAGGCTTGTGGCCGTGG - Intronic
1202703086 1_KI270713v1_random:2920-2942 GTGCCTCTGTGTAGTGGCCCAGG - Intergenic
925039108 2:716562-716584 CTCCTCCTTTCTAGAGGCCAAGG + Intergenic
925317897 2:2939349-2939371 CTGCCTCTGTCTTGGGGGCAGGG - Intergenic
928969735 2:37015292-37015314 ATCCCCCTGTCCAGAGGCCATGG - Intronic
929074295 2:38065603-38065625 CTCCCTCTGGCCAGTGCTCACGG + Intronic
929761950 2:44814371-44814393 CTCCCACTGTCATCTGGCCAGGG + Intergenic
933213915 2:79604393-79604415 CTCCCTCAGTCTAGTAGGCTGGG - Intronic
933891009 2:86769904-86769926 CTCACCCTGTCCAGTGGCCAGGG + Intronic
934389641 2:93042652-93042674 CTCCTTCTGTCTAGTTTTCAGGG - Intergenic
937215881 2:120313332-120313354 CTAGCTCCGCCTAGTGGCCACGG + Intergenic
940180877 2:150931540-150931562 CTGCCTTTCTCTACTGGCCAGGG - Intergenic
942296823 2:174525670-174525692 CTCCCTCTCTCTAGTTGCTATGG - Intergenic
943377791 2:187101127-187101149 CTCCCTCTGTTCAGTGGAAATGG + Intergenic
949017885 2:241723700-241723722 CTGGCTCTGTCTAGTGGAGAAGG + Intronic
1169068377 20:2707173-2707195 CTCCCCCAGCCCAGTGGCCATGG - Intronic
1172441580 20:34970164-34970186 CTCCCTCTTCCTAAGGGCCAAGG + Intergenic
1174044908 20:47726668-47726690 CTCCCTGTGGCTAGTGGCAACGG + Intronic
1178275814 21:31236026-31236048 CTCCCTCTGTCTCCTGGAAAGGG + Intronic
1178384471 21:32138128-32138150 CACCCTCGGTCTTGTGCCCATGG + Intergenic
1178883149 21:36464505-36464527 CTCACTCTGTCCAGGGGCTAGGG + Intronic
1180105711 21:45616960-45616982 CTCCTGATGTCTAGTGGCCCGGG + Intergenic
1180750896 22:18123598-18123620 CTCGCTCTGTCTTGTTGCCCAGG + Intronic
1181480919 22:23198589-23198611 TTCCCTGTGGCTGGTGGCCATGG + Intronic
1181543015 22:23584017-23584039 CTGCCTCTGTTGAGAGGCCATGG - Intergenic
1182001046 22:26920109-26920131 CTGCCTCTTTCTAATGGCCTTGG + Intergenic
1182864929 22:33595819-33595841 TTCCCTCTGTCTAGTAGAGAAGG + Intronic
1182963771 22:34502684-34502706 CTCCCTCTGTCTGGGTGACATGG + Intergenic
1183985720 22:41569101-41569123 CTCCCTCTCTCTAGGGAGCAGGG - Intronic
1184886030 22:47344990-47345012 CTGCCTCTGTCTCCTGCCCATGG - Intergenic
1184889505 22:47371167-47371189 CACCCTCTGTCCACTGGCTAGGG + Intergenic
1185132443 22:49046824-49046846 CACCATCTGCCTAGTGGCCGAGG + Intergenic
949897491 3:8778953-8778975 CTCCATCTGTAAAGTGGACAAGG - Intronic
950047114 3:9955332-9955354 ATCCCTTTGGCTAGAGGCCAAGG + Intergenic
951262246 3:20523739-20523761 CTGCCTCTGCCAAGTCGCCAGGG + Intergenic
951915158 3:27792998-27793020 CTCCCTCTGGCTCAGGGCCATGG - Intergenic
952924379 3:38310447-38310469 CTCGCTCAGGATAGTGGCCAAGG + Intronic
953404463 3:42653768-42653790 GTCCCTCTGTCTCCTGGCCCTGG + Exonic
954298740 3:49688114-49688136 GTGCCTCTGTTTAGTGGCCCAGG + Intronic
954886640 3:53881066-53881088 CTCCATCTGTCTAGTTGAGAAGG - Intronic
955564586 3:60230075-60230097 CTACATGTGGCTAGTGGCCACGG - Intronic
962950190 3:140211343-140211365 CTCCTTATGTCTACTGGTCATGG - Intronic
968549538 4:1214989-1215011 CTCCCTCGGCTTCGTGGCCAGGG + Intronic
969126229 4:4950310-4950332 CTCCAACTATCTAGTGCCCAAGG - Intergenic
969312952 4:6364723-6364745 GTCCCTATGTCTTGGGGCCAAGG + Intronic
974157287 4:58090692-58090714 ATCTCTCTGTTTAGTGGGCATGG + Intergenic
976796134 4:88935065-88935087 CTTCCTCTGTCTGAAGGCCAAGG - Intronic
978892277 4:113844389-113844411 CTCCCACTCTCTTGTGGCCAGGG + Intergenic
984146293 4:176065744-176065766 CTCCCTCAGCCTAGTCTCCAAGG + Intergenic
986211889 5:5681790-5681812 CTCCCTCTGGCTAGGGGCAAGGG + Intergenic
986988430 5:13524771-13524793 CTGCCTCAGTTTGGTGGCCAAGG - Intergenic
988169851 5:27639390-27639412 CTCCCTCTGTCTGCTGGCATTGG + Intergenic
991410311 5:66339136-66339158 CTCCCTCTGCCTAGTGTACTTGG + Intergenic
991668945 5:69027671-69027693 CTCCCGTTCTCTTGTGGCCATGG - Intergenic
993573567 5:89572704-89572726 CCCCCTCTGTCTCCTGGCCCTGG - Intergenic
994035496 5:95195255-95195277 CTCCTTCAGTCAAGTTGCCACGG - Intronic
997377888 5:133410359-133410381 CTCCCTCCGTCTTGGAGCCAAGG + Intronic
998603167 5:143605601-143605623 CTCTCTGTGTCCAGTGGCCTTGG - Intergenic
1001398519 5:171433254-171433276 CTGCCTCTGTCCAGTGGGCCAGG + Intronic
1001565672 5:172697681-172697703 CTGTCGCTCTCTAGTGGCCACGG + Intergenic
1002164236 5:177334711-177334733 CTCCATCTGTGTGGTTGCCATGG + Intronic
1002279566 5:178122487-178122509 CTCCCACTGACCACTGGCCATGG - Exonic
1003575022 6:7284886-7284908 CTGCCTTTGCTTAGTGGCCAGGG + Exonic
1004724130 6:18294682-18294704 CTCCCTCTGTATTGTGCCCTGGG + Intergenic
1006055406 6:31380174-31380196 CTTCCTCTGTCTTGTTGCTAGGG - Intergenic
1006706225 6:36023857-36023879 GTCACTCTGGCTAGTGGCTAGGG + Intronic
1006726579 6:36203457-36203479 CTCCCTCTACCTCTTGGCCATGG - Intronic
1009759989 6:67992967-67992989 CTCACTCTGTGTTGTGGCCTTGG - Intergenic
1011698003 6:89930565-89930587 CTCCCTCGCTCCAGTGGCCTTGG - Exonic
1013175424 6:107672846-107672868 CCTCCTCAGTCTAGTGGCCTTGG - Intergenic
1014477085 6:121886958-121886980 CTGCCACTCTCTAGAGGCCAAGG - Intergenic
1016075458 6:139789526-139789548 CTCCCTCTGTCTACTCTCAATGG + Intergenic
1016163089 6:140906522-140906544 CTCCCACTGTTTAGTTGTCAGGG - Intergenic
1016337114 6:143018808-143018830 CTCTCTCTGTCTGTTGCCCAGGG - Intergenic
1017149651 6:151267535-151267557 CACCCTCTCTCTGTTGGCCAGGG - Intronic
1017315566 6:153027465-153027487 ATCCCTCTGTCTAGAAGCCGAGG + Intronic
1019061965 6:169263220-169263242 CTCCCTCTGGATCCTGGCCATGG + Intergenic
1019501716 7:1368212-1368234 CCCCATCTGTCAAGTGGCCACGG + Intergenic
1023888003 7:44374691-44374713 GCCCCTTTATCTAGTGGCCAAGG + Intergenic
1026169201 7:67938283-67938305 CTCCCTCCTTCTAGTGAGCAAGG - Intergenic
1028135178 7:87217611-87217633 CTCCCTCTGTGAAGTTGACAGGG - Intronic
1029223723 7:99009772-99009794 CTCCCTCTGCCTATAGGCCCTGG - Intronic
1031015621 7:116573409-116573431 CTCACTCTTTCTAGTGACCCAGG + Intergenic
1031049543 7:116931209-116931231 CTCTCTCTCTCTAGTGACTAAGG - Intergenic
1031447972 7:121878175-121878197 CTACATCTGCCTAGTGGCTATGG - Intronic
1033426285 7:141247530-141247552 CTCCCTCTGTCACGTGGGAAAGG + Intronic
1034567097 7:151924116-151924138 CTCCCTCGGTCCAGTGGCCCAGG - Intergenic
1035323390 7:158049232-158049254 CTCCATCTGACTGGTGGCCCTGG + Intronic
1035327257 7:158073198-158073220 CTGCTTCTGTCGAGTTGCCATGG + Intronic
1036646030 8:10611806-10611828 CTCCCTCTGCCGGGTGGGCAGGG - Exonic
1037609612 8:20465074-20465096 CTCCCTCTCTCAGGTGCCCAAGG - Intergenic
1038446717 8:27609685-27609707 CTCCCTCTGCGAAGTGGGCACGG - Intronic
1038507236 8:28095023-28095045 ATGCCTTTGCCTAGTGGCCAGGG + Intronic
1038563587 8:28601090-28601112 CACCCTCTGCCTAGTAGCCAGGG - Intronic
1039399209 8:37254440-37254462 CACCCACTGGCTAGTGGCTACGG - Intergenic
1040803725 8:51371017-51371039 CTTGCTCCGTGTAGTGGCCATGG - Intronic
1042360860 8:67881632-67881654 GACCCTCTGTCTAGTGTCCTGGG + Intergenic
1042745183 8:72099452-72099474 CTCCCTCTTTCTTGTTGCCCAGG + Intronic
1042944801 8:74144447-74144469 CTTCCTCTCTGTAGTGGACAAGG - Intergenic
1044277703 8:90321692-90321714 CTCCCTCTGTCTTTTTGGCAAGG - Intergenic
1045344938 8:101285394-101285416 GTCCCTGTGGCTAGTGGCTATGG - Intergenic
1047549357 8:125852895-125852917 ATCCCTCTTTCTAGTGGGCTTGG + Intergenic
1049016356 8:139922800-139922822 CCAGCTCTGTCTAGTGTCCACGG - Intronic
1050115617 9:2260525-2260547 CTGCCTCTGTGTAGTGTCCCCGG + Intergenic
1050825511 9:9940379-9940401 CTCCATCAGGCTAGTTGCCAGGG + Intronic
1055172210 9:73272620-73272642 CACCATCTCTCTAGTGGCTAGGG + Intergenic
1059413404 9:114148561-114148583 CACCCTCAGTCTGTTGGCCATGG + Intergenic
1060416273 9:123432857-123432879 CTCCCTCTGCCTGGTGGCACTGG + Intronic
1061675389 9:132212703-132212725 CTCCTTCCCTCTAGTGCCCAAGG + Intronic
1186585503 X:10869023-10869045 ATCCCTCTGTCCAATGGCAAGGG - Intergenic
1186613273 X:11159539-11159561 CTCCATCTTTCTAGTTGCCTAGG - Intronic
1188726273 X:33587153-33587175 CTCCCTCTGTACTGTAGCCAGGG + Intergenic
1190143942 X:47873580-47873602 CTCCCTTTGTATATTGTCCAGGG + Intronic
1192158021 X:68761083-68761105 CTCTCTCTGTCTTGGGACCAAGG + Intergenic
1192208438 X:69111185-69111207 CTCCCTCTTGCTAGTGGACCTGG - Intergenic
1194641357 X:96407196-96407218 CTCCCTCTGGCCAGTAGCCCAGG - Intergenic
1195613180 X:106892174-106892196 CTCCCGCTCTCGAGTTGCCATGG + Intronic
1195704263 X:107727347-107727369 CGCCAGCTGGCTAGTGGCCAAGG - Intronic
1196814240 X:119652582-119652604 CTCCCTGGGTCTAGGGGCAAAGG - Intronic