ID: 1135747769

View in Genome Browser
Species Human (GRCh38)
Location 16:25031885-25031907
Sequence GGAAGACTCCCTCTGTCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 118}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135747769_1135747780 29 Left 1135747769 16:25031885-25031907 CCACTAGACAGAGGGAGTCTTCC 0: 1
1: 0
2: 1
3: 13
4: 118
Right 1135747780 16:25031937-25031959 CGACGCGGGCGACGAGGGCGTGG 0: 1
1: 0
2: 2
3: 14
4: 154
1135747769_1135747779 24 Left 1135747769 16:25031885-25031907 CCACTAGACAGAGGGAGTCTTCC 0: 1
1: 0
2: 1
3: 13
4: 118
Right 1135747779 16:25031932-25031954 AATTGCGACGCGGGCGACGAGGG 0: 1
1: 0
2: 0
3: 0
4: 6
1135747769_1135747775 15 Left 1135747769 16:25031885-25031907 CCACTAGACAGAGGGAGTCTTCC 0: 1
1: 0
2: 1
3: 13
4: 118
Right 1135747775 16:25031923-25031945 TCCACCTGGAATTGCGACGCGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1135747769_1135747771 1 Left 1135747769 16:25031885-25031907 CCACTAGACAGAGGGAGTCTTCC 0: 1
1: 0
2: 1
3: 13
4: 118
Right 1135747771 16:25031909-25031931 TCACCTCCTGCTTTTCCACCTGG 0: 1
1: 0
2: 15
3: 96
4: 864
1135747769_1135747778 23 Left 1135747769 16:25031885-25031907 CCACTAGACAGAGGGAGTCTTCC 0: 1
1: 0
2: 1
3: 13
4: 118
Right 1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG 0: 1
1: 0
2: 0
3: 0
4: 18
1135747769_1135747781 30 Left 1135747769 16:25031885-25031907 CCACTAGACAGAGGGAGTCTTCC 0: 1
1: 0
2: 1
3: 13
4: 118
Right 1135747781 16:25031938-25031960 GACGCGGGCGACGAGGGCGTGGG 0: 1
1: 0
2: 0
3: 10
4: 84
1135747769_1135747774 14 Left 1135747769 16:25031885-25031907 CCACTAGACAGAGGGAGTCTTCC 0: 1
1: 0
2: 1
3: 13
4: 118
Right 1135747774 16:25031922-25031944 TTCCACCTGGAATTGCGACGCGG 0: 1
1: 0
2: 0
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135747769 Original CRISPR GGAAGACTCCCTCTGTCTAG TGG (reversed) Intergenic
900687104 1:3955588-3955610 GGAACGCTCTCTCTGCCTAGTGG + Intergenic
905302356 1:36994040-36994062 AAAAGACTCCATCTGTCTAGGGG + Intronic
913282752 1:117201435-117201457 GGGGGAATCCCTCTGTGTAGGGG + Intronic
915930992 1:160060978-160061000 GGTAGGCTCACTCTGCCTAGGGG + Intronic
916265904 1:162889681-162889703 GGAAGACCCCTTATGTCTTGGGG + Intergenic
921311133 1:213845008-213845030 GGCAGAAGCCCTCTGTCTGGAGG - Intergenic
922067765 1:222160374-222160396 GGAAAACTTCCTCGGTCCAGTGG - Intergenic
922957966 1:229620535-229620557 GGAACTCTCCATCTGTTTAGGGG - Intronic
924178693 1:241419200-241419222 GTAATACTCCCTCTGACTCGAGG - Intergenic
1063580096 10:7298309-7298331 GGAGGTCTCAGTCTGTCTAGGGG - Intronic
1068570038 10:58618037-58618059 GAAAAACTCCCTCTGCCTAGGGG + Intronic
1068866019 10:61896850-61896872 GGAAGTCTCCATCTGTATCGAGG + Intergenic
1069185101 10:65412511-65412533 GGAAAATTCCCTCTGTCTTGGGG - Intergenic
1071098626 10:82009700-82009722 AGAGGACTCCATCTTTCTAGGGG + Intronic
1073414135 10:103367391-103367413 GGAAGCCTCCCTCTGGCAAATGG + Intergenic
1075301333 10:121327164-121327186 GAGAGACTGCCCCTGTCTAGGGG - Intergenic
1075780725 10:125015589-125015611 AGAGGACTCCCTCTGGCTCGAGG + Intronic
1077555123 11:3222292-3222314 GGAGGACTTCCCCTGTCTAAGGG + Intergenic
1077929080 11:6711770-6711792 GAAAGACTCCCTTTGCCAAGTGG + Intergenic
1078804682 11:14685918-14685940 GGTAGAATCACTCTGGCTAGAGG - Intronic
1080892126 11:36418270-36418292 GGAAGACTGCCTCAGTCCATTGG + Intronic
1083653950 11:64220112-64220134 GGAAGATGCCCTCTGTCCTGAGG + Intronic
1084953396 11:72678895-72678917 GGGTGACTCCCTCTGGCTGGGGG + Intergenic
1085012307 11:73149798-73149820 GGAAGACTGCCTCTGTCTAAAGG + Intergenic
1086351383 11:85945381-85945403 GGAGAACTCCCTCAGCCTAGGGG + Intergenic
1088673072 11:112162835-112162857 GAAAGTCTCGCTCTGTTTAGTGG + Intronic
1094612234 12:32005566-32005588 GGAAGAATCCTTCTGTCCACAGG - Intergenic
1097080113 12:56423707-56423729 GTAATCCTCCCTCTGTCTATAGG - Exonic
1098525809 12:71485789-71485811 GGAAGTCTCACTCTGTCTCCAGG + Intronic
1098879096 12:75898309-75898331 GGAAGATTCCCTCTATCTTCTGG - Intergenic
1100103087 12:91133626-91133648 TCCAGACTCCCTCTGTCTTGTGG - Intergenic
1102310068 12:111837755-111837777 GGAAGACTCCTTCCTTCTGGTGG - Intergenic
1102404771 12:112663850-112663872 GGAAGACTACCTCTTTCTCTTGG - Intronic
1104878280 12:132051892-132051914 GGAAGACACCCACTGCCAAGCGG - Intronic
1107159437 13:37208999-37209021 AGCAGGCTCCCTCTTTCTAGAGG + Intergenic
1111659836 13:91195109-91195131 GGAAGACACCCTATATCTAGAGG + Intergenic
1119555540 14:75549640-75549662 GGATGGCTCCCTCAGTCTGGTGG + Intergenic
1126381373 15:48050907-48050929 AGAAGACCCCCTCGGCCTAGCGG - Intergenic
1128497476 15:68206628-68206650 GGAAGGCTGCCTCTGTGCAGAGG + Intronic
1129162943 15:73757242-73757264 GGAAGAACCCCTCTTCCTAGTGG + Intergenic
1131803183 15:96094047-96094069 GGAAGACTCTCTCAGGCAAGAGG - Intergenic
1132539198 16:500360-500382 TGGAGAATCCCTCTTTCTAGGGG + Intronic
1135747769 16:25031885-25031907 GGAAGACTCCCTCTGTCTAGTGG - Intergenic
1135757725 16:25111888-25111910 AGAGGATTCCCTCTGCCTAGTGG - Exonic
1140087132 16:71807404-71807426 CGAAGTCTCCCTCTGTCTCCAGG - Intronic
1142735707 17:1897655-1897677 CGAAGGCTCTCTCTTTCTAGAGG + Exonic
1143103479 17:4516483-4516505 GGTAGATTCCCTCTATCTATGGG + Intronic
1143879255 17:10017340-10017362 GCAAGACTCCGTCTGTCTCAAGG - Intronic
1144887561 17:18473882-18473904 GGCAGACTCCCTCAGTCTATAGG + Intergenic
1145144656 17:20470413-20470435 GGCAGACTCCCTCAGTCTCTAGG - Intergenic
1145176108 17:20701815-20701837 GGCAGACTCCCTCAGTCTATAGG - Intergenic
1146216927 17:30984539-30984561 TTATGATTCCCTCTGTCTAGTGG + Intronic
1148586875 17:48787320-48787342 GGAAGATTCCCTATGTGAAGTGG - Intronic
1151508686 17:74545096-74545118 GGGAGGCTCCCTCTGTGCAGAGG + Intronic
1151539391 17:74757506-74757528 AGAAGACACCTTCTGCCTAGAGG + Intronic
1151547040 17:74799527-74799549 GGAAGACTCTCTCTGTCACAAGG - Intronic
1151786273 17:76276573-76276595 GGAAGACACCCAGGGTCTAGTGG + Intronic
1152786014 17:82248499-82248521 GGAAGGCTCCCTCGGGCTGGGGG + Intronic
1160081529 18:75731789-75731811 GAAAGACTCATTCTGGCTAGAGG + Intergenic
1164610488 19:29628291-29628313 TGGAGTCTCCCTCTGTCTAGAGG - Intergenic
1166453791 19:42923264-42923286 GGAAGACACCCTTTGCCAAGTGG - Intronic
1166731028 19:45059153-45059175 TGAAGAATCCCTCAGTCTGGCGG + Intronic
937826319 2:126371947-126371969 AGAAAACTCCCTCAGCCTAGGGG - Intergenic
937826610 2:126373747-126373769 AGAAAACTCCCTCGGCCTAGGGG + Intergenic
938247028 2:129785689-129785711 GGAGGCGTCCCTCTGTCCAGGGG + Intergenic
939020809 2:136956298-136956320 GGAAGACTCATTCTCTCTTGGGG - Intronic
940180256 2:150923956-150923978 GGACAACTCCCTCTGTCTCTTGG - Intergenic
940657117 2:156501227-156501249 AGAAGACTGCCTCTTTCTGGAGG + Intronic
941078166 2:161030105-161030127 GGAAGATTCCCTATGTCCTGGGG + Intergenic
1168792499 20:589138-589160 GGAGGACTCTGTCTGACTAGCGG - Intergenic
1168925031 20:1572284-1572306 GGAAGTCTCCCTGTGTGGAGAGG - Intronic
1168928907 20:1605312-1605334 GGAAGTCTCCCTGTGTGGAGAGG - Intronic
1169329703 20:4706632-4706654 GGGAGTCTCCCAATGTCTAGGGG - Intergenic
1171297768 20:24033944-24033966 GGAAGATTCCCTTTGTCTCATGG + Intergenic
1173026225 20:39309976-39309998 GCAATACTCCCTGTGTCTAGGGG - Intergenic
1173332324 20:42085667-42085689 GGCAGCCTCCATCTGTCTTGGGG + Intronic
1177700284 21:24631139-24631161 GGAAAATTCCCTCTTTCTTGGGG + Intergenic
1180032701 21:45223386-45223408 GGCTGACTCCCTCTGTCGTGGGG - Exonic
1183180542 22:36257254-36257276 GCAAGCCTCCCTCTGTCCACTGG + Intronic
1183278012 22:36913619-36913641 GGGAGGCTCACTCTGCCTAGAGG + Exonic
1183286348 22:36966820-36966842 GGCAGACTCCCTCTGACTGGAGG + Intergenic
949405868 3:3713755-3713777 GGAAGATTACTTCTGTTTAGGGG - Intronic
950145027 3:10642863-10642885 GGTAGACTCCCTCAGTGTATGGG - Intronic
951232746 3:20198891-20198913 GGAAGACTCCTGGTTTCTAGAGG - Intergenic
951232834 3:20199580-20199602 GGAAGACTCCTGGTTTCTAGAGG + Intergenic
953294121 3:41696016-41696038 GGAAGACGCCCGCTGCCAAGCGG + Intronic
956838483 3:73115317-73115339 GGAAGACACCCTCTATCAAGGGG + Intergenic
958449699 3:94258703-94258725 GGAAGATTCCTTCTGTGGAGAGG + Intergenic
958483695 3:94676719-94676741 GGAGGTCTCACTCTGTCAAGAGG - Intergenic
964680415 3:159331786-159331808 GGAACCCTCACTCTGTCTATAGG - Intronic
964698470 3:159536648-159536670 AGAAGACTCCATCCCTCTAGAGG + Intronic
968953343 4:3706024-3706046 GGCAGCTTCCCTCTGTCTGGTGG + Intergenic
971134041 4:23847347-23847369 AGAAGACTCCTTCGGTCAAGGGG - Intronic
972243333 4:37217822-37217844 GGAGGACTCCCACTGTGTAAAGG - Intergenic
974115725 4:57576750-57576772 GGATTATTCCCTCTGTTTAGTGG + Intergenic
975054206 4:69907762-69907784 GGCAGACTACCTCTGTTTATGGG - Intergenic
976674109 4:87685459-87685481 TAAAGACTCACTCTGTCTACAGG - Intergenic
977192499 4:94018288-94018310 ATTAGACTCCCTCTGTCTACTGG + Intergenic
981101078 4:140829703-140829725 GAAAAACTCACTCTGCCTAGGGG + Intergenic
987063766 5:14268068-14268090 GGAAGACTCAGTCTTTCTAGAGG - Intronic
988083039 5:26436931-26436953 TGGAGTCTCCCTCTGTCTCGAGG - Intergenic
990162208 5:52954089-52954111 GAAAGAATACCTCTTTCTAGAGG + Exonic
993655686 5:90575709-90575731 GGCAGACTCCCTCTAACTGGAGG + Intronic
993992737 5:94679843-94679865 GGAAGCCTCCTTCAGTCTAGAGG - Intronic
995196580 5:109376457-109376479 GGAAGACTACCTTTCTCTAGGGG + Intronic
996124662 5:119710092-119710114 GGAAGACTCCCCGTATGTAGAGG + Intergenic
998184099 5:139965591-139965613 GTCAGAGTCCCTCTGTCCAGGGG - Intronic
1000651687 5:163825977-163825999 GGAAGTGTCCCTTTGTCTTGTGG + Intergenic
1000783209 5:165510791-165510813 GACAGACTCCTTCTCTCTAGTGG + Intergenic
1007787141 6:44287197-44287219 GGAAGACTCCATCAGAGTAGAGG + Intronic
1009948902 6:70372352-70372374 GAAAGAATCCCTGTGTCTATTGG + Intergenic
1010723261 6:79307933-79307955 GGAGGACGCCCTCAGCCTAGGGG - Intergenic
1013398605 6:109769126-109769148 GGGAGTCTCGCTCTGTCTACAGG + Intronic
1015853764 6:137602353-137602375 GGAACACTGCCTCTGACAAGTGG + Intergenic
1019146472 6:169978531-169978553 TAAAGACCCCCTCTGTCAAGGGG - Intergenic
1020376216 7:7490464-7490486 GGAAGCCTCCTTGTGTCTATTGG + Intronic
1022562189 7:31361012-31361034 GGAAGTCTCGCTCTGTCTCCCGG - Intergenic
1026896346 7:74012172-74012194 AGAACACTCCCTCTGTTCAGTGG - Intergenic
1029032716 7:97485780-97485802 GGCAGACTGCATCTGCCTAGAGG + Intergenic
1035487373 7:159236667-159236689 GGAAGGCTGCCTCTGGGTAGGGG - Intergenic
1035650649 8:1261493-1261515 AGAAGACTCCCCCTGTCCGGTGG + Intergenic
1038434918 8:27528746-27528768 GGAAGACTCCTTCTGTGCTGTGG + Intronic
1038778811 8:30553800-30553822 GGAAGTCTCCCTCTGTCACCAGG + Intronic
1044611632 8:94097845-94097867 GGTAGCTTCCATCTGTCTAGTGG + Intergenic
1045904127 8:107323031-107323053 GGAAGACTCCCTTTGGCTGATGG + Intronic
1048224746 8:132574422-132574444 GGTAGGCACCCTCTGCCTAGTGG - Intronic
1053065438 9:35065570-35065592 TGAAGAGTCCCTCTGACAAGAGG + Intronic
1057273025 9:93661168-93661190 TGAAGACCCACTCTGACTAGAGG + Intronic
1058639503 9:107069231-107069253 GGGAGTCTCCCTCTGTCTCCAGG + Intergenic
1187867343 X:23735931-23735953 GGAAGATTCCCTGTTTCTTGGGG + Exonic
1193733024 X:85124607-85124629 AGAAGACTCCCACTGTGTGGAGG + Intergenic
1197030500 X:121808402-121808424 GAGAGACTCCTTCTGTTTAGGGG - Intergenic
1197500494 X:127235489-127235511 GAATGACACCCTATGTCTAGAGG + Intergenic