ID: 1135747770

View in Genome Browser
Species Human (GRCh38)
Location 16:25031906-25031928
Sequence GGTGGAAAAGCAGGAGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1193
Summary {0: 1, 1: 0, 2: 8, 3: 91, 4: 1093}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135747770_1135747779 3 Left 1135747770 16:25031906-25031928 CCTTCACCTCCTGCTTTTCCACC 0: 1
1: 0
2: 8
3: 91
4: 1093
Right 1135747779 16:25031932-25031954 AATTGCGACGCGGGCGACGAGGG 0: 1
1: 0
2: 0
3: 0
4: 6
1135747770_1135747774 -7 Left 1135747770 16:25031906-25031928 CCTTCACCTCCTGCTTTTCCACC 0: 1
1: 0
2: 8
3: 91
4: 1093
Right 1135747774 16:25031922-25031944 TTCCACCTGGAATTGCGACGCGG 0: 1
1: 0
2: 0
3: 2
4: 48
1135747770_1135747778 2 Left 1135747770 16:25031906-25031928 CCTTCACCTCCTGCTTTTCCACC 0: 1
1: 0
2: 8
3: 91
4: 1093
Right 1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG 0: 1
1: 0
2: 0
3: 0
4: 18
1135747770_1135747775 -6 Left 1135747770 16:25031906-25031928 CCTTCACCTCCTGCTTTTCCACC 0: 1
1: 0
2: 8
3: 91
4: 1093
Right 1135747775 16:25031923-25031945 TCCACCTGGAATTGCGACGCGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1135747770_1135747781 9 Left 1135747770 16:25031906-25031928 CCTTCACCTCCTGCTTTTCCACC 0: 1
1: 0
2: 8
3: 91
4: 1093
Right 1135747781 16:25031938-25031960 GACGCGGGCGACGAGGGCGTGGG 0: 1
1: 0
2: 0
3: 10
4: 84
1135747770_1135747780 8 Left 1135747770 16:25031906-25031928 CCTTCACCTCCTGCTTTTCCACC 0: 1
1: 0
2: 8
3: 91
4: 1093
Right 1135747780 16:25031937-25031959 CGACGCGGGCGACGAGGGCGTGG 0: 1
1: 0
2: 2
3: 14
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135747770 Original CRISPR GGTGGAAAAGCAGGAGGTGA AGG (reversed) Intergenic
900185977 1:1333405-1333427 GGTGGGAACGCAGCAGGGGAGGG + Intronic
900237249 1:1598714-1598736 GCTGCAGAAGCATGAGGTGAGGG - Exonic
900428601 1:2591801-2591823 GGGGGAAAAGCATGAGGGGCAGG - Intronic
900725897 1:4216227-4216249 GGTGGAGAGGCAGGTGGAGAAGG - Intergenic
900725909 1:4216281-4216303 GGTGGAAAGGCAGGTGGAGGTGG - Intergenic
900975138 1:6012008-6012030 GGTGGTAGAGGTGGAGGTGATGG + Intronic
901412562 1:9094676-9094698 GGTGGACAAGGAGGAGGCCAAGG - Intergenic
901650584 1:10740593-10740615 GGTCTAGAAGCAGGAGGTGGAGG + Intronic
901714258 1:11140472-11140494 GGAGGCACAGCAGGAGGTGAGGG - Intronic
902221427 1:14968383-14968405 GGCTGCACAGCAGGAGGTGAGGG - Intronic
902322254 1:15676163-15676185 GGTGGGAAAGCAGGAAGTGAAGG - Intergenic
902606808 1:17573581-17573603 GGAGGAAGAGCAGGAGGAGGAGG + Intronic
902654927 1:17860531-17860553 GGTGGAAAAGTGGAAAGTGAAGG - Intergenic
902694112 1:18128859-18128881 GGTGAAATAAAAGGAGGTGAGGG - Intronic
902805379 1:18858103-18858125 GGTGGAAATGGTGGTGGTGATGG - Intronic
902842303 1:19082691-19082713 TCTGGGAAAGCAGGAGGAGAGGG + Intronic
902849987 1:19147684-19147706 GCTGGAAAAGGGTGAGGTGAGGG - Intronic
903468504 1:23568569-23568591 GGAGGAAAAGCAGGGGGCGCGGG - Intergenic
903615764 1:24655015-24655037 GGTGGAGTTGCAGGAGGTGATGG - Exonic
903944014 1:26950606-26950628 GCTGGGAGAGCAGCAGGTGAGGG + Intronic
903969503 1:27109619-27109641 GGAGGTAAATCGGGAGGTGAAGG + Exonic
904014616 1:27409961-27409983 GGTGGGAAAGATGGGGGTGAGGG + Exonic
904055644 1:27668378-27668400 GGAGGAACAGGAGCAGGTGAGGG + Intronic
904190618 1:28740785-28740807 GGTGTGAACCCAGGAGGTGAAGG - Intronic
905014042 1:34764939-34764961 GGGAGAATAGCAGGAGGAGAAGG - Intronic
905050583 1:35047495-35047517 GGAGCAACAGCTGGAGGTGAGGG - Intergenic
905371154 1:37483321-37483343 GGTGGAAAGGCAGGGGGCGCGGG - Exonic
906004538 1:42457136-42457158 CGTGGGTAAGCAGGAGGTAAGGG - Intronic
906180855 1:43817626-43817648 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
906180889 1:43817794-43817816 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
906297774 1:44659576-44659598 GGTGGGAAAGGAGGAGGTCCTGG + Intronic
906516711 1:46443322-46443344 GGAGGAAGAGGAGGAGGAGAAGG - Intergenic
906852762 1:49269651-49269673 GGTGGTAAATCAGGACATGATGG - Intronic
907014917 1:51003272-51003294 AGTGGAAAGACAGGAGATGATGG + Intergenic
907237745 1:53063137-53063159 GGTGGAAGAGGAGGTGGTGGCGG + Intronic
907967341 1:59345451-59345473 GGTGGTAAGGCAGGATATGAGGG + Intronic
908349144 1:63267026-63267048 GGGGGAAGAGGAGGAGGAGAAGG + Intergenic
908728647 1:67203495-67203517 GGTGGAGGAGGAGGAGGTGGAGG - Intronic
908759040 1:67495090-67495112 GGTGGAAAGGCTGGAGGAGTGGG - Intergenic
908815782 1:68032340-68032362 GGTGGAAAAACAAGAGGAGGTGG + Intergenic
908916842 1:69138121-69138143 TGTGGAACAGCAGTAGGTAAGGG + Intergenic
909304776 1:74060314-74060336 GGTGGAAGAGGAGGAGGAGGAGG - Intronic
909428445 1:75556052-75556074 GGTGTAGAAGGAGGAGGGGATGG + Intronic
909847409 1:80412404-80412426 GGAGGAAAAGGAGGAGGAGGAGG + Intergenic
910117570 1:83749201-83749223 GGTGGAAAGGCAAGAGGGTAGGG + Intergenic
910258694 1:85276003-85276025 GGGGGGAAAGCATGAGGAGATGG + Intronic
910286106 1:85556092-85556114 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
910360050 1:86406917-86406939 GGTGCAAGAGAAGGAGGTGGTGG - Intergenic
910492119 1:87784078-87784100 TGTGGAAAAGCTTGGGGTGAAGG - Intergenic
910515923 1:88060170-88060192 GGTGAACAAGGAGGAGGAGAAGG - Intergenic
911064662 1:93777492-93777514 GGTGGAGGAGGAGGAGGTGGAGG - Intronic
911087427 1:93990522-93990544 GGAGGAAAAGGAGGAGGAAATGG - Intergenic
911102378 1:94104835-94104857 GGAGGAAAAGCAGGAGGGCTGGG - Intronic
911272042 1:95813794-95813816 GGAGGAAAAGAAGGAGAAGAAGG + Intergenic
911595142 1:99791375-99791397 GGTGGGAGTCCAGGAGGTGAAGG - Intergenic
912421027 1:109542698-109542720 GATGGAAAAGGAAGAGGTGAAGG + Exonic
912760173 1:112359534-112359556 AGTGGAAGGGCAGGAGCTGAGGG + Intergenic
912909722 1:113745546-113745568 GGTTGCACAGCAGGAGGTGAGGG + Intronic
913083601 1:115413168-115413190 GGAGAAAAAGGAGGAGGAGAAGG + Intergenic
913245899 1:116869719-116869741 GGAGGAAGAGGAGGAGGAGAAGG + Intergenic
913297447 1:117335661-117335683 GGTGGAAACCATGGAGGTGAGGG + Intergenic
913493985 1:119410589-119410611 GGAGGAAAATTAGGAGGGGATGG - Intergenic
913494459 1:119415485-119415507 GGTGGAAGAGAAGGAACTGAAGG + Exonic
913511193 1:119564134-119564156 GGTGGAGGAGAAGGAGCTGAAGG + Intergenic
913515429 1:119601408-119601430 GGTGGAGGAGAAGGAGCTGAAGG + Intergenic
913660749 1:121004585-121004607 GGTGGAAGAGCAGGCAGGGAGGG + Intergenic
914012112 1:143787741-143787763 GGTGGAAGAGCAGGCAGGGAGGG + Intergenic
914165719 1:145173393-145173415 GGTGGAAGAGCAGGCAGGGAGGG - Intergenic
914244617 1:145876432-145876454 AGAGGAGAAGCAGGAGGAGAAGG + Intronic
914650743 1:149696404-149696426 GGTGGAAGAGCAGGCAGGGAGGG + Intergenic
914886575 1:151589971-151589993 GGTGGAAAAAGAGGAGGAGGAGG + Intergenic
915224391 1:154401901-154401923 GATGAGAAAGCAGGAGGGGAAGG + Intergenic
915732874 1:158066680-158066702 GGTGGGAAAGCAGAAAGGGACGG - Intronic
916427253 1:164692508-164692530 AATTGAAAAGCAGGAGGGGAGGG - Intronic
916891601 1:169117194-169117216 GGTGGGAAGGGAGGAGGAGAGGG - Intronic
916944471 1:169711994-169712016 GGTGGAAAAGAAGGAGGAGGAGG - Intronic
917562667 1:176175605-176175627 GGCTGCACAGCAGGAGGTGAGGG - Intronic
917622584 1:176811900-176811922 GGTGGAAAGGTAGGGGGTGTAGG - Intronic
917783074 1:178420485-178420507 GAAGGAAAGGCAGAAGGTGATGG - Intronic
917850598 1:179060420-179060442 GGTTGCACAGCATGAGGTGAGGG + Intronic
917861270 1:179146890-179146912 GGTAGAAAAGCAAGAGGATATGG - Intronic
918610761 1:186488271-186488293 GATGGAAAGGTAGGGGGTGAGGG - Intergenic
918739958 1:188117075-188117097 GGTGTAACAGTAGAAGGTGATGG - Intergenic
919450578 1:197768193-197768215 GGAGGAAGAGGAGGAGGAGAAGG - Intronic
920555126 1:206899038-206899060 GATGGAGAAGGAGGAGGTGCAGG + Intronic
920555291 1:206899893-206899915 GGTGAGGAAGCAGGATGTGAGGG - Intronic
920784781 1:209030710-209030732 ACTGGGAAAGCAGCAGGTGAAGG - Intergenic
921080381 1:211734332-211734354 GGTGGAAGAGGTGGAGGTGTTGG + Intergenic
921559088 1:216635185-216635207 GGTGGAAAGGTAGCAGGGGAAGG + Intronic
921885062 1:220297094-220297116 GGAGGAATAGCAAGAGGTAATGG + Intergenic
922010186 1:221575541-221575563 GGCTGCACAGCAGGAGGTGAGGG + Intergenic
922068562 1:222168518-222168540 GGAGGAAGAGCAGGAGGAGAGGG + Intergenic
922914374 1:229243779-229243801 GGTGGTAATGAAGGTGGTGAAGG + Intergenic
923146479 1:231202178-231202200 GGTGGAAGAGGAGGAGGTGGTGG + Intronic
923146498 1:231202246-231202268 AGTGGAGAAGGAGGAGGTGGTGG + Intronic
923161271 1:231316913-231316935 GGTGGAAGAGATGGAGGGGATGG - Intergenic
923161285 1:231316972-231316994 GGAGGAAGAACAGGAGGTGGAGG - Intergenic
923290761 1:232543407-232543429 GGTGGAAAAGGTGGAGGAGGTGG - Intronic
923373739 1:233339416-233339438 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
923373742 1:233339428-233339450 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
923373745 1:233339440-233339462 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
923612092 1:235504526-235504548 TGTGGAAACGCGGGAGGAGAGGG - Intergenic
923624960 1:235606455-235606477 GGTGGAGAGCCAGGTGGTGAGGG + Intronic
923629144 1:235638212-235638234 GGGAAGAAAGCAGGAGGTGAAGG - Intronic
923969683 1:239185831-239185853 GGTGGTGAAGGAGGAGGAGAAGG + Intergenic
923969687 1:239185843-239185865 GGAGGAGAAGGAGGAGGTGGTGG + Intergenic
924298725 1:242614893-242614915 GGAGGGAAAGAAGGAAGTGAGGG - Intergenic
924809451 1:247388371-247388393 GGTGGGAACCCAGGAGGTGGAGG + Intergenic
1062982479 10:1736995-1737017 GGTGGAGAAGCCGGGGGTGAAGG + Intronic
1063326291 10:5106448-5106470 GCAGGAAAAGCAGGAAGTTATGG + Intronic
1063603694 10:7505302-7505324 GGTGGAAAAGGTGGAGGAGGAGG - Intergenic
1063793617 10:9484355-9484377 GGTACAAATGCAGGATGTGAAGG - Intergenic
1063945359 10:11170673-11170695 GGTGGAGGAGGAGGAGTTGAAGG + Intronic
1064782562 10:18858413-18858435 GGTGGAATAATTGGAGGTGAGGG + Intergenic
1064850844 10:19707078-19707100 GGAGGAAGAGGAGGAGGAGAAGG - Intronic
1065043108 10:21717625-21717647 GGAGGAAAAGGAGGAGGAGGAGG - Intronic
1065043151 10:21717825-21717847 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1065043154 10:21717837-21717859 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1065043157 10:21717849-21717871 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1065043160 10:21717861-21717883 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1065043163 10:21717873-21717895 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1065050375 10:21785805-21785827 GATGGAAAAGGAGGAGGGGAAGG + Intronic
1065072280 10:22038234-22038256 GGAGGAAAAGCAAGGGGTGGGGG - Intergenic
1065389331 10:25166672-25166694 GGAGGAAAAGGAAGAGGAGAAGG + Intergenic
1065608513 10:27446626-27446648 GGAGGAGGAGCAGGAGGAGAAGG - Intergenic
1066214408 10:33272527-33272549 GGAGGAAAAGGAGGAGGAGGAGG + Intronic
1067487183 10:46661709-46661731 GTGAGAAATGCAGGAGGTGATGG - Intergenic
1067554327 10:47257537-47257559 GGTGGAGGAGCAGGTGGTGGAGG + Intergenic
1068269203 10:54697767-54697789 GGAAGAAAAGCAGGAAGGGATGG + Intronic
1068588472 10:58827886-58827908 GGTTGAGAAGGAGGAGGAGAAGG - Intronic
1069510648 10:69040098-69040120 GGTAGAAATGAAGGATGTGAGGG + Intergenic
1069588875 10:69630030-69630052 CGTGGAAAAGAAGGAGAAGAAGG - Intergenic
1069639660 10:69946423-69946445 GGTGGGAAAGCATGCCGTGATGG - Intronic
1069760235 10:70805435-70805457 GGTGGAAATGGGGGAGATGAAGG + Intergenic
1069954305 10:72040440-72040462 GATGGAAAACCAGGAGGAGCAGG + Intergenic
1069994184 10:72332517-72332539 GAGGGAAAAGCAGAGGGTGATGG + Intergenic
1070140032 10:73732204-73732226 GCTGGGGAAGCAGGAGGAGAAGG - Intergenic
1070394558 10:76000877-76000899 GGTGGAGAAGCGGGAAGGGAGGG - Intronic
1070405802 10:76093571-76093593 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1070652719 10:78249620-78249642 GGTGGGAATGAAGGGGGTGATGG - Intergenic
1070844443 10:79510376-79510398 GATGGAAAAGCAGGGAGTGCTGG - Intergenic
1070929354 10:80249932-80249954 GATGGAAAAGCAGGGAGTGCTGG + Intergenic
1071623179 10:87141663-87141685 GTGAGAAATGCAGGAGGTGATGG + Intronic
1071877798 10:89861452-89861474 GGAGGAAAAGGAGGAGGAGGGGG - Intergenic
1072046993 10:91666984-91667006 GGTGGTAAAGCAGGAATTGGAGG - Intergenic
1072327793 10:94315252-94315274 GGAGGAAAAGCAGAATGTGATGG - Intronic
1072448889 10:95523074-95523096 AGTGCAAAAGCATGAGGTAATGG - Intronic
1072741871 10:97914678-97914700 GATGGAAAAAGAGGAGGGGAAGG - Intronic
1072789690 10:98309227-98309249 CGTGTCTAAGCAGGAGGTGAGGG + Intergenic
1073357053 10:102864303-102864325 GGTAAAAAAGCTGGATGTGAAGG + Exonic
1073460878 10:103665253-103665275 GGAGGACGAGCAGGAGGTGCTGG + Intronic
1073689145 10:105787989-105788011 GGAGGAGAAGCAGGAGGAGGAGG - Intergenic
1074001646 10:109379596-109379618 GGAGGAAGAGGAGGAGGAGAAGG - Intergenic
1074543195 10:114383325-114383347 GGAGGAAAAGGAGGAAGGGAAGG + Intronic
1074865505 10:117542405-117542427 GGAGGAAGAGGAGGAGGCGAAGG + Intergenic
1075066452 10:119292046-119292068 GGAGGAAGAGGAGGAGGAGAAGG - Intronic
1075081933 10:119390109-119390131 GGAGGAAAAGCAGCTGGTGGGGG + Intronic
1075605895 10:123807664-123807686 GATGGAAAAGGAGGAGGGGCAGG + Intronic
1075778186 10:125001294-125001316 GCTGGAGAAGCAAGAGGTGCGGG + Intronic
1075874612 10:125796038-125796060 GGTGGGGAAGCAGAGGGTGAAGG - Intronic
1076610483 10:131723072-131723094 GGTGGGAGGGCAGGAGGAGAGGG - Intergenic
1076778114 10:132709318-132709340 GGGGGAAAAGAAGGAGGTGGGGG + Intronic
1077136653 11:1002904-1002926 GGTGGGGAGGCAGGAGGTCATGG - Intronic
1077309877 11:1883545-1883567 GGAGGAACAGGAGGAGGTGATGG + Exonic
1077776689 11:5279988-5280010 GGAGAAAAAACAGGAGGTCAAGG - Intronic
1077836170 11:5929759-5929781 GGTGGAGGAGGAGGAGATGATGG - Intronic
1078192957 11:9108271-9108293 GGAGGAGAAGCAGGAGGAGGAGG + Intronic
1078380495 11:10835677-10835699 GGCTGCACAGCAGGAGGTGAGGG + Intronic
1078494643 11:11803658-11803680 AGAGGAAAATGAGGAGGTGATGG + Intergenic
1078662040 11:13295514-13295536 GGTGGGAAGGGAGGAGGTGGAGG + Intronic
1079108526 11:17589941-17589963 GGAGGAAAAGCAAGAGGAGGTGG - Intronic
1079315581 11:19405357-19405379 GGTGGGAAAGGAGAAGGGGAGGG - Intronic
1079703929 11:23589025-23589047 GGAGGAGAAGGAGGAGGTGGAGG + Intergenic
1080571327 11:33559648-33559670 GGAGGCTAAGCAGGAGTTGAGGG - Intronic
1081572715 11:44301690-44301712 GGTGGAAAGGCAGAAAGTGTTGG - Intronic
1082096813 11:48137707-48137729 GGAGGAAGAGCAGGAGGCAAGGG + Intronic
1082669790 11:56020859-56020881 GGAGGAAGAGCAGGAGGAGGAGG + Intergenic
1082669794 11:56020877-56020899 GGAGGAAGAGCAGGAGGAGGAGG + Intergenic
1082724448 11:56718510-56718532 GGGGGAAGAGCAGGCAGTGATGG + Intergenic
1082892420 11:58154164-58154186 GGAGGAGAAGGAGGAGGGGAAGG + Intronic
1083142315 11:60732270-60732292 GGAGGAAAAGCAGGGAGTAAGGG + Intronic
1083173560 11:60936322-60936344 GGAGGAAGAGGAGGAGGAGATGG + Exonic
1084466719 11:69327660-69327682 GGTGGAAAAACAGGTGATGGTGG + Intronic
1084513998 11:69625839-69625861 TGTGGAAAATCAGGAGGGGTGGG - Intergenic
1085189103 11:74602370-74602392 GCAGGAAAAGCAGGTGTTGAGGG - Intronic
1085597353 11:77821480-77821502 GCTGGAAAAGCAGGATCTGAGGG + Intronic
1085983101 11:81748793-81748815 GGAGGAGAAGGAGGAGGAGAAGG - Intergenic
1086071594 11:82805673-82805695 GGTGGAAGAGGAGGAAGTGGAGG + Intergenic
1086885821 11:92204688-92204710 GGTGGAAAAAGAGGAGGGAAAGG - Intergenic
1087424514 11:97970499-97970521 GGTGGAACTGGAGGAGCTGAAGG + Intergenic
1087802620 11:102520164-102520186 GCAGGAAAATCAGGAGGTGAGGG + Intergenic
1089495764 11:118908018-118908040 GGTGGGAAAGCAGGAGGGGAAGG + Intronic
1089573575 11:119425438-119425460 GGTGGGAAAACAGGAGATGGTGG - Intergenic
1090160023 11:124482745-124482767 GGTGGAGAAGCAGAAGCAGAGGG - Intergenic
1090993839 11:131846884-131846906 GGTAGAAAATCAGGAAGGGAGGG + Intronic
1091016534 11:132056026-132056048 GGTAGAAAAGTATGAGGTGTGGG + Intronic
1091359144 11:134961095-134961117 GGAGGAGGAGCAGGAGGAGAAGG - Intergenic
1091563098 12:1629555-1629577 GCTGGAGAAGCAGGAGGGCACGG + Intronic
1091603181 12:1930072-1930094 GGGGGAGAAGGAGGAGGTGGAGG + Intergenic
1091676123 12:2491442-2491464 GGAGGAAAAGGAGGAGGAGGAGG + Intronic
1091687371 12:2572903-2572925 GGAGGAAGAGGAGGAGGAGAAGG - Intronic
1091687392 12:2572990-2573012 GGAGGAGAAGAAGGAGGAGAAGG - Intronic
1091968671 12:4767098-4767120 GGTGAAGAAGCGGGAGGGGAGGG - Intronic
1092037556 12:5350448-5350470 TCTGTACAAGCAGGAGGTGAAGG + Intergenic
1092200747 12:6581080-6581102 AGTGGAAAAGGCAGAGGTGAAGG - Exonic
1092284401 12:7120545-7120567 GTAGGTACAGCAGGAGGTGAAGG - Intergenic
1092908549 12:13124542-13124564 GGAGAAAGGGCAGGAGGTGATGG + Intronic
1092965061 12:13633415-13633437 GGGAGAAAAGTAGGAGGTAATGG + Intronic
1093481811 12:19612107-19612129 GGTGGATTAGCAGTAGGTGGGGG + Intronic
1093595315 12:20951849-20951871 GGTGGAACTGGAGGAGTTGATGG + Intergenic
1093790270 12:23241405-23241427 TGTGGCAAAGCAGGAGTGGAGGG + Intergenic
1094077378 12:26491990-26492012 TGTGGAAATGAAGGAGGTCAGGG + Intronic
1094370577 12:29733309-29733331 GGTGAGAAAGGAGGACGTGAAGG - Intronic
1094539320 12:31349970-31349992 GGTGTAGATGCAGTAGGTGACGG - Intergenic
1095168420 12:39003227-39003249 AATGGAAAAGCAGAAGGGGATGG - Intergenic
1095618800 12:44224525-44224547 GGAGGAAGAGAAGGAGGAGAAGG - Intronic
1095975854 12:47940779-47940801 GATTGAAATGGAGGAGGTGAGGG + Intronic
1096059611 12:48685668-48685690 GGTGGAAGAGAAGGAAGTGAAGG - Intergenic
1096122524 12:49097481-49097503 TATGGAAAAGCAGGAGGTCCTGG + Exonic
1096848691 12:54421503-54421525 AGAGGAAAGGCAGGAGGTGTTGG - Intergenic
1097548040 12:61029322-61029344 GGTGGAGAAGGAGAAGGAGAAGG - Intergenic
1097744082 12:63280520-63280542 GGATGAAAAGGAGGAGGAGAGGG + Intergenic
1098174235 12:67774349-67774371 GGTGGAAAAGCTGGGGGTGGGGG + Intergenic
1098506073 12:71251876-71251898 GGAGGAAAAGGAGGAGGAGGAGG + Intronic
1098701323 12:73631224-73631246 GGTGGAAGAGAAGGAGGAGGGGG + Intergenic
1098965366 12:76782440-76782462 AGTGGAAAAGCTGGAAGAGAGGG + Intronic
1099061410 12:77914609-77914631 GGTGAAAAAGCAAGAAGTAAAGG - Intronic
1099247323 12:80208691-80208713 GATGGAAAAACAGGGTGTGAAGG + Intergenic
1099501260 12:83417318-83417340 GTTGGAAAAGCAGGTGGTTATGG - Intergenic
1100021470 12:90074670-90074692 GGAGGAAGAGAAGGAGGAGAAGG - Intergenic
1100550696 12:95644217-95644239 GGAGGAGAAGAAGGAGGGGAAGG - Intergenic
1100881537 12:99023468-99023490 GGAGGAAGAGCAGGAGGAGGAGG - Intronic
1100881541 12:99023486-99023508 GGAGGAAGAGCAGGAGGAGGAGG - Intronic
1101038884 12:100733902-100733924 CCTGGAAAAGCTGGAGGTCAAGG + Intronic
1101239639 12:102825002-102825024 GGTGGAAAAGCGCAAGGTGAGGG + Intergenic
1101439005 12:104688949-104688971 GGAGCAAGAGGAGGAGGTGAAGG + Intronic
1101782752 12:107850060-107850082 GGTGGAGAAGAAGGAGGAGCAGG - Intergenic
1101941817 12:109104839-109104861 GGTGTATCAGCAGGAGGTAACGG + Intronic
1102848381 12:116213231-116213253 GGTGGACAAGAAAGAGGGGAGGG + Intronic
1102970372 12:117161551-117161573 GGAGGACAAGCAGGAGGCCAGGG + Intronic
1103220774 12:119242759-119242781 GGAGGAAACTCAGAAGGTGATGG - Intergenic
1103804331 12:123560624-123560646 GGAGGAAAAGGAGGAGGAGATGG - Intergenic
1104153375 12:126106738-126106760 AGTGGAAAGGAAGGTGGTGAAGG + Intergenic
1104225820 12:126832092-126832114 GGAGGAGAAGAAGGAGGAGAAGG - Intergenic
1104665679 12:130646053-130646075 GGTGGAGAGGCAGGTGGTGAGGG - Intronic
1104665697 12:130646113-130646135 GGTGGAGAGGCAGGTGGTGAGGG - Intronic
1104665704 12:130646137-130646159 GGTGGAGAGGCAGGTGGTGAGGG - Intronic
1104665711 12:130646161-130646183 GGTGGAGAGGCAGGTGGTGAGGG - Intronic
1104665729 12:130646221-130646243 GGTGGAGAGGCAGGTGGTGAGGG - Intronic
1104665746 12:130646281-130646303 GGTGGAGAGGCAGGTGGTGAGGG - Intronic
1104665779 12:130646389-130646411 GGTGGAGAGGCAGGTGGTGAGGG - Intronic
1104749917 12:131231828-131231850 GGAGGAAGAGGAGGAGGAGAAGG - Intergenic
1104776882 12:131394832-131394854 GGAGGCCAAGCAGGAGGTGTGGG - Intergenic
1104794217 12:131505850-131505872 GGAGGAACAGAAGGAGGTGTGGG + Intergenic
1105014326 12:132776951-132776973 CGTGGGAAACCAAGAGGTGACGG - Exonic
1105246757 13:18659778-18659800 GGTGGCCAAGCATGAGGTGTTGG - Intergenic
1105428209 13:20313885-20313907 GGTGTAAGAGCAGATGGTGAGGG - Intergenic
1105863481 13:24438375-24438397 GGCTGCACAGCAGGAGGTGAGGG - Intronic
1105950941 13:25229121-25229143 TGTGGAAAGGCAGGGGGAGACGG - Intergenic
1106338134 13:28803352-28803374 GGTGGCAAAGCAGCAGCGGAAGG + Intergenic
1106794366 13:33189401-33189423 GGAGGGAAAGCAGGAGGAAAGGG - Intronic
1106794383 13:33189442-33189464 GGAGGGAAAGCAGGAGGAAAGGG + Intronic
1107382172 13:39868505-39868527 GGAGGAAAAGGAGGAGGAGGAGG - Intergenic
1107595995 13:41963597-41963619 GTTGGCAGAGCAGGAGGAGAAGG + Intergenic
1109158831 13:58946644-58946666 GTTGGAAAATTAGGAGGTAAAGG + Intergenic
1110041287 13:70762373-70762395 GGAGGAGAAGGAGGAGGAGAAGG + Intergenic
1110509351 13:76330693-76330715 GGTGGAAAAGCAGAACCTGGTGG + Intergenic
1110590105 13:77246547-77246569 GGAGGAGGAGCAGGAGGAGAAGG + Intronic
1110658490 13:78029539-78029561 AGAGGAGAGGCAGGAGGTGAGGG + Intergenic
1110680728 13:78309062-78309084 TGTAGAAAAGTGGGAGGTGAGGG + Intergenic
1110802264 13:79712436-79712458 TGTGGAGAAGCAGGAGATAATGG + Intergenic
1110822525 13:79933444-79933466 GTTGGAAAAGCAGGCAGTAAGGG - Intergenic
1111851330 13:93579443-93579465 GGAGAAAAAGGAGGAGGAGAAGG + Intronic
1112288413 13:98124214-98124236 GCTGGAAATGGTGGAGGTGACGG - Intergenic
1112622604 13:101067179-101067201 AGTGGAGAAGGAGGAGGTGGGGG + Intronic
1112636774 13:101225156-101225178 GGTGGACAAGGAGGAGGCCAGGG - Intronic
1113267313 13:108633967-108633989 AGTGGAACAGAGGGAGGTGAGGG - Intronic
1113366770 13:109683730-109683752 GGAGGAGAAGGAGGAGATGAAGG + Intergenic
1113769654 13:112899855-112899877 GGTGGAAAAGATCCAGGTGAGGG - Intronic
1113909790 13:113836515-113836537 GGAGGAAGAGGAGAAGGTGAGGG + Intronic
1114187353 14:20413156-20413178 GGTGAGAAAGGAGGAGGAGAAGG - Intronic
1114355738 14:21906016-21906038 GGAGGAAAAGTAGAAGGAGAAGG + Intergenic
1114447239 14:22798323-22798345 GGAGGAAAAGGAGAAGGAGAAGG + Intronic
1115270782 14:31549943-31549965 GGAGGAAGAGAAGGAGGAGAAGG - Intronic
1115321303 14:32082119-32082141 GGCTGCACAGCAGGAGGTGAGGG - Intronic
1115524113 14:34262354-34262376 GGAGGAAAAGAAGGAAGAGATGG - Intronic
1115872488 14:37820872-37820894 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1115872495 14:37820902-37820924 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1115872498 14:37820914-37820936 GGAGGAGAAGAAGGAGGAGAAGG - Intronic
1116394426 14:44430576-44430598 GGTGGAGAAGGAGGAGGAGTGGG - Intergenic
1117187094 14:53251024-53251046 GGAGGAGGAGCAGGAGGAGAAGG - Intergenic
1117342615 14:54805010-54805032 AGTGGCAAAGCAGGATGTGGGGG - Intergenic
1117646701 14:57860752-57860774 GCTGGAAAGGTAGGAGGTGGTGG - Intronic
1117695076 14:58353513-58353535 GGAGGAGAAGAAGGAGGAGAAGG - Intronic
1118411149 14:65479646-65479668 GAAGGAAAAACAGGAGGGGAGGG - Intronic
1118904202 14:70011595-70011617 GGAGGAACAGAAGGAGGTGATGG - Intronic
1118961577 14:70538174-70538196 GGTGGAGAAGGAGGAGGAGTGGG - Intergenic
1119216873 14:72876063-72876085 GGAGGAAGAGAAGGAGGAGAAGG + Intronic
1119472109 14:74906807-74906829 CCTGGAAAAGCTGGAGGTGGGGG - Exonic
1119501160 14:75128391-75128413 TCTGAAAAAGCAGGATGTGATGG + Intergenic
1119703119 14:76768496-76768518 GGTGGAGACGCAGGAGGGAAGGG - Intronic
1119770258 14:77216243-77216265 GGAGGAAAAGCAGGAGAGGGTGG - Intronic
1120472036 14:84937967-84937989 GGAGGAGAAGAAGGAGGAGAAGG + Intergenic
1120874271 14:89362258-89362280 GGTGGAGGAGGAGGAGGTGGTGG - Intronic
1120874316 14:89362405-89362427 GGTGGAGGAGGAGGAGGTGGTGG - Intronic
1121246925 14:92467687-92467709 GGAGGAAAAGTAGGAGGTAAAGG + Intronic
1121546501 14:94767498-94767520 GGGGAAGAAGCAGGAGGTGTCGG + Intergenic
1121958912 14:98240625-98240647 GGGTGAGAGGCAGGAGGTGAGGG - Intergenic
1122322289 14:100862282-100862304 GGAGGAGAAGCAGGAGGAGGAGG - Intergenic
1122829148 14:104387224-104387246 GCTGGAAACACAGGAGGTGAAGG + Intergenic
1122907095 14:104806636-104806658 GGTGGTAGAGGTGGAGGTGATGG - Intergenic
1122907123 14:104806783-104806805 GGTGGTGAAGGTGGAGGTGATGG - Intergenic
1123681906 15:22769667-22769689 GGTGCGAAAGCAGGAGGAGCAGG - Intergenic
1123681966 15:22770021-22770043 GGTGCAGAAGCAGGAGGAGCAGG - Intergenic
1124029735 15:25999607-25999629 GGAGGAAAAGGAGGAGGAGGAGG - Intergenic
1124342612 15:28899997-28900019 GGTCGGAGAGCAGGAGGTGAGGG + Intronic
1124421500 15:29527059-29527081 GGGGGAAAAGCAGGAGGGTGTGG - Intronic
1124466964 15:29948923-29948945 GTTGGAAGAGGAGGAGGTGGTGG - Intronic
1124500240 15:30221923-30221945 AGTGAACAAGCAGGAGCTGAGGG - Intergenic
1124743335 15:32316743-32316765 AGTGAACAAGCAGGAGCTGAGGG + Intergenic
1125609421 15:40960592-40960614 GTTGGAGAAGCAGAAGGTGTGGG + Intergenic
1126646892 15:50883629-50883651 GGTCACACAGCAGGAGGTGATGG + Intergenic
1127349258 15:58134182-58134204 GGTGGAAAAGAAAAAAGTGAAGG + Intronic
1128081025 15:64856991-64857013 GCTGGAGAAGCAGGGGGAGAGGG - Intronic
1128721142 15:69949326-69949348 TGAGGAAAAGGAGGAGGTGCGGG - Intergenic
1129172680 15:73817623-73817645 GCTGGCGAAGCAGGAGGAGAAGG + Intergenic
1129229541 15:74189148-74189170 CGAGGACAAGCAGGAGGTGGTGG - Exonic
1129426279 15:75465499-75465521 GGTGTTAAAGGAGGAGGTAAAGG - Exonic
1130319702 15:82830872-82830894 GGTGGAGGAGGAGGAGGTGGTGG - Exonic
1130529304 15:84733990-84734012 GAAGGAAAAGGAGGAGGAGAAGG + Intergenic
1130959845 15:88652430-88652452 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1131082051 15:89545085-89545107 GGAGGAGAAGGAGGAGGAGAAGG - Intergenic
1131339531 15:91584168-91584190 GGAGGAGAAGGAGGAGGAGAAGG - Intergenic
1131663013 15:94538803-94538825 GGAAGAAAAGCAGGAGTTTAAGG + Intergenic
1131716126 15:95112700-95112722 GGTGGGAAAGCAGAAGGAAATGG + Intergenic
1131870297 15:96756903-96756925 GGAGGAAAAGGAGGAGGAGGAGG + Intergenic
1131870303 15:96756924-96756946 GGAGGAAAAGGAGGAGGAGGAGG + Intergenic
1132033352 15:98457511-98457533 GGCTGCACAGCAGGAGGTGAGGG - Intronic
1132050079 15:98600376-98600398 GGAGGAGGAGCAGGAGGTGGCGG - Intergenic
1132105235 15:99058622-99058644 GCTGGAAAAGCAGGGGCGGAGGG + Intergenic
1132372635 15:101308990-101309012 GGTGGACAGCCAGGAGGTTACGG + Intronic
1132532719 16:461275-461297 GGAAGCACAGCAGGAGGTGAGGG - Intronic
1132539935 16:504049-504071 GGGGGTACAGGAGGAGGTGAGGG - Intronic
1132539954 16:504106-504128 GGGGGTACAGGAGGAGGTGAGGG - Intronic
1132539992 16:504221-504243 GGGGGTACAGGAGGAGGTGAGGG - Intronic
1132539999 16:504241-504263 GGGGGTACAGGAGGAGGTGAGGG - Intronic
1132540006 16:504261-504283 GGGGGTACAGGAGGAGGTGAGGG - Intronic
1132540014 16:504282-504304 GGGGGTACAGGAGGAGGTGAGGG - Intronic
1132540043 16:504376-504398 GGGGGTACAGGAGGAGGTGAGGG - Intronic
1132540072 16:504471-504493 GGGGGTACAGGAGGAGGTGAGGG - Intronic
1132540108 16:504586-504608 GGGGGTACAGGAGGAGGTGAGGG - Intronic
1132540140 16:504684-504706 GGCGGTACAGGAGGAGGTGAGGG - Intronic
1132540152 16:504724-504746 GGGGGTATAGGAGGAGGTGAGGG - Intronic
1132540201 16:504874-504896 GGGGGAGCAGGAGGAGGTGAGGG - Intronic
1132596336 16:752211-752233 GGGGGAAAAGCAGGGGCCGAGGG - Intronic
1132676693 16:1124034-1124056 GATTTAACAGCAGGAGGTGAGGG + Intergenic
1133034389 16:3026901-3026923 GGTCTATAAGCACGAGGTGAGGG + Exonic
1133392403 16:5420935-5420957 GGAGGAAAAGCAGGAGGAAGGGG - Intergenic
1133404068 16:5509199-5509221 GGTGCAAGAGCAGGAAGTGTTGG + Intergenic
1133437736 16:5794309-5794331 TGAGGAAAAAAAGGAGGTGAAGG - Intergenic
1133874757 16:9723257-9723279 GGAGGAAGAGGAGGAGGAGAAGG + Intergenic
1134749360 16:16613633-16613655 GGAGGGAAAGAAGGAGGTCAGGG + Intergenic
1134849931 16:17471027-17471049 GGAGGAAAAGGAGGAGGGAAAGG + Intergenic
1134996111 16:18739990-18740012 GGAGGGAAAGAAGGAGGTCAGGG - Intergenic
1135264373 16:21009937-21009959 GGAGGAAAAGAAGGAAGGGAAGG + Intronic
1135623695 16:23977280-23977302 TGGGGAAAAGCAGGTGGTGGAGG + Intronic
1135671853 16:24382262-24382284 GGTGGAGAAGGAGGAGGGGGAGG - Intergenic
1135747770 16:25031906-25031928 GGTGGAAAAGCAGGAGGTGAAGG - Intergenic
1135946294 16:26867811-26867833 GGAGGAAAAGGAGGAGGAGGAGG + Intergenic
1135963414 16:27016378-27016400 GGAGGAGAAGCAGGAGGAGGAGG - Intergenic
1135979039 16:27132293-27132315 GCTGGTAAAGTTGGAGGTGAGGG - Intergenic
1136015729 16:27399551-27399573 GGAGGAATAGTAGAAGGTGAAGG - Intergenic
1136021791 16:27445196-27445218 GGAGGAGAAGCAGCAGGTGAGGG - Exonic
1136081292 16:27854177-27854199 GGAGGAAGAGGAGGAGGGGAAGG + Intronic
1136271842 16:29153314-29153336 GGAGGGAAAGCGGGAGGGGACGG - Intergenic
1136347393 16:29684951-29684973 GGTGGGACAGCAGGAGGGGGCGG - Intronic
1136417341 16:30112225-30112247 GGAGGAGGAGAAGGAGGTGAAGG + Intronic
1136600767 16:31285990-31286012 GATGGAGGAGCAGGAGGTGTGGG - Intronic
1136632671 16:31498094-31498116 GGGGGAAGAGGAGGAGGTGGTGG + Intronic
1136656042 16:31709923-31709945 AGAGAAAAAGCAGGAGGTTAGGG - Intergenic
1136938532 16:34499377-34499399 GGTCAAAAAGCAGCAGGTGTGGG + Intergenic
1136961286 16:34849180-34849202 GGTCAAAAAGCAGCAGGTGTGGG - Intergenic
1137398738 16:48135863-48135885 GGACAAAAAACAGGAGGTGAAGG - Intronic
1137416536 16:48287199-48287221 TCTGCAAAAGCAGGAAGTGAAGG - Intronic
1137859317 16:51830449-51830471 GGAGGAAGAGGAGGAGGGGAGGG - Intergenic
1137978789 16:53053013-53053035 GGAGGAAGAGCAGGAGGAGGAGG - Intergenic
1137978794 16:53053034-53053056 GGAGGAGAAGCAGGAGGAGGAGG - Intergenic
1138112649 16:54337061-54337083 GGTGGAGCAGGAGGAGGAGAAGG + Intergenic
1138112674 16:54337154-54337176 GGAGGAGAAGGAGGAGGAGAAGG + Intergenic
1138112684 16:54337193-54337215 GGAGGAGAAGGAGGAGGAGAAGG + Intergenic
1138126144 16:54440378-54440400 GGAGGAGAAGGAGGAGGAGAAGG - Intergenic
1138209543 16:55151946-55151968 GGTAAGAAGGCAGGAGGTGAGGG + Intergenic
1138299634 16:55915366-55915388 GGAGGAAAAGAAGGAGGGAAAGG + Intronic
1138507202 16:57484359-57484381 GGGGGCAGAGCAGCAGGTGATGG - Intronic
1138520790 16:57569786-57569808 GGAGGAGATGGAGGAGGTGATGG - Intronic
1138868986 16:60858012-60858034 GGAGGAGAAGGAGGAGGAGAAGG - Intergenic
1139018112 16:62714803-62714825 GGAGGAAAAGGAGGAGGAGGAGG - Intergenic
1139182168 16:64761377-64761399 GGGGGAGAAGGAGGAGGAGAAGG + Intergenic
1139301664 16:65950052-65950074 GGTAGACAGGCAGAAGGTGAAGG + Intergenic
1139469757 16:67171839-67171861 GGTGGCAAGGCAGGAGCTGATGG + Intronic
1140054627 16:71515291-71515313 TGAGGAACAGCAGGAGGTGAGGG + Intronic
1140474814 16:75234574-75234596 GGGGGAGCAGCAGGAGGTGGTGG - Intronic
1140630647 16:76847941-76847963 GATGGCAGAGCAGGAGGTGGTGG + Intergenic
1140683055 16:77404156-77404178 GGAGGAAGAGGAGGAGGTGGAGG + Intronic
1140997867 16:80278629-80278651 GGAGGAAGAGAAGGAGGAGAAGG - Intergenic
1141105858 16:81233071-81233093 TGTGGAAAAGCAGGAAGATAAGG - Intergenic
1141155514 16:81594043-81594065 GGGGGAAGAGGAGGAGGAGAAGG - Intronic
1141775568 16:86120892-86120914 GGAGGAAGAGGAGGAGGAGAAGG - Intergenic
1141908247 16:87041624-87041646 TGTGGGAAAGCAGGATGTGGAGG - Intergenic
1142015090 16:87741340-87741362 GGTCGCACAGCAGGAGGTGAGGG + Intronic
1142175325 16:88642591-88642613 GGTGGACAAGCAGCAGGCAAGGG + Intergenic
1142194535 16:88733365-88733387 GGTGGACAGGCAGGAGGCCATGG + Exonic
1142614077 17:1124981-1125003 GTTGGCAAAGCAGGTGGGGAGGG + Intronic
1142927927 17:3257528-3257550 GGGGGAAGAGTAGGGGGTGAGGG - Intergenic
1143247763 17:5500621-5500643 GGTAAAGATGCAGGAGGTGATGG + Intronic
1143383361 17:6509912-6509934 GGTGGAAAAGCTGGAGATGAAGG - Intronic
1143717509 17:8785536-8785558 GGCTGAGGAGCAGGAGGTGAGGG + Intergenic
1143780091 17:9224779-9224801 GGAGGAACAGCAGGTGGGGATGG + Intronic
1144614049 17:16752109-16752131 GGCCGCACAGCAGGAGGTGAGGG + Intronic
1144742184 17:17590160-17590182 GGTGAAAATGCAGGAGCTGTAGG + Intronic
1144758483 17:17694314-17694336 GGTGGAGACGCACGAGGTGCGGG + Intronic
1144898661 17:18563558-18563580 GGCCGCACAGCAGGAGGTGAGGG - Intergenic
1145009744 17:19361300-19361322 TGTGGAAAACCAGGTGGCGAGGG - Intronic
1145079069 17:19879671-19879693 GGGGGAAAAGAGGGAGGTGGGGG - Intergenic
1145133714 17:20382161-20382183 GGCCGCACAGCAGGAGGTGAGGG + Intergenic
1147186511 17:38716187-38716209 GGTGGGAAAGCTGGAGGGGTCGG + Intronic
1147311048 17:39596428-39596450 GGTGGGGAAGCAGGAGGTGAGGG + Intergenic
1147585302 17:41651110-41651132 GCTGGAAAGGCAGGGGGTGGGGG + Intergenic
1147728162 17:42579714-42579736 TGTGGAAAGACAGGAGGTGTGGG - Exonic
1147860790 17:43521685-43521707 GATGGAAAAGCTGGAGGAAAAGG - Intronic
1148126797 17:45241486-45241508 GGTGGAGGAGCTGGAGGAGAAGG + Exonic
1148148241 17:45379506-45379528 GGTGGAAAAGGTGGGGCTGAGGG + Intergenic
1148485615 17:47988890-47988912 GGTGAGGAAGCAGGAGGTGGGGG + Intergenic
1148804392 17:50257086-50257108 GGTGGCAGAGCAGGAGGGTAGGG + Intergenic
1149504527 17:57183078-57183100 GGTGGGAGATCAGGAGGCGAGGG + Intergenic
1150191075 17:63239909-63239931 GGAGGAAGAGCAGGAGGAGGAGG + Intronic
1150391005 17:64789903-64789925 GGTGCAGAAGCAGGTGGTGGTGG + Intergenic
1150409787 17:64933957-64933979 GGTGCAGAAGCAGGTGGTGGTGG + Intergenic
1150582248 17:66484970-66484992 GAAGGAAAAGCAGGAGATAAAGG + Intronic
1150964175 17:69948488-69948510 GGAGGAGAAGGAGGAGGAGAGGG + Intergenic
1151131039 17:71896114-71896136 GGCCGCACAGCAGGAGGTGACGG + Intergenic
1151251032 17:72835394-72835416 GGGGGAAGAGGAGGAGGTGGAGG + Intronic
1151714324 17:75823702-75823724 GGTGAAAAGGCTGGGGGTGAGGG + Intronic
1151935244 17:77257269-77257291 GATGGGAATGGAGGAGGTGATGG - Intergenic
1152095884 17:78271424-78271446 GGAGGATGAGCAGGAGGTGGGGG + Intergenic
1152266280 17:79296844-79296866 GGAGGAGAAGCAGGAGGAGGGGG - Intronic
1152277051 17:79363968-79363990 GGTGGAAAAGGAGGGCGTGGTGG - Intronic
1152454543 17:80406071-80406093 TGTGTAAAAGCAGGAGGAAAGGG - Intergenic
1152613716 17:81328519-81328541 GGTGGACAGGCAGGGGGTGGGGG + Intronic
1152896487 17:82914317-82914339 GGTGGGAAAGCTGGAGTTGGGGG - Intronic
1153220119 18:2853822-2853844 GGTGGAATGGCAGGAGGGAAGGG + Intronic
1153416217 18:4848999-4849021 GGTTGAAAGGCAGGAGGTGGGGG - Intergenic
1153516818 18:5911491-5911513 GGTGGAAACTGAGGAGGTGGAGG - Intergenic
1153539280 18:6136448-6136470 TGCAGAAAAGCAGGGGGTGAGGG - Intronic
1153581515 18:6578584-6578606 AGTGGAAGAGCAGGAGATGGTGG + Intronic
1153853528 18:9121132-9121154 GGGGGAAAGGCAGGAAGTGTAGG + Intronic
1154110967 18:11567984-11568006 GGAGGAGAAGAAGGAGGAGAAGG + Intergenic
1154442100 18:14399344-14399366 GGTGGCCAAGCATGAGGTGTTGG + Intergenic
1154495835 18:14960124-14960146 GGAGGAGAAGCAGGAGGAGAAGG + Intergenic
1155577678 18:27265701-27265723 TGTGGATCAGGAGGAGGTGAGGG - Intergenic
1155708392 18:28845082-28845104 GGGGGCAAAGCTGGAGGTGGAGG + Intergenic
1155853748 18:30805794-30805816 GGTGAAGAAGCAGGTGCTGATGG + Intergenic
1156261301 18:35446924-35446946 CTTGGAGAACCAGGAGGTGAGGG - Exonic
1156305269 18:35873361-35873383 GGTGGAACTGGAGGAGCTGATGG - Intergenic
1156312908 18:35941093-35941115 GCTGGCAAGGCAGGAGCTGATGG - Intergenic
1156534170 18:37846959-37846981 GATGGAAGAGAAGGAGGAGATGG + Intergenic
1157423160 18:47562855-47562877 GGCCACAAAGCAGGAGGTGAGGG + Intergenic
1157434735 18:47658814-47658836 GGTGGAAGAGGAGGAGGAAAAGG - Intergenic
1157727962 18:49979281-49979303 AGTGGAAAAGGAGGAGGTGTTGG - Intronic
1157804031 18:50644782-50644804 GTTTGAAAAGCAGGAAGAGAGGG + Intronic
1158635761 18:59155772-59155794 GCTGGAAAAGAAGGACGTGGTGG + Exonic
1158894602 18:61901174-61901196 GCTGGAGCAGCAGGAGGGGAGGG - Intergenic
1158942797 18:62421289-62421311 TGGGGGAAAGCAGGTGGTGATGG - Intergenic
1159407132 18:68018793-68018815 GGAGGAAAAGGAGGAGGAGTGGG - Intergenic
1159687275 18:71438245-71438267 GGTGGATAAGCAGAAGGTATGGG + Intergenic
1159819313 18:73119741-73119763 GGTGGAGGAGCAGGAAGTGAGGG - Intergenic
1159877388 18:73827626-73827648 GGAGGAAAAGGAGGAGGAGAGGG + Intergenic
1159956224 18:74520111-74520133 GTTGGAAAAGGGTGAGGTGAGGG - Exonic
1160225885 18:77010112-77010134 GAAGGAAGAGCAAGAGGTGATGG + Intronic
1160242565 18:77133570-77133592 GGTGGAAGAGGAGGAGGTTGGGG + Intronic
1160595874 18:79973774-79973796 GGAGGACAAGCAGGAGATGGTGG - Exonic
1160939995 19:1615705-1615727 GGAGGAGAAGAAGGAGCTGAAGG - Exonic
1160971384 19:1769249-1769271 GGTGGAGGAGGAGGAGGTGCTGG + Intronic
1161284895 19:3463906-3463928 GGTGGAGAGGCTGGAGGGGAGGG - Intronic
1161415621 19:4145131-4145153 GGAGGAAAAGGAGGAGGAGGAGG + Intergenic
1161783947 19:6311657-6311679 GGAGGAGAAGGAGGAGGAGAAGG + Intronic
1161783953 19:6311687-6311709 GGTGGAAAAGTAGAAGGAGAAGG + Intronic
1162053117 19:8046870-8046892 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1162053120 19:8046882-8046904 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1162341180 19:10092254-10092276 GGAGGAAGAGGAGGAGGTGGAGG + Exonic
1162399090 19:10433832-10433854 GGTGGAAAAGCACGGGGAGCCGG + Intronic
1162422717 19:10574963-10574985 TGTGGAAAAGGAAGAGGTGGAGG - Exonic
1163000126 19:14362025-14362047 GGGAGAGAAGGAGGAGGTGAGGG + Intergenic
1163083004 19:14956902-14956924 TGTGGAAGAGCAGGAGGAGGAGG - Intronic
1163243075 19:16076256-16076278 GGAGGAAGAGGAGGAGGAGAAGG + Intronic
1163321271 19:16576434-16576456 GCTGGACAAGCAGGAGGCCAAGG - Exonic
1163508289 19:17720690-17720712 GGTGGAGATGGAGGAGGTGGAGG + Intronic
1163742552 19:19024801-19024823 TTTGGAAACGCAGCAGGTGAGGG + Exonic
1163989411 19:20984473-20984495 GGAGAAAAAGGAGGAGGAGAAGG - Intergenic
1164250143 19:23468766-23468788 GGAGGAAGAGGAGGAGGGGAAGG - Intergenic
1164250226 19:23469324-23469346 GGAGGAAGAGGAGGAGGAGAAGG - Intergenic
1164452414 19:28378220-28378242 AGGGGAAAAGGAGAAGGTGATGG - Intergenic
1164493098 19:28732178-28732200 GGTGGAGAAGGAGGAGGAGGAGG + Intergenic
1164507843 19:28874171-28874193 GGTGGAAGAGATGGAGGGGATGG + Intergenic
1164539966 19:29115069-29115091 GGTGAAGAAGCAGGAGAGGAAGG - Intergenic
1164567949 19:29341808-29341830 GCTGAACAAGCAGGAAGTGAAGG + Intergenic
1164816993 19:31211794-31211816 GGTGACAAAGCAGGAGCTGCAGG + Intergenic
1164893220 19:31842948-31842970 GGAGGAAAGGCAGGAGATGCTGG - Intergenic
1164897943 19:31893623-31893645 GGAGGAGAAGGAGGAGGAGAAGG + Intergenic
1164897948 19:31893644-31893666 GGAGGAGAAGGAGGAGGAGAAGG + Intergenic
1164897971 19:31893815-31893837 GGAGGAGAAGGAGGAGGAGAAGG + Intergenic
1165016191 19:32881866-32881888 GAAGGACAAGCAGGAGGTGCTGG - Exonic
1165392361 19:35545866-35545888 CCTGGAGAAGCGGGAGGTGAGGG - Exonic
1165467913 19:35986029-35986051 GGTTGAACAGCAGCAGGAGATGG - Intergenic
1165473439 19:36016269-36016291 GGGGGAAAGGCTGGGGGTGATGG - Intronic
1165996799 19:39849354-39849376 GCTGGAGAGACAGGAGGTGACGG - Intergenic
1166226031 19:41396037-41396059 GGGGGAAAACAGGGAGGTGATGG - Intronic
1166335873 19:42106829-42106851 GGAGGAGGAGCAGGAGGAGAAGG + Intronic
1166788928 19:45386051-45386073 GGTGGTGCAGCAGGCGGTGAAGG - Exonic
1166882891 19:45940033-45940055 GGTGGAGTACCAGGAGCTGACGG - Exonic
1167195531 19:48025677-48025699 GGAGGAGAAGGAGGAGGAGAAGG - Intergenic
1167390819 19:49193847-49193869 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1167532342 19:50025900-50025922 GCTGAAGAAGCAGGAGGAGATGG + Exonic
1167603760 19:50469153-50469175 GCTGGAGGTGCAGGAGGTGAGGG - Intronic
1167665430 19:50820686-50820708 GGTGAAAAAGGCGGAGGGGAGGG + Intronic
1167686465 19:50959886-50959908 GGAGGAAGAGGAGGAGGAGAAGG + Intronic
1167827587 19:51987750-51987772 GGAGGAAGAGGAGGAGGAGAAGG + Intergenic
1168110036 19:54187093-54187115 GGAGGTAAAGTGGGAGGTGAAGG + Intronic
925277499 2:2660922-2660944 GCTGTGGAAGCAGGAGGTGAAGG + Intergenic
925507435 2:4584162-4584184 GGTGGAGGAGCAGGAGGTGGGGG - Intergenic
925727234 2:6884945-6884967 GGTGGAAAATCAGCAGCTTATGG - Intronic
926001308 2:9335164-9335186 GGTTGAACAGAAAGAGGTGAGGG + Exonic
926224301 2:10956222-10956244 CGAGGAAAAGCAGGAGGCGTTGG + Intergenic
926229446 2:10991721-10991743 GGTGGAAGAGGAGGAGGAGGAGG + Intergenic
926399151 2:12478006-12478028 GTTGAAAAAGCAGGAAGTCATGG + Intergenic
926434139 2:12821495-12821517 GGAGGAAGGGCAGGAGGTGGAGG - Intergenic
926524379 2:13958308-13958330 GGTGGAAGAGTGGGAGGGGATGG + Intergenic
926558305 2:14386563-14386585 GGAGGAGAAGCAGGAGGGGGAGG + Intergenic
927587180 2:24318512-24318534 TGTGGACCAGGAGGAGGTGATGG - Intronic
927634954 2:24807116-24807138 GGTGGAAAAGGAAGAGGGGGAGG - Intronic
927848716 2:26485674-26485696 GGTGGAAGAGGAGGGAGTGAAGG - Intronic
927989639 2:27438660-27438682 GGTAGAAAAGGAGGCGGTGGTGG + Intronic
928608106 2:32962954-32962976 TGTGGAAAGGGAGGAGGAGATGG - Intronic
928980939 2:37134644-37134666 GGTGGTCAAGGAGGAGGTCAAGG - Intronic
929819623 2:45262751-45262773 GGTGGACAGGGAGGAGGAGATGG - Intergenic
930664664 2:54090268-54090290 AGTAGAAAAGCAGGAGATAAAGG - Intronic
931277607 2:60756989-60757011 GGTGGGGAAGCAGGGGGTGAGGG - Intronic
931356110 2:61538542-61538564 GGTCGAAAGGCAAGAGGAGAGGG + Intronic
931693910 2:64858262-64858284 GCTGGCCAAGCAGGAGGGGACGG - Intergenic
931844107 2:66185038-66185060 GAAACAAAAGCAGGAGGTGAGGG + Intergenic
932311460 2:70745578-70745600 GCTGGGAAAGCAGGAGGGGCAGG + Intronic
932493585 2:72135915-72135937 GGTCCAAAAGCAGGGGGAGATGG + Intronic
932781472 2:74561135-74561157 GGAGGAGAAGGAGGAGGAGAAGG + Intronic
933997538 2:87680608-87680630 GGAGGAAGAGTAGGACGTGAGGG + Intergenic
934652316 2:96099733-96099755 GGAGGAGAAGGAGGAGGTGGAGG + Intergenic
934784669 2:96996268-96996290 GGAGGAAGAGAAGGAGGAGAAGG - Intronic
934790424 2:97055213-97055235 GTTGGAAAAGCAGGAGGAAGAGG - Intergenic
935024473 2:99263055-99263077 GGTGGAATGGCAGAAGGTGGAGG + Intronic
936296314 2:111270304-111270326 GGAGGAAGAGTAGGACGTGAGGG - Intergenic
936379444 2:111970844-111970866 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
936855114 2:116948345-116948367 GGAGGAATAGGAGGAGGGGAAGG + Intergenic
937063112 2:118994777-118994799 GGTGGTGAGGCAGAAGGTGAAGG + Intergenic
937635938 2:124155303-124155325 GGTTGAAGAGCAGTAGCTGAAGG - Intronic
937833541 2:126448474-126448496 AGTGAAAACACAGGAGGTGAAGG - Intergenic
939102097 2:137907116-137907138 GGTGGCCAAGCAGGAGGTGTTGG - Intergenic
939462909 2:142519660-142519682 GGAGGAGATGGAGGAGGTGAAGG + Intergenic
940026286 2:149211962-149211984 TGTAGATAAGCAGGAGGTGGTGG + Intronic
940641361 2:156347655-156347677 GGAGTAAAAGCTGGAGGTGGGGG - Intergenic
940899895 2:159117034-159117056 GGTGGAAAGGCAGAGTGTGAGGG - Intronic
940918482 2:159283728-159283750 GGCTGCACAGCAGGAGGTGAGGG - Intronic
940990053 2:160087601-160087623 GGTGGAACTGGAGGAGCTGATGG + Intergenic
941384990 2:164841541-164841563 GCTGGAAAAGGAGGAGGAGCGGG + Intronic
941439414 2:165514719-165514741 GGAGGAGGAGCAGGAGGAGAAGG - Intronic
941697994 2:168573757-168573779 GGTGGAGCAGGAGTAGGTGAGGG + Intronic
941710691 2:168709544-168709566 GGTAGAATAGCAGGAGGTTGAGG + Intronic
941858259 2:170252176-170252198 TGTGGAAAGGAAGGGGGTGAAGG - Intronic
942074295 2:172342489-172342511 GGAGGAAGAGCAGGAGGAGGAGG - Intergenic
942390938 2:175492412-175492434 GGTGAAAGAGAGGGAGGTGAGGG + Intergenic
942501194 2:176592487-176592509 GGTGGGAAAGCACGCGGTGAGGG + Intergenic
944102667 2:196045195-196045217 GGAGGAAAAGGAGGAGGAGGAGG + Intronic
944518377 2:200536660-200536682 GATGGAGAAGCTGGAGGTGAAGG + Intronic
944626510 2:201575070-201575092 GGAGGAAGAGGAGGAGGAGAAGG + Intronic
945195046 2:207229690-207229712 GGTGGAAAAAGAGGAGGAGAAGG - Intergenic
945436191 2:209820587-209820609 GGTGGAGATGGAGGAGGTGGAGG + Exonic
945677086 2:212868677-212868699 TCTGGAAATGCAGGAGGAGAGGG + Intergenic
946502781 2:220267424-220267446 GGTAGCACAGCAGGAGGTGAGGG - Intergenic
947430127 2:230020829-230020851 GGTGAAATAGAAGGAGGTAAGGG - Intergenic
947450971 2:230208603-230208625 GAGCAAAAAGCAGGAGGTGAGGG + Intronic
947517939 2:230823414-230823436 TGTGGAGAAAAAGGAGGTGAGGG + Intergenic
947653956 2:231810461-231810483 GGTGAGGTAGCAGGAGGTGAGGG + Intergenic
947714551 2:232333144-232333166 GGAGGAGAAGGAGGAGGTGGTGG - Intronic
947736421 2:232457684-232457706 GCTGGCAAAGCACCAGGTGATGG + Exonic
948219143 2:236255537-236255559 GCTGGTAAAGCAGGAGAGGAGGG + Intronic
948486613 2:238285326-238285348 GGAGGAAAAGCAGCTGGTGGGGG + Intronic
948845922 2:240682796-240682818 GGTGGCAAAGAAGAAGGAGAGGG + Exonic
948847935 2:240691933-240691955 GGTGGCAAAGAAGAAGGAGAGGG - Exonic
948939175 2:241187681-241187703 GGAGGAGAAGGAGGAGGAGAGGG + Intergenic
949041764 2:241852883-241852905 GTTGGAGAAGCTGCAGGTGAAGG + Exonic
1168867672 20:1102948-1102970 GAAGGAGAAGCAGGAGGAGAAGG - Intergenic
1168966798 20:1903656-1903678 GGTGGGAAAGAAGCTGGTGAAGG - Intronic
1169297673 20:4414039-4414061 GGAGGAAAAGCCGGAACTGATGG - Intergenic
1169706175 20:8507590-8507612 GGTAGAAAAGCAGGATTTAATGG + Intronic
1169906405 20:10609076-10609098 GGAGGAAGAGGAGGAGGAGAAGG + Intronic
1169946682 20:10996514-10996536 GGCTGCACAGCAGGAGGTGAGGG + Intergenic
1169975983 20:11328375-11328397 GTGGGGAAAGCAGGAGCTGATGG + Intergenic
1170017276 20:11796001-11796023 GGAGGAGAAGCAGGAGGAGAAGG - Intergenic
1170304832 20:14926809-14926831 GCTGCAAAAGCAGGGGGTGTGGG + Intronic
1170501811 20:16982429-16982451 GGGAGAAAAGCAGGAGGGAAGGG - Intergenic
1170986456 20:21263746-21263768 GGAGGAGAAGGAGGAGGAGAAGG + Intergenic
1172043024 20:32059350-32059372 GGAGGAAGAGGAGGAGGAGAAGG - Intronic
1172061446 20:32189903-32189925 GGTGGAGAAGCAGCAGGAGGGGG - Intergenic
1172327737 20:34050049-34050071 GATGGAACAGCAGGAGCTGATGG - Intronic
1172666165 20:36601786-36601808 GAAGGAAAAGAGGGAGGTGAAGG - Intronic
1173006688 20:39145180-39145202 GGTGCAGGAGCAGGAAGTGATGG + Intergenic
1173134204 20:40424910-40424932 GGAGGAGAAGGAGGAGGGGAAGG + Intergenic
1173304124 20:41831662-41831684 GGTGGAAAAGTAGGATGTATAGG + Intergenic
1173307339 20:41862966-41862988 ATAGGAAAAGCAGGAGCTGAAGG - Intergenic
1174102178 20:48136208-48136230 AGAGAAGAAGCAGGAGGTGATGG + Intergenic
1174430968 20:50468635-50468657 GGAGGAAGAGGAGGAGGAGAAGG - Intergenic
1174563652 20:51448964-51448986 AGTGGAAAAACAGTAGGAGAGGG - Intronic
1174639344 20:52029790-52029812 GGAGGAAAAGGAGGAGGAGGGGG - Intergenic
1175028254 20:55926317-55926339 GGTGGCAAACCAGGAGTTCAAGG - Intergenic
1175298838 20:57928591-57928613 GGAGGAGAAGGAGGAGGAGAAGG - Intergenic
1175298846 20:57928624-57928646 GGAGGAAAAGGAGGAGGAGGAGG - Intergenic
1175403406 20:58713057-58713079 GGAGGAAGAGCAGGAGATGCGGG - Intronic
1175491531 20:59383861-59383883 GGTGGGGGAGAAGGAGGTGATGG + Intergenic
1175690135 20:61059185-61059207 GGTGGATGCTCAGGAGGTGAAGG - Intergenic
1175891848 20:62319195-62319217 GGAGGCACTGCAGGAGGTGAGGG - Intronic
1175959239 20:62626636-62626658 GCTGGAAGAGCAGGAGGGGGAGG - Intergenic
1176028700 20:62999783-62999805 GGTCGGAAAGCAGGAAGTGCTGG + Intergenic
1176453971 21:6891828-6891850 GGTGGCCAAGCATGAGGTGTTGG - Intergenic
1176832146 21:13756876-13756898 GGTGGCCAAGCATGAGGTGTTGG - Intergenic
1177046423 21:16175749-16175771 GGTAGAAAGGCATGAGGGGATGG - Intergenic
1178151000 21:29793523-29793545 GGGGGAGAAGGAGGAGGAGAAGG - Intronic
1178356494 21:31913785-31913807 GGGGGAGAAGCAGGAGGTGTGGG + Intronic
1178373670 21:32048967-32048989 GGTGGAAAAGGAGGAGGAAGAGG + Intergenic
1178962905 21:37084257-37084279 GGAGGAAAACCAGGAGAAGATGG + Exonic
1179071291 21:38073548-38073570 GGTGGGAAAGGAGGAGGACATGG + Intronic
1179185385 21:39081722-39081744 GGAGGAAAAGGAGGAGGAGAAGG + Intergenic
1179231670 21:39509333-39509355 GGTGGAAAAGGACGAGGAGCAGG - Intronic
1179939298 21:44627908-44627930 GGGGGCACAGCAGGAGGAGACGG - Exonic
1179942137 21:44647213-44647235 GGGGGCACAGCAGGAGGAGACGG - Exonic
1180068834 21:45426017-45426039 GGTGGGGAAGCAGGAGGGGGCGG - Intronic
1180588931 22:16919321-16919343 GTTGGAAAAGCAGGAGGAAGAGG + Intergenic
1180971669 22:19819227-19819249 GCTGGGTAAGCAGGAGGTGGCGG - Intronic
1180999058 22:19979489-19979511 GGTGTGAAGGCAGGAGGTGAGGG + Intronic
1181358542 22:22317569-22317591 GGTGGAACAGCTCCAGGTGAAGG + Intergenic
1181393807 22:22603800-22603822 ACTGGATAAGCAGGAGGAGAAGG + Intergenic
1181850081 22:25743613-25743635 GGAGGAAGAGGAGGAGGAGAGGG + Intronic
1182312449 22:29418907-29418929 GTGGGAAAGGCAGCAGGTGATGG - Intronic
1182712648 22:32332285-32332307 GGAGGAAGTGCAGGAGGGGACGG - Intergenic
1183187186 22:36298890-36298912 GGGTGACGAGCAGGAGGTGATGG - Intronic
1183679257 22:39317606-39317628 GGTGAACAAGAAGGAGGTGGTGG - Exonic
1183747177 22:39698614-39698636 GGAGGTAAAGGAGGAGGTGATGG - Intergenic
1183747208 22:39698705-39698727 GGAGGCAAAGGAGGCGGTGATGG - Intergenic
1183747223 22:39698764-39698786 GGAGGTGAAGGAGGAGGTGATGG - Intergenic
1183747250 22:39698853-39698875 GGAGGTGAAGGAGGAGGTGATGG - Intergenic
1183747257 22:39698876-39698898 GGAGGTGAAGGAGGAGGTGATGG - Intergenic
1183747270 22:39698922-39698944 GGAGGTGAAGGAGGAGGTGATGG - Intergenic
1183747281 22:39698956-39698978 GGAGGTGAAGGAGGAGGTGATGG - Intergenic
1183747288 22:39698979-39699001 GGAGGTGAAGGAGGAGGTGATGG - Intergenic
1183747326 22:39699136-39699158 GGAGGTGAAGGAGGAGGTGATGG - Intergenic
1183919133 22:41149971-41149993 GGTGGCATGGCAGGAGGTGTAGG - Exonic
1184013543 22:41767894-41767916 GGAGGAGATGGAGGAGGTGAAGG + Intronic
1184309836 22:43634007-43634029 AGAGGAGAAGCAGGAAGTGAGGG + Intronic
1184449757 22:44575956-44575978 GGAGGAAGAGAAGGAGGAGAAGG + Intergenic
1184537080 22:45094556-45094578 GGAGGAAGAGCAGGAGGAGGAGG - Intergenic
1184581602 22:45421783-45421805 AGAGGAAGAGTAGGAGGTGAAGG - Intronic
1184600213 22:45539063-45539085 GGGGGAAGAGGAGGAGGAGAAGG - Intronic
1184715597 22:46280117-46280139 GCAGGAAAAGCAGGCTGTGATGG + Intronic
1184928411 22:47660811-47660833 GGAGGAAGAGGAGGAGTTGAAGG - Intergenic
1185227863 22:49663470-49663492 GTTGGACGAGCAGGACGTGATGG + Intergenic
949934478 3:9106318-9106340 GTTGGAAAGGCAGGATGTGAGGG + Intronic
949973652 3:9434304-9434326 GGGGGAGAAGCAGGAGGTGTCGG - Intronic
950049867 3:9979733-9979755 AGTGCATAACCAGGAGGTGATGG + Intronic
950283305 3:11725199-11725221 GGAGGAGAAGGAGGAGGAGAAGG - Intergenic
950520537 3:13495284-13495306 GGTGGGAGAGTGGGAGGTGAAGG - Intronic
950969235 3:17170039-17170061 GGCTGCACAGCAGGAGGTGAGGG - Intronic
951040863 3:17987686-17987708 GGTGGGGAAGCTGGAGGTGTAGG + Intronic
951289695 3:20860655-20860677 GGCAGAAAAGTTGGAGGTGAAGG + Intergenic
951806990 3:26656347-26656369 GGTGGTAAAGTGGGAGGGGAAGG + Intronic
952198309 3:31098942-31098964 GTAGGAGAAGTAGGAGGTGAGGG - Intergenic
952358878 3:32610215-32610237 GGGGGAAAAACTGGAGGTGAAGG - Intergenic
952904057 3:38128198-38128220 GGTAGAAAAGGAGCAGGGGAGGG + Intronic
952924015 3:38308211-38308233 GGAGGAAGAGGAGGAGGTGGTGG + Intronic
953354825 3:42246741-42246763 GGGAGAAACACAGGAGGTGAAGG + Intergenic
954145156 3:48630847-48630869 GGTGGGAGAGCAGGACGTGTGGG - Intronic
954752190 3:52819918-52819940 GGTGACAAAGTAGGAGGTGGGGG - Exonic
955536994 3:59934372-59934394 GGTTGAATAGCAGGGGGTGCAGG - Intronic
955651605 3:61200483-61200505 GGAGGACAAGCAGGTGGTTAAGG + Intronic
955851007 3:63219834-63219856 GGTGGCAGAGGTGGAGGTGAAGG + Intergenic
955996771 3:64686808-64686830 GGAGGAAGAGGAGGAGGCGAAGG + Exonic
956524726 3:70145052-70145074 GGGAGCAAAGCAGGAGGTAAGGG - Intergenic
956733502 3:72217951-72217973 GCTGCAAAATCAGGAGGTGCCGG + Intergenic
957040570 3:75332618-75332640 GGTGGAACATCCGGTGGTGAGGG + Intergenic
957834355 3:85567917-85567939 TGTGGAAGGGCAGGAGGAGAAGG + Intronic
957899918 3:86476141-86476163 GGAGGAAGAGGAGGAGGAGAAGG + Intergenic
958133234 3:89456646-89456668 GGTGGAAAAGCTGATGGTCAGGG + Intronic
958428776 3:94012738-94012760 GATGGAAGAGGAGGTGGTGATGG - Intronic
958643685 3:96841143-96841165 GGTGGAACAACTCGAGGTGAAGG + Intronic
958683487 3:97361532-97361554 GGTTGAAAAGTAGAAGGTCAAGG + Intronic
958795875 3:98705677-98705699 AATGGAAAAGAAGGAGGTGGAGG + Intergenic
958878447 3:99641757-99641779 GGTTGAAGAGAAGGAGGTCAAGG - Intronic
958907925 3:99962143-99962165 GCTGGAAAGGCTGAAGGTGAGGG + Intronic
958947076 3:100375392-100375414 GGCTGAAGAGTAGGAGGTGAGGG - Intronic
958962549 3:100523742-100523764 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
958979718 3:100707382-100707404 TGTGGAAAAGCTGGAGCTCATGG - Intergenic
959152850 3:102628647-102628669 GATGGCCAATCAGGAGGTGAAGG + Intergenic
959948868 3:112155763-112155785 GGTGAAAGAGCAGACGGTGAAGG + Intronic
960134734 3:114093891-114093913 GGAGGACAAGGAGGAGGTGAGGG - Intergenic
960407196 3:117276397-117276419 GGAGGCAAAATAGGAGGTGAAGG - Intergenic
960525349 3:118703767-118703789 GGTGGAAAAGGAAGAGATGGGGG - Intergenic
960584755 3:119310474-119310496 GGCTGCACAGCAGGAGGTGAGGG + Intronic
960694526 3:120383152-120383174 GTTAGAAAACCAGAAGGTGAGGG + Intergenic
961011737 3:123440867-123440889 GGTGGTAAAACAGGATGAGAGGG - Intronic
961045841 3:123707435-123707457 GTTGGAAAAGCAGGGGGATAGGG - Intronic
961170550 3:124794832-124794854 GGAGGAGAAGGAGGAGGAGAAGG + Intronic
961356052 3:126340720-126340742 GCTGAAAAAGCAGGTGGAGATGG - Intergenic
961426654 3:126853636-126853658 GGTGGACAAGCAGGTGTTGATGG - Intronic
961427776 3:126861620-126861642 GGTAGTAGAGGAGGAGGTGATGG - Intronic
961427956 3:126862166-126862188 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961427981 3:126862259-126862281 GGTAGAGGAGGAGGAGGTGATGG - Intronic
961428018 3:126862397-126862419 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428031 3:126862442-126862464 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428066 3:126862562-126862584 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428115 3:126862721-126862743 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428121 3:126862742-126862764 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428149 3:126862835-126862857 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428155 3:126862856-126862878 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428189 3:126862973-126862995 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428195 3:126862994-126863016 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428237 3:126863147-126863169 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428268 3:126863240-126863262 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428294 3:126863336-126863358 GGTAGAGGAGGAGGAGGTGATGG - Intronic
961428350 3:126863546-126863568 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428404 3:126863735-126863757 GGTGGAAGAGGAGGTGGTGATGG - Intronic
961428410 3:126863759-126863781 GGTGGTGGAGGAGGAGGTGATGG - Intronic
961428425 3:126863828-126863850 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428437 3:126863873-126863895 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428454 3:126863942-126863964 GGTGGAGGAGGAGGTGGTGATGG - Intronic
961428603 3:126864525-126864547 GGTGGAGAAGGAGGAGGAGGTGG - Intronic
961428610 3:126864549-126864571 GGTGGAGAAGGAGGAGGAGGAGG - Intronic
961428621 3:126864588-126864610 GGTGGAGGAGAAGGAGGTGGTGG - Intronic
961428628 3:126864612-126864634 GGTGGAGGAGAAGGAGGTGGTGG - Intronic
961428727 3:126865051-126865073 GGTGGAAAAGGAGGAGGAGGAGG - Intronic
961428750 3:126865135-126865157 GGTGGAAAAGGAGGTGGTGGTGG - Intronic
961428772 3:126865219-126865241 GGTGGAAATGGAGGTGGTGGTGG - Intronic
961584594 3:127911518-127911540 GGTGGAAAACAAGGAGGGAATGG - Intergenic
961822766 3:129583687-129583709 GGTGGGGAACCAGGAGTTGAGGG - Intronic
962403003 3:135077614-135077636 GGTGGGGTAGCAGGAGCTGAAGG + Intronic
963098738 3:141576382-141576404 GGTGGTGAAGCAGATGGTGAGGG - Intronic
963327348 3:143877130-143877152 GGAGGAAAAGGAGAAGGTGTGGG - Intergenic
963461584 3:145620633-145620655 TGTTGAAAAGGAGGATGTGAAGG + Intergenic
963751093 3:149180820-149180842 GGTGGAAGAGCAGGTTGTAAAGG - Intronic
963897620 3:150703694-150703716 GGGGGAAGAGCAGGAGTTGGAGG - Exonic
963908373 3:150793253-150793275 AGTGGCAAAGCAGGAAGAGATGG + Intergenic
964445422 3:156752698-156752720 GGAGGAAGAGGAGGAGGTGGGGG + Intergenic
964835140 3:160929879-160929901 GCTGGAAGAGCAGAAGCTGAAGG - Intronic
965354033 3:167651697-167651719 GTTGGAAAAGCAGGAACTAATGG - Intronic
965451587 3:168845435-168845457 GGAGGAAAAGGACGAGGAGATGG - Intergenic
965451603 3:168845521-168845543 GGAGGAAAAGGACGAGGAGAAGG - Intergenic
965541014 3:169871363-169871385 GGTGGAAAAGAAGAAGGAAAGGG + Intergenic
966908550 3:184544683-184544705 GGGGGAGAAGGAGGAGGAGAAGG - Intronic
967038392 3:185665484-185665506 GGAGGAGAAGGAGGAGGAGAAGG + Intronic
967038407 3:185665541-185665563 GGAGGAGAAGGAGGAGGAGAAGG + Intronic
967268539 3:187713764-187713786 GGCAGAAAAGCAGGAGGGGTGGG + Intronic
967674392 3:192278681-192278703 AGTGGAAAACCAAGAGCTGATGG + Intronic
967949308 3:194828680-194828702 GCTGGGAAAGGAGGTGGTGATGG + Intergenic
968359919 3:198139657-198139679 GGAGGACAAGGAGGAGGTGAAGG + Intergenic
968359947 3:198139753-198139775 GGGGGAGAAGGAGGAGGAGAAGG + Intergenic
968738074 4:2309228-2309250 GGCAGAGAAGCAGGAGGGGAAGG - Intronic
968868668 4:3229857-3229879 TGTGGAAAACCAGGAGGGCAAGG - Intronic
968889167 4:3358891-3358913 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
969047553 4:4347709-4347731 GGTTGACAGGCAGGAGGAGAGGG - Intergenic
969095130 4:4727120-4727142 GCTGGAACAGGAGGAGGAGAGGG - Intergenic
969154239 4:5196125-5196147 GATGGAAATGCAGGTGGAGAGGG + Intronic
969158672 4:5235957-5235979 GGGGGACCAGCAGGAGGGGATGG + Intronic
969979532 4:11140489-11140511 GGAGGAGAAGGAGGAGGGGAAGG - Intergenic
970239845 4:13997299-13997321 GGAGGAGGAGGAGGAGGTGAAGG - Intergenic
970384022 4:15538018-15538040 AGTGATAGAGCAGGAGGTGAGGG + Exonic
970476342 4:16427670-16427692 GTTGGCAGAGCAGGAGTTGAAGG + Intergenic
970974389 4:22026113-22026135 GGCAGAAAAGGAGGAGGAGAAGG - Intergenic
971003716 4:22351236-22351258 TCTGGCAAAGCAGGAGGTCAGGG + Intronic
971132467 4:23827855-23827877 GGGGAGAAAGCAGGAGGTGAAGG + Intronic
971586004 4:28406728-28406750 GCTAGAAAAGTAGGAGGAGATGG + Intergenic
971589764 4:28452405-28452427 GGTAGAAAAGTAGGAGGAGGTGG - Intergenic
972281491 4:37606113-37606135 GGAGGAGAAGGAGGAGGAGAAGG + Intronic
972404593 4:38733929-38733951 GGTGGTAATGGAGGTGGTGATGG + Intergenic
972687875 4:41368715-41368737 GGTGGTAGGGCAGGGGGTGAAGG + Intronic
972867085 4:43246122-43246144 GGTGGAAAAGCTAGTGGGGATGG - Intergenic
973106201 4:46341664-46341686 TTTGCAAAAGCAGGAAGTGAAGG - Intronic
973133172 4:46673325-46673347 GGAGGAGAAGCAGCACGTGAAGG - Intergenic
973573705 4:52265233-52265255 ACTGGAACAGCAGGATGTGAAGG + Intergenic
973613503 4:52658759-52658781 GGGGGATAAGCTGGAGGTGGGGG - Intronic
973826109 4:54708932-54708954 GGAGGAAAACCAGGAGATGGGGG + Intronic
973826944 4:54717480-54717502 GGTGGAAAAGCAGGAGAAACAGG + Intronic
973981900 4:56314615-56314637 GCTGGAACAGCAGGAGGCGGAGG + Exonic
974713913 4:65640744-65640766 TGTGCACAAGCAGGAAGTGAAGG - Intronic
974878802 4:67729492-67729514 GGAGGAAAACCAGGAGGAGATGG + Intergenic
975388547 4:73788225-73788247 GGAGGAAAAGGAGGAGGAGGAGG + Intergenic
975388584 4:73788408-73788430 GGAGAAAAAGGAGGAGGAGAAGG + Intergenic
975405846 4:73988253-73988275 GGTAGGAAAGGAGGAAGTGAGGG + Intergenic
975763057 4:77636474-77636496 GGGGCAAAACCTGGAGGTGAAGG - Intergenic
975800975 4:78058718-78058740 GGAGGAAAACCAGGAGGCGGAGG - Intronic
976012700 4:80510552-80510574 GGTGGAAAAGCAGTCAGTGTTGG - Intronic
976268437 4:83206800-83206822 GGTGGACAAGGAGGAGGTCAGGG - Intergenic
976315808 4:83657565-83657587 GTTGGAGAATCAGGAGGTCATGG + Intergenic
977143639 4:93407843-93407865 GAAGGAGAAGCAGGAGGTGGAGG - Intronic
977666979 4:99653636-99653658 GGAGGAAAAGGAGGAGGGGGAGG - Exonic
977934383 4:102784744-102784766 GGTGGAGGAGGAGGAGGTGGTGG - Intergenic
978289610 4:107121701-107121723 GATAGAAAAGCAGGAGTTAATGG + Intronic
978302372 4:107285350-107285372 GGTGGCAAAGCAGAAGGGGTTGG + Intergenic
978344301 4:107750651-107750673 GGAGGAAGAGGAGGAGGAGAAGG - Intergenic
979154779 4:117370990-117371012 GGAGGAAAAGGAGGAGGAGGAGG - Intergenic
979799829 4:124894817-124894839 GGTGGAAAGTCAGGGGGAGAGGG - Intergenic
979878400 4:125923324-125923346 GGAAGAAAAGCTGGAGTTGAAGG - Intergenic
980018932 4:127684690-127684712 GGAGAAAAAGAAGGAGGTGGAGG - Intronic
980981423 4:139657575-139657597 GGAGGAAGAGGAGGAGGAGAAGG + Intergenic
981571720 4:146158739-146158761 GGTGGAAGAGGTGGAGGAGATGG - Intergenic
981902817 4:149886862-149886884 GGAGGAGAAGCAGGAGCTGACGG - Intergenic
982120112 4:152135106-152135128 GGAGGAAAAGAGGAAGGTGAGGG - Intergenic
982132944 4:152246916-152246938 GGGGGAAAACAAAGAGGTGAGGG - Intergenic
982716467 4:158814066-158814088 GGAAGAAAAGGAGGAGGAGAAGG - Intronic
982821399 4:159944465-159944487 GGAGGAAGAGGAGGAGGAGATGG - Intergenic
983295051 4:165856758-165856780 GGCTGCACAGCAGGAGGTGAGGG - Intergenic
983354909 4:166644651-166644673 TGTGGAAAAACAGTAAGTGAGGG + Intergenic
983901817 4:173143886-173143908 CGTGGAAGAGCAGGTGGAGACGG - Intergenic
984261412 4:177446911-177446933 AGTGCAAAAGCCGGAGGGGATGG - Intergenic
984725134 4:183013380-183013402 GGAGGAGAAGGAGGAGGAGAAGG - Intergenic
985690123 5:1304277-1304299 GGAGGAGAAGGAGGAGGTGGAGG - Intergenic
985819103 5:2147889-2147911 GGAGGAAGAGGAGGGGGTGATGG - Intergenic
985917232 5:2931510-2931532 GGTGGCACAGCTGGAGGGGAAGG - Intergenic
986192014 5:5506064-5506086 AGTGGAAAAGCAAGAGGAGGCGG + Intergenic
986392635 5:7300406-7300428 GGTGCGAAAGCAGGAGGAGCAGG - Intergenic
986583926 5:9294864-9294886 GGTGGAAGAGAAGGAGGGGAGGG - Intronic
986652596 5:9979432-9979454 AGTGGAGAGGCAGGAGGTGGTGG - Intergenic
987205864 5:15624976-15624998 TGGGAAAAAGCAGGAGGGGAGGG - Intronic
987447255 5:18035065-18035087 GGAAGAAAAGGAGGGGGTGAAGG - Intergenic
987903509 5:24046249-24046271 GGGGGAAAAGAGGAAGGTGAAGG - Intronic
987952462 5:24692878-24692900 GGAGGAAGAGGAGGAGGAGAAGG + Intergenic
988211988 5:28215860-28215882 GGAGGAGAAGAAGGAGGTGGGGG - Intergenic
988545866 5:32156817-32156839 GGTTGCACAGCAGGAGGTGAGGG - Intronic
988553320 5:32216242-32216264 GGCTGCACAGCAGGAGGTGAGGG + Intergenic
989087973 5:37695913-37695935 GTTGCAGGAGCAGGAGGTGAGGG - Intronic
989335229 5:40308476-40308498 GGATGAAAAGCAGGAGGTCAAGG + Intergenic
989606417 5:43248417-43248439 GGTTGAAAAGCAAGAGATGCAGG + Intronic
989623745 5:43410196-43410218 GGTGGAAAACCAAGTGGGGAGGG - Intronic
989731867 5:44658577-44658599 GGTGGAAAAGATGGAGGAGGTGG + Intergenic
989812532 5:45695715-45695737 GGTGGAAAAGGAGCAGGAAAGGG - Exonic
990325777 5:54673992-54674014 GCTGTGAAAGCAGGAGGTCAAGG - Intergenic
990548354 5:56846407-56846429 GGAGAAAAAGCAGGAGGTGAAGG - Intronic
991090067 5:62685676-62685698 GGGGGAAAAGCAGAAAGTGGGGG + Intergenic
991440183 5:66638919-66638941 GGGGGAAAAGCAGTAGTTAAGGG + Intronic
991444748 5:66687218-66687240 GAGGGAAAAGAAGGGGGTGAAGG - Intronic
991633765 5:68682505-68682527 GGTGGAAAAGGGTGAGGTGAGGG - Intergenic
992013618 5:72555179-72555201 GGAGGAAAAAAAGGGGGTGAGGG - Intergenic
992199325 5:74368324-74368346 GGAGGAAAAGGAGGAGGAGGAGG + Intergenic
993502172 5:88676374-88676396 GGTGGAAGAGGAGGAGGAGGAGG - Intergenic
994043601 5:95284613-95284635 GGAGGAGAAGCAGGAGGAGGAGG - Intergenic
994710956 5:103263215-103263237 GGAGGAAGAGCAGGAGGAGGAGG - Intronic
994710961 5:103263236-103263258 GGAGGAAGAGCAGGAGGAGGAGG - Intronic
994816268 5:104591774-104591796 GGTGGAGAAGGAGGAGGGGCAGG - Intergenic
994816999 5:104597328-104597350 GGTGAACAAGGAGGAGGTTAGGG - Intergenic
996728584 5:126695083-126695105 GCTTGAAACCCAGGAGGTGAAGG + Intergenic
996812922 5:127540117-127540139 GATGGGAAATCAAGAGGTGACGG + Intronic
996967165 5:129320253-129320275 GGTGGAAAACAAGGAGGGGCAGG + Intergenic
997517582 5:134501905-134501927 GGTGGGAAGGCAGGAGTTAATGG + Intergenic
997672619 5:135688685-135688707 AGTGGAAAAGCAGGCCCTGAAGG + Intergenic
997759888 5:136434777-136434799 GGTGGCACACCAGCAGGTGAAGG - Intergenic
997777279 5:136621975-136621997 GGAGGAAAAGGAGGAGAAGAAGG - Intergenic
997889187 5:137659994-137660016 GGTGGAGGAGGAGGAGGAGAAGG - Intronic
998020749 5:138768155-138768177 AGTGGGAAAGCTGGAAGTGAAGG - Intronic
998163642 5:139827976-139827998 GGTGGAAGAGCAGGAGATGGGGG + Intronic
999261531 5:150241632-150241654 GGAAGAAAAGAAGGAGGAGAGGG - Intronic
999283871 5:150382541-150382563 GGTGGAAATGCTGGTGGTGATGG - Intronic
999289224 5:150412720-150412742 GGAGGAGAAGCAGGAGCTGTCGG - Exonic
999341779 5:150779139-150779161 GGAGAAAAAGGAGGGGGTGAGGG - Intronic
999589920 5:153133620-153133642 GGTGGAAAAGGAGGAGGTAATGG - Intergenic
1000152151 5:158513839-158513861 GGAGGAGAAACAGGAGGGGAGGG + Intergenic
1000172095 5:158712343-158712365 GGGGGCAAAACCGGAGGTGAGGG + Intronic
1000369844 5:160524494-160524516 TGTGGAAAGGAAGGAGATGAAGG + Intergenic
1000627427 5:163555217-163555239 GAAGGATGAGCAGGAGGTGAAGG - Intergenic
1000881334 5:166701100-166701122 GGTGGAAGAGGAGGAGGAGAAGG + Intergenic
1001481897 5:172094444-172094466 GGTGGGAACCCAGGAGGTGGAGG - Intronic
1001559410 5:172659457-172659479 GGAGGAGAAGCAGGCGCTGAGGG + Intronic
1001646852 5:173288538-173288560 GGTGCAAAGGCGGGAGGTGGGGG + Intergenic
1002163475 5:177331118-177331140 GGAGGAAAGGCAGCAGCTGAAGG - Intergenic
1002761906 6:209052-209074 TGTGGAGAAGAAGGAGGTGCAGG - Intergenic
1002866359 6:1125503-1125525 GATGGGAAGTCAGGAGGTGAGGG + Intergenic
1002899547 6:1399456-1399478 GGTGGAGGAGGAGGAGGAGAGGG + Intergenic
1002989825 6:2228313-2228335 GGAGGAAAAGGAGGACGTGAAGG - Intronic
1003127629 6:3368216-3368238 TGTGGAAGAGCAGGGTGTGAGGG - Intronic
1003145628 6:3508093-3508115 GGAGGCAATGCGGGAGGTGAAGG - Intergenic
1003516858 6:6825142-6825164 GATGGAAAATCAGGATGTGGTGG + Intergenic
1003532202 6:6947078-6947100 GGTGGAAAAGGTGGAGGAGGTGG - Intergenic
1003901922 6:10662464-10662486 GGTGATAAAACAGGAGGTGGTGG + Intergenic
1004253462 6:14041902-14041924 GATGGAGAGGCAGGAGATGAAGG - Intergenic
1004273842 6:14218364-14218386 GGTGGAAAATCAGAAGGAAAAGG - Intergenic
1004645654 6:17558428-17558450 GGCGGCAAAGCAGAAGATGAAGG + Intergenic
1005325073 6:24692179-24692201 GGAGGAAAACCAGGAGGAGGTGG + Intronic
1005639883 6:27785881-27785903 GGTGGAGATGCAGCAGGTTAAGG - Intergenic
1005673680 6:28132692-28132714 GCCAGGAAAGCAGGAGGTGAGGG - Intergenic
1006044191 6:31280514-31280536 GGTGAACAAGAAGGAGGTGGTGG + Intronic
1006367464 6:33623853-33623875 GGTGGAACATCAGGAGATGTTGG - Intronic
1006599051 6:35213825-35213847 GGTGGAGAAGGAGGAGGAGGAGG + Intergenic
1006932161 6:37695064-37695086 GCTGGAGAAGCTGGAGGGGATGG + Intronic
1007180592 6:39926720-39926742 GGAGGAAAAGAAGGGGGGGAAGG + Intronic
1007301479 6:40871095-40871117 GGTGGGAGTGCAGGTGGTGAAGG + Intergenic
1007424227 6:41736315-41736337 GGAAGAAAAGGAGGAGGGGAAGG - Intergenic
1007476576 6:42123522-42123544 GGTGGAGGAGGAGGAGGAGAAGG + Intronic
1007528906 6:42522719-42522741 GGTGGAAAAAAAGGAGGAGTGGG - Intergenic
1007546528 6:42698712-42698734 GCTGGAAAGGGAGGAGGAGAGGG - Intronic
1008171616 6:48214435-48214457 GGTGGAAGAGGAGGAAGTGGAGG - Intergenic
1008423928 6:51334516-51334538 GGAGAAAAAGAAGGAGGTGGAGG - Intergenic
1008423939 6:51334585-51334607 GGTGGAGAAGAAGGAGGAAAAGG - Intergenic
1008647992 6:53534675-53534697 GGTGGAAGAGATGGAGCTGAAGG + Intronic
1009218128 6:60947720-60947742 GCAGGAAAAGCAGGAGGGAAGGG + Intergenic
1009652816 6:66498438-66498460 GGAGGAGAAAGAGGAGGTGAAGG + Intergenic
1010198446 6:73262982-73263004 GGTAGGAATGAAGGAGGTGAGGG + Exonic
1010745688 6:79558917-79558939 GGAGGAGAAGAAGGAGGTGGTGG + Intergenic
1011301852 6:85883715-85883737 GGGGGAAAAGAGGGAGGTGGAGG - Intergenic
1011484731 6:87829910-87829932 GGAGGAGAAGGAGGAGGAGAAGG - Intergenic
1012631191 6:101469896-101469918 TGTGGAAAAGCAAGAGGTGAGGG + Intronic
1012872792 6:104691996-104692018 GGAGGAAGAGCAGGAGTGGAAGG + Intergenic
1013056611 6:106589244-106589266 GGAGGAGAAGGAGGAGGAGAAGG + Intronic
1013077702 6:106785809-106785831 GCTGGAAAAACAGCATGTGATGG - Intergenic
1013486178 6:110598430-110598452 GGAGGAACAAAAGGAGGTGATGG + Intergenic
1013606726 6:111757253-111757275 TGTTGAAGAGCAGGAGATGAAGG - Intronic
1014318296 6:119894188-119894210 GGTGGGAAGACAGGAAGTGACGG - Intergenic
1014383751 6:120776702-120776724 GGAGGGAAAAGAGGAGGTGAAGG - Intergenic
1014639963 6:123897381-123897403 TGTGGTAAACCAGCAGGTGAAGG - Intronic
1014923697 6:127244458-127244480 GGTGGAAAAACAGGAGCTAATGG + Intergenic
1014927094 6:127285634-127285656 AATGGAAGAGCAGGAGATGAAGG - Intronic
1014981833 6:127954119-127954141 GGTGGAAAAGAAGCAGATGATGG - Intergenic
1015084706 6:129276171-129276193 AGTGGAGAAGCTGGAGATGAGGG - Intronic
1015113418 6:129619402-129619424 AGGGGAAAAGGGGGAGGTGAGGG + Intronic
1015113432 6:129619444-129619466 GGAGGAAAAGGGGGAGGGGAGGG + Intronic
1016003686 6:139067772-139067794 GGAGGAGAAGGAGGAGGAGAGGG - Intergenic
1016161292 6:140883884-140883906 AGTGGAAGAGGAGGAGGAGAAGG - Intergenic
1016817064 6:148312844-148312866 GGAGGAGAAGGAGGAGGAGAAGG + Intronic
1016832473 6:148447633-148447655 GGAGGAAAAGGAGGAGGAGGAGG - Intronic
1016940772 6:149481456-149481478 GGTTGATAATCAGGAGGTGGAGG - Intronic
1016990765 6:149926139-149926161 GGTGGAAAAGAAGGATTGGAGGG + Intergenic
1017207845 6:151823253-151823275 GGTAGAAAAGCAGGTGGAAACGG - Intronic
1017953942 6:159162546-159162568 GGTGGAAAGGCAGAAAGGGACGG + Intergenic
1018630550 6:165818205-165818227 GGTGAATAAGGAGGAGGAGATGG - Intronic
1018973406 6:168545169-168545191 TGTGGAAAGGGAGGAGGAGATGG + Intronic
1019260042 7:76868-76890 GGAGGAGAAGGAGGAGGAGAAGG - Intergenic
1019260064 7:76965-76987 GGAGGACAAGGAGGAGGTGAAGG - Intergenic
1019324113 7:429629-429651 GGTGGAAACACAGCCGGTGAAGG - Intergenic
1019603033 7:1894797-1894819 GGAGGAAGAGCAGGAGTAGAGGG + Intronic
1019891999 7:3954489-3954511 AGAGGAGAAGCAGGAGGGGAGGG - Intronic
1019954938 7:4405919-4405941 GGAGGAAAATTAGGAGGAGAAGG + Intergenic
1020471378 7:8539153-8539175 GGTGGAAGGGGAGGAGTTGATGG + Intronic
1020584009 7:10042906-10042928 GTTAGAAGAGAAGGAGGTGAAGG + Intergenic
1021126509 7:16856343-16856365 GGAGGACAAGGAAGAGGTGAAGG + Intergenic
1022055490 7:26728967-26728989 GGTGGAAATGCATGAGGAGTGGG + Intronic
1022337045 7:29431811-29431833 GTTGGAAAAGCAGGGGCTGATGG - Intronic
1022624649 7:32022497-32022519 TGTGGAAAATCATGGGGTGATGG + Intronic
1022793651 7:33714560-33714582 GGAGGAGTAGCAGGAGGAGAAGG - Intergenic
1022793750 7:33715067-33715089 GGAGGAGAAGCAGGAGGAGCAGG - Intergenic
1023178226 7:37454344-37454366 GGTGGAACAGCTGGAGCAGAGGG - Intergenic
1023424434 7:40020474-40020496 GGGGGAACAGCAGGAGGGAAAGG - Intronic
1023737598 7:43248680-43248702 GGAGGAAAAGGAGGAGGAGGAGG - Intronic
1023737608 7:43248713-43248735 GGAGGAAAAGGAGGAGGAGGAGG - Intronic
1024139239 7:46445197-46445219 GGTGGCACAGCAGGAGGTAGAGG + Intergenic
1024237267 7:47408093-47408115 GGTAGAAGACCAGGAGGAGATGG + Intronic
1024569693 7:50713606-50713628 GGTGGAGGAGGTGGAGGTGATGG - Intronic
1024569706 7:50713645-50713667 GGTGGAGGAGGTGGAGGTGATGG - Intronic
1024570414 7:50718370-50718392 GGTGGATAAGGAGGAGTTGGAGG - Intronic
1024755115 7:52519877-52519899 GAAGGAAGAGAAGGAGGTGAGGG + Intergenic
1024846248 7:53646146-53646168 GGAGGAAGAGGAGGAGGAGAAGG - Intergenic
1024974532 7:55100970-55100992 GGTGGAAAAGCACCAGGTAAAGG - Intronic
1026245376 7:68615081-68615103 GGAGGAGAAGAAGGAGGAGAAGG + Intergenic
1026602790 7:71790520-71790542 AGAGGAAAAGGAGGAGGAGATGG - Intronic
1026606246 7:71818431-71818453 GGTGGGAAGGAATGAGGTGAGGG + Intronic
1026869887 7:73843958-73843980 GGTGTCCAGGCAGGAGGTGATGG + Intergenic
1028106744 7:86887752-86887774 TGTGGATCAGGAGGAGGTGAGGG - Intronic
1028119129 7:87037355-87037377 GAAGGAAAAGGAGGAGGTGGTGG - Intronic
1028151745 7:87381522-87381544 GGTGGAAAAGCAGATGGGGATGG - Intronic
1028160594 7:87480376-87480398 GGTGGTAGAGCTGGAGGTGCAGG - Intronic
1028250312 7:88532334-88532356 GGTAGAAGAGCAAGAGGTAAAGG + Intergenic
1028552195 7:92081385-92081407 GCTGGAAACCCAGGAGGTGGAGG - Intronic
1028606505 7:92661721-92661743 GTTGGAAGAGCTGGAGGTGGTGG + Intronic
1029094873 7:98077189-98077211 GGAGGAGGAGCAGGAGGAGAAGG + Intergenic
1029367280 7:100124786-100124808 GGAGGAAGAGCAGGAGGAGGAGG + Exonic
1029422095 7:100477177-100477199 GATGGAGAAGGAGGAGGAGAGGG + Intronic
1029813567 7:103072695-103072717 GCTGGAAACACAGGAGGTGGGGG - Intronic
1029921417 7:104268734-104268756 GGTGGAAAGTCATGAGGGGAGGG - Intergenic
1030058978 7:105608028-105608050 GCTGGAATAGCAAGAGATGATGG + Intronic
1030605376 7:111633807-111633829 GGTGGAGATGCAGGAGCTGTGGG + Intergenic
1030632631 7:111912599-111912621 GGAGGAAGAGGAGGAGGAGAAGG + Intronic
1030715770 7:112805155-112805177 GTTGGATAAGCAGGAGGAAAGGG - Intergenic
1031103218 7:117507627-117507649 GGTGGAGAAGCATGTGGGGAGGG + Intronic
1031258476 7:119485963-119485985 GGAGGAAAAGGAAGAGGAGAAGG - Intergenic
1031373429 7:120995915-120995937 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1032072293 7:128815676-128815698 GGAGGAAAAGAAAGAGGAGATGG + Exonic
1032258236 7:130313926-130313948 GGTGGACAAGGAGGAGGCCAGGG + Intronic
1032523177 7:132561531-132561553 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1032523180 7:132561543-132561565 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1032523453 7:132562735-132562757 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1032523470 7:132562801-132562823 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1032523473 7:132562813-132562835 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1032523706 7:132563790-132563812 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1032523709 7:132563802-132563824 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1032523712 7:132563814-132563836 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1032523732 7:132563903-132563925 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1032523739 7:132563936-132563958 GGAGGAAAAGGAGGAGGAGGAGG - Intronic
1032523755 7:132563994-132564016 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1032523758 7:132564006-132564028 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1032523761 7:132564018-132564040 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1032793984 7:135263023-135263045 GCTGGAAAAATAGGAGGTGGTGG + Intergenic
1032850775 7:135793319-135793341 AGTGGGAAAGGAGGAGATGAAGG - Intergenic
1033069233 7:138186820-138186842 GGAGCAAAAGAAGGAGGAGAAGG + Intergenic
1033595228 7:142854553-142854575 GAAGGAAAAGCAGGGGGTGGAGG - Intergenic
1033606860 7:142933834-142933856 GGAAGAAAAGGAGGAGGGGAAGG + Intergenic
1034885807 7:154798027-154798049 GTTTGAACAGGAGGAGGTGAGGG + Intronic
1035035399 7:155891209-155891231 GGTGGAATTGCTGGAGGTGGTGG + Intergenic
1035141461 7:156766697-156766719 GGTGGGCAAGCAGGAGGAGCAGG + Intronic
1035280617 7:157776051-157776073 GGAGGAAGAGGAGGAGGAGAGGG - Intronic
1035280794 7:157776752-157776774 GGAGGAAAGGTAGGAGGAGAGGG - Intronic
1035280803 7:157776785-157776807 GGAGGAAAGGGAGGAGGAGAGGG - Intronic
1035280835 7:157776887-157776909 GGGGGAGAAGGAGGAGGAGATGG - Intronic
1035419730 7:158717497-158717519 GGAGGAGAAGGAGGAGGAGAAGG - Intergenic
1035419779 7:158717738-158717760 GGAGGAGAAGGAGGAGGAGAAGG - Intergenic
1035419793 7:158717798-158717820 GGAGGAGAAGGAGGAGGAGAAGG - Intergenic
1035419812 7:158717886-158717908 GGAGGAGAAGGAGGAGGAGAAGG - Intergenic
1035889980 8:3332790-3332812 GTTGGAGCAGCAGGAGGTGAGGG - Intronic
1036213883 8:6863508-6863530 GGTGGGGAAGCTGGAGGGGAGGG + Intergenic
1036463475 8:8974682-8974704 GGAGGAAAAGAAGGAGGAGGAGG - Intergenic
1037165223 8:15819410-15819432 GGTGGAGAAGGATGAGGTGATGG - Intergenic
1037581321 8:20247446-20247468 GGTGGAAATGAAGGAACTGAGGG + Exonic
1038120390 8:24607972-24607994 GGAGGAAAAGGAGAAGGGGAGGG + Intergenic
1038244634 8:25843822-25843844 GATGGAAAAGGAGGGGGTGCAGG + Exonic
1038391939 8:27209985-27210007 TGGGGAAAAGAAGGAGGAGATGG - Intergenic
1038963377 8:32547378-32547400 AGTGGAAAAGCAGGCAGGGAGGG - Intronic
1039078136 8:33710847-33710869 AGTGGCAAAGCAGGAGGAGTGGG - Intergenic
1039357735 8:36839792-36839814 GGTGGAGAAGGATGAGGAGAGGG + Intronic
1039435954 8:37559394-37559416 GGAGGAAGAGGAGGAGGAGATGG + Intergenic
1039435969 8:37559481-37559503 GGAGGAAGAGGAGGAGGAGATGG + Intergenic
1039435987 8:37559565-37559587 GGAGGAAAAGAAGGAGGGGGAGG + Intergenic
1039435993 8:37559586-37559608 GGGGGAAAAGAAGGAGGAGATGG + Intergenic
1039436015 8:37559673-37559695 GGAGGAAAAGGAGGAGGGGGAGG + Intergenic
1039469025 8:37802324-37802346 GGTGGAAGAGAAGGGGGTGGAGG - Intronic
1039477406 8:37847038-37847060 GCTGCAAAAGAAGGAGGTGTTGG - Exonic
1039577074 8:38632277-38632299 GGAGGAGAAGCAGGAGGAAAAGG + Intergenic
1039736964 8:40343388-40343410 GGAGAGAAGGCAGGAGGTGAAGG - Intergenic
1039751878 8:40486256-40486278 GGAGGAGAAGGAGGAGGAGAGGG - Intergenic
1039757829 8:40542075-40542097 GGTGGAGAGGCCGGAGGGGAGGG + Intronic
1039914824 8:41852174-41852196 GGAGGGAAAGGAGGAGGTCACGG + Intronic
1040898460 8:52392347-52392369 GGTGATAAAGCAGGTGGTGATGG + Intronic
1041330527 8:56719335-56719357 GGAGGAGAAGTAGGAGGGGAAGG - Intergenic
1041695566 8:60732502-60732524 GGTGGAACAGAAGGAAGGGAAGG - Intronic
1042108816 8:65357100-65357122 AGTGCAAAAGCAGGAGGTCAAGG - Intergenic
1042679635 8:71368452-71368474 AGTGGGTAAGCAGAAGGTGAAGG + Intergenic
1042819824 8:72917866-72917888 GTTGGTAGAACAGGAGGTGAAGG + Intronic
1043889832 8:85643327-85643349 GGTGGCAAAGCAGCACGTGCGGG - Intergenic
1043891370 8:85655235-85655257 GGTGGCAAAGCAGCACGTGCGGG - Intergenic
1043892443 8:85662072-85662094 GGTGGCAAAGCAGCACGTGCGGG - Intergenic
1043893114 8:85715263-85715285 GGTGGCAAAGCAGCACGTGCGGG + Intergenic
1043895801 8:85736717-85736739 GGTGGCAAAGCAGCACGTGCGGG + Intergenic
1043896878 8:85745091-85745113 GGTGGCAAAGCAGCACGTGCGGG - Intergenic
1043899202 8:85763458-85763480 GGTGGCAAAGCAGCACGTGCGGG - Intergenic
1043900812 8:85775652-85775674 GGTGGCAAAGCAGCACGTGCGGG - Intergenic
1043902776 8:85790927-85790949 GGTGGCAAAGCAGCACGTGCGGG - Intergenic
1043904386 8:85803120-85803142 GGTGGCAAAGCAGCACGTGCGGG - Intergenic
1043905998 8:85815314-85815336 GGTGGCAAAGCAGCACGTGCGGG - Intergenic
1043907606 8:85827501-85827523 GGTGGCAAAGCAGCACGTGCGGG - Intergenic
1044041067 8:87368918-87368940 GAAGGAAAAGAAGGAGGGGAGGG - Intronic
1044934092 8:97277277-97277299 GGAGGAAAAGAAGGAAGAGAGGG - Exonic
1045320680 8:101079786-101079808 GCTGGAAGAGCAGCAGGGGAGGG + Intergenic
1045334014 8:101182144-101182166 GGCTGCACAGCAGGAGGTGAGGG - Intronic
1045642982 8:104272372-104272394 GGTGGGAAAGCAGGAATTCATGG + Intergenic
1046359036 8:113126653-113126675 GGAGGAAAAGCAGAAGGAGGAGG + Intronic
1046513074 8:115223121-115223143 GGTGGAAAAGCAGGAGGTTGTGG - Intergenic
1046889751 8:119409851-119409873 GTTGGAAAAGCAAGAAGTCAAGG + Intergenic
1047142695 8:122159178-122159200 AGAGGAAAAGAAGGAGGAGAAGG + Intergenic
1047301615 8:123618321-123618343 GGCGGCACAGCAGGAGGTGGGGG + Intergenic
1047731627 8:127733641-127733663 GGAGGCACAGCAGAAGGTGATGG - Intergenic
1047800208 8:128301285-128301307 GAGGGAAAAGGAGGAGGTGGAGG + Intergenic
1048234150 8:132674141-132674163 GGAGGAAGAGGAGGAGGAGAAGG + Intronic
1048234162 8:132674189-132674211 GGAGGAGAAGGAGGAGGAGAAGG + Intronic
1048407747 8:134140347-134140369 GGTTGCAAAGGAGGTGGTGAGGG - Intergenic
1048417438 8:134243146-134243168 GGAGGAAAAGGAGGAGGAGAAGG + Intergenic
1048417496 8:134243383-134243405 GGAGGAAAAGGAGGAGGAGGAGG + Intergenic
1048417533 8:134243527-134243549 GGAGGAGAAGGAGGAGGAGAAGG + Intergenic
1048417536 8:134243539-134243561 GGAGGAGAAGGAGGAGGAGAAGG + Intergenic
1048417551 8:134243608-134243630 GGAGGAGAAGGAGGAGGAGAAGG + Intergenic
1048417554 8:134243620-134243642 GGAGGAGAAGGAGGAGGAGAAGG + Intergenic
1048558065 8:135501134-135501156 GGTTTAAAGGCAGGAGGAGATGG - Intronic
1048608134 8:135991431-135991453 GGTGGAGCAGCAGGAGGAGGTGG - Intergenic
1049121998 8:140747579-140747601 GGGGGAAGAGGAGGAGGAGAAGG + Intronic
1049372187 8:142273189-142273211 TGAGGAAGAGGAGGAGGTGAAGG - Intronic
1049419332 8:142510082-142510104 GGAGGAAGAGGAGGAGGTGGAGG + Intronic
1049600438 8:143505074-143505096 GGTGGACACGCGGGAGGGGAGGG - Intronic
1049681566 8:143920913-143920935 GGTGGAGGAGCAGGAGCAGAAGG - Exonic
1049816707 8:144606615-144606637 GGAGGAGGAGGAGGAGGTGACGG + Intergenic
1050148818 9:2598761-2598783 AGAGGAAAAGGAGGAGGAGAAGG + Intergenic
1050308972 9:4333774-4333796 GGTGTAACAGCTGGAAGTGAGGG - Intronic
1051045691 9:12870889-12870911 GGTGGAAGAAGAGGAGGTAAAGG + Intergenic
1051247531 9:15126744-15126766 GGAGGAGAAGGAGGAGGAGAAGG + Intergenic
1051247534 9:15126756-15126778 GGAGGAGAAGGAGGAGGAGAAGG + Intergenic
1051247543 9:15126792-15126814 GGAGGAGAAGGAGGAGGAGAAGG + Intergenic
1051247548 9:15126813-15126835 GGAGGAGAAGGAGGAGGAGACGG + Intergenic
1051247557 9:15126849-15126871 GGAGGAGAAGGAGGAGGAGAAGG + Intergenic
1051738527 9:20228507-20228529 GATGGAAAATGGGGAGGTGAAGG + Intergenic
1051767815 9:20543653-20543675 GAAGGAAAAGAAGGAGGAGAAGG + Intronic
1052605137 9:30689435-30689457 GGTGGAAGAGGAGGAAGTGGAGG + Intergenic
1053223049 9:36327373-36327395 CGTGGAAAGGCAGGAGATGATGG + Intergenic
1053387936 9:37709706-37709728 GGTCCAAAAGATGGAGGTGAAGG + Intronic
1054850651 9:69843459-69843481 GGAGGAGAAGTAGGAGGGGAGGG - Intronic
1054914116 9:70480170-70480192 GGTGGCAAGGCGGGAGGGGAGGG - Intergenic
1055087451 9:72328521-72328543 CTTGGGAAAGCAGGTGGTGAGGG - Intergenic
1055143195 9:72899938-72899960 GGTGGTAACTGAGGAGGTGAGGG + Intergenic
1055506400 9:76954015-76954037 GCTGCAAGGGCAGGAGGTGAAGG + Intergenic
1055557134 9:77486192-77486214 GGTGAAACAGCAGGTGCTGATGG - Intronic
1055737780 9:79350726-79350748 GGTGGAGGAGGAGGAGGAGAAGG - Intergenic
1056182720 9:84101590-84101612 GGAGGAAAAAGAGGAGGAGAAGG - Intergenic
1056237003 9:84604590-84604612 GGAGGAAGAGAAGGAGGAGAAGG - Intergenic
1057091418 9:92261438-92261460 AGTGGGAAGGCAGGAGGGGAAGG + Intronic
1057697061 9:97330707-97330729 GGAGGAAGAGAAGGAGGAGAAGG + Exonic
1057852141 9:98574024-98574046 GGGGGAAAAGAAGGAGATCAGGG + Intronic
1057919748 9:99087459-99087481 CGTGGAAAAGAAGAAGGCGAGGG + Intergenic
1059113418 9:111578661-111578683 GGATGCACAGCAGGAGGTGAGGG - Intronic
1059365829 9:113785821-113785843 GGAAGAAAAGGAGGAGGTGGAGG + Intergenic
1059402070 9:114076818-114076840 GGAGGAAGAGGAGGAGGTGGAGG - Intronic
1059542525 9:115144378-115144400 GGAGGAAAAGGAGAAGGGGAGGG - Intronic
1059843861 9:118249127-118249149 GGAGGAAAAGCATGATATGATGG - Intergenic
1059968997 9:119645192-119645214 GGAGGAAAAGGAGGAGGAGGGGG - Intergenic
1060210547 9:121707503-121707525 GGGCGACAGGCAGGAGGTGATGG - Intronic
1060507598 9:124209638-124209660 GGAGTAAAGGCAGGAGGTAAGGG + Intergenic
1060526369 9:124323500-124323522 GGAGGAGGAGCAGGAGATGAAGG + Intronic
1061456341 9:130700768-130700790 GGAGGAAAAGATGGAGGTGTGGG + Intronic
1061624359 9:131832839-131832861 GGTGGAAAAGTAGGAAGATAAGG - Intergenic
1061848087 9:133399410-133399432 GGTCGAAGAGGAGGAGGGGAGGG - Intronic
1062043795 9:134416013-134416035 GATGGAACAGAAGGAGGTGGTGG + Intronic
1062572617 9:137192589-137192611 GGTGGACCAGCAGGAGGAGGAGG - Exonic
1062744623 9:138203477-138203499 GGAGGACAAGGAGGAGGTGAAGG + Intergenic
1062744654 9:138203594-138203616 GGGGGAGAAGGAGGAGGAGAAGG + Intergenic
1185523793 X:761368-761390 GAAGGAAAAGGAGGAGGAGAAGG - Intergenic
1185566730 X:1100355-1100377 AGAGGAAGAGCAGGAGGAGATGG + Intergenic
1185591578 X:1280934-1280956 GGAGGAGAAGCAGGAGGAGGAGG - Intronic
1185591608 X:1281053-1281075 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1185591620 X:1281097-1281119 GGAGGAGAAGGAGGAGGAGAAGG - Intronic
1185714477 X:2330179-2330201 GGAGGAGAAGCAGGAGGAGGGGG + Intronic
1185855001 X:3525655-3525677 AGAGGAAAAGCAGGAGATGAAGG + Intergenic
1185887089 X:3792563-3792585 GGAGGAAAAGGAGGAGGAGGAGG + Intergenic
1186034476 X:5406164-5406186 GGAGGAAAAAGAGGAGGAGAAGG + Intergenic
1186131079 X:6465858-6465880 GATGGAAGAGCAGGAGGAGGTGG - Intergenic
1186265131 X:7824362-7824384 GGCAGAAAAGCAGGAGGACAGGG - Intergenic
1186277866 X:7959496-7959518 GGAGGAAGAGGAGGAGGAGAAGG - Intergenic
1186730132 X:12401314-12401336 GGGGGAAAAGGAGGAGATGGAGG - Intronic
1187262322 X:17697275-17697297 GGTGGTGAGGCAGGAGTTGAAGG - Intronic
1187713574 X:22078557-22078579 GGTTAAAATGCATGAGGTGAGGG - Intronic
1187738686 X:22331144-22331166 ATTGGAAAAGCATGAGGTCAAGG + Intergenic
1188617691 X:32178982-32179004 GGAGGAGGAGCAGGAGGAGAGGG - Intronic
1188980176 X:36720388-36720410 GGAGGAGAAGAAGGAGGAGAAGG + Intergenic
1189081572 X:37978345-37978367 GGAGGAAAGACAGGTGGTGAGGG + Intronic
1189083065 X:37994703-37994725 GGAGGAGAAGGAGGAGGAGATGG + Intronic
1189378775 X:40486666-40486688 GGGGTAAAAGTCGGAGGTGAAGG + Intergenic
1189973396 X:46439912-46439934 GGTGGTGAAGCAGGCGTTGAAGG - Intergenic
1190072740 X:47292461-47292483 GGTGGAGAAGGAGGAGGGGCAGG + Intergenic
1190084194 X:47381051-47381073 GGAGGAAGAGCAGGAGGAGGAGG + Intronic
1190259774 X:48790578-48790600 GGAGGAAAAGAAGAAGGTGGAGG + Intronic
1190259839 X:48790901-48790923 GGAGGAAGAGAAGGAGGGGAAGG + Intronic
1190323131 X:49190113-49190135 GGAGGAAAGGCAGGAGGAAAAGG - Intronic
1190608308 X:52167990-52168012 GGTGGAAAAGGTGGAGCAGATGG - Intergenic
1191108372 X:56786563-56786585 GGAGGAGAAGGAGGAGGAGAAGG - Intergenic
1191892340 X:65956844-65956866 GGTGGAAGAGGAGGAAGTGGAGG - Intergenic
1192173093 X:68868717-68868739 GGTGGAAGAGGAGGTGGGGAGGG + Intergenic
1192359913 X:70432955-70432977 GGAGGAGAAACATGAGGTGAGGG - Intronic
1192573067 X:72222062-72222084 GGTGGAGAAGGAGGAGGAGTGGG - Intronic
1192587859 X:72334131-72334153 GCTGGAAAAGCTAGATGTGAGGG - Intronic
1192616293 X:72626185-72626207 GGGGGAAAGGCAGGAAGGGAGGG + Intronic
1192670089 X:73130688-73130710 TGTAGCAAAGCAGCAGGTGAGGG - Intergenic
1193530556 X:82649687-82649709 GGTGGAACTGGAGGAGCTGATGG + Intergenic
1193747493 X:85299586-85299608 GGTGTGAAAACAGGAGGTGGAGG - Intronic
1194098297 X:89671471-89671493 GGTGGAAAGGAAGGATGTAAGGG - Intergenic
1194609981 X:96031295-96031317 GGTGGAGAAGGAGGAGTTGGGGG - Intergenic
1195397414 X:104426231-104426253 GGTGGAAAAGCAGCAGAGGCAGG - Intergenic
1196519898 X:116661110-116661132 GCTGGAAAAGGAGAGGGTGAGGG - Intergenic
1196664596 X:118303258-118303280 GGAGGAGAAGGAGGAGGAGAAGG + Intergenic
1196767574 X:119262185-119262207 GGAGGAAGAGGAGGAGGAGAAGG + Intergenic
1198002842 X:132457439-132457461 GGTGAAAAAGGAGGAGATGGAGG + Intronic
1198017203 X:132623448-132623470 GGAGGAAGAGCAGGAGGGAAGGG + Intergenic
1198312243 X:135434627-135434649 GGAGGAAGAGCAGGAGGAGGCGG + Intergenic
1198441499 X:136667768-136667790 GGTGAAAAAGCAGGAAGTGGTGG - Exonic
1198462616 X:136877950-136877972 GGTGGAAGAGGAGGAAGTGGAGG - Exonic
1198474777 X:136984493-136984515 GGTGGAGTTGCAGGAGGAGATGG + Intergenic
1199512927 X:148642755-148642777 AGAGGAAAAGGAGGAGGTGAAGG + Intronic
1199627784 X:149757189-149757211 GGTTGAAAGGCTGGAGATGAGGG - Intergenic
1201253848 Y:12088093-12088115 GGAGAAAAAGAAGGAGGAGAAGG - Intergenic
1201738681 Y:17300285-17300307 GGAAGAAAAGGAGGTGGTGAGGG + Intergenic