ID: 1135747772

View in Genome Browser
Species Human (GRCh38)
Location 16:25031912-25031934
Sequence ATTCCAGGTGGAAAAGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 312}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135747772_1135747779 -3 Left 1135747772 16:25031912-25031934 CCTCCTGCTTTTCCACCTGGAAT 0: 1
1: 0
2: 2
3: 44
4: 312
Right 1135747779 16:25031932-25031954 AATTGCGACGCGGGCGACGAGGG 0: 1
1: 0
2: 0
3: 0
4: 6
1135747772_1135747780 2 Left 1135747772 16:25031912-25031934 CCTCCTGCTTTTCCACCTGGAAT 0: 1
1: 0
2: 2
3: 44
4: 312
Right 1135747780 16:25031937-25031959 CGACGCGGGCGACGAGGGCGTGG 0: 1
1: 0
2: 2
3: 14
4: 154
1135747772_1135747778 -4 Left 1135747772 16:25031912-25031934 CCTCCTGCTTTTCCACCTGGAAT 0: 1
1: 0
2: 2
3: 44
4: 312
Right 1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG 0: 1
1: 0
2: 0
3: 0
4: 18
1135747772_1135747781 3 Left 1135747772 16:25031912-25031934 CCTCCTGCTTTTCCACCTGGAAT 0: 1
1: 0
2: 2
3: 44
4: 312
Right 1135747781 16:25031938-25031960 GACGCGGGCGACGAGGGCGTGGG 0: 1
1: 0
2: 0
3: 10
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135747772 Original CRISPR ATTCCAGGTGGAAAAGCAGG AGG (reversed) Intergenic
900193148 1:1359894-1359916 AAACCAGTTGGAAAAACAGGAGG - Intronic
901412383 1:9093417-9093439 AATCCTGGAGGAAAAGGAGGAGG + Intergenic
901412564 1:9094682-9094704 ACTCCAGGTGGACAAGGAGGAGG - Intergenic
901626023 1:10625569-10625591 ATCCCAGGAGGAAGAGCAGGTGG - Intronic
901717382 1:11167408-11167430 ATTCTTTTTGGAAAAGCAGGAGG - Intronic
901765766 1:11499126-11499148 ATTCCTGGTGGAATAGCAATGGG + Intronic
902469470 1:16638494-16638516 ATGAAAGGTGGAAGAGCAGGTGG - Intergenic
903348639 1:22704253-22704275 AATCCATGTGGACAAGCACGGGG - Intergenic
903597565 1:24507302-24507324 ATTTCAGGAGGAAAAGAATGGGG - Intronic
903990651 1:27266123-27266145 TTGCCTGGGGGAAAAGCAGGAGG + Intronic
904314774 1:29653127-29653149 TTTCCAGGTGGAAAAGGTGGAGG - Intergenic
905224552 1:36470749-36470771 GTTCCAAGTGGAAAAGCCTGGGG + Intronic
905371156 1:37483327-37483349 TCTCGAGGTGGAAAGGCAGGGGG - Exonic
906662004 1:47589674-47589696 CTTCCAGGGTGAAAAGGAGGTGG + Intergenic
907483836 1:54763122-54763144 ATTCCAGTTGGAATTGCTGGGGG - Intronic
908121346 1:60989033-60989055 ATTCCAGGTGGCAATTCAAGAGG + Intronic
909546907 1:76858322-76858344 AGAACAGGTGGAAAAGCAGGTGG - Intergenic
910389637 1:86726272-86726294 TTTCCAGGTAGAAAAGCAGACGG - Intronic
911379986 1:97101646-97101668 ATTGCAGGAGGAGAAGCAGCAGG + Intronic
911964350 1:104347448-104347470 ATTCCAGGTAAGAAATCAGGTGG - Intergenic
912726842 1:112066261-112066283 CTTCTAGCTGGAAAATCAGGGGG + Intergenic
914428096 1:147597258-147597280 TTTACAGGTGGAAAAACTGGAGG + Intronic
917339867 1:173964965-173964987 ATTCCATTTGGCAGAGCAGGAGG + Exonic
918051313 1:180975196-180975218 TTTCCAAGTGCAAAAGAAGGTGG + Exonic
918262955 1:182812836-182812858 GTTCCTGGCAGAAAAGCAGGTGG + Intronic
924941983 1:248818395-248818417 ATTCCAGGTGGCAGAGGAGAGGG + Intronic
1063290568 10:4742441-4742463 ATTCCAGCTGGAAGAGTAGAGGG + Intergenic
1064911737 10:20409419-20409441 TTACCAGGTGGTAAAGCATGAGG + Intergenic
1067192122 10:44080373-44080395 ATACCAGCTGGCAAAGGAGGTGG + Intergenic
1067541436 10:47157567-47157589 ATGCCCGGTGAAAAAGTAGGAGG - Intergenic
1073647225 10:105317797-105317819 AAACCAGGTGAAAAGGCAGGTGG + Intergenic
1074118567 10:110476318-110476340 CGTCCAGGTGGAAAGACAGGTGG - Intergenic
1074229447 10:111519276-111519298 ATAGCAGGTGGAAAAGAAGGAGG - Intergenic
1074365748 10:112856228-112856250 ATTTTATGTGGAAAAGCAAGAGG - Intergenic
1075015864 10:118909657-118909679 CTCCCAGGTGGGAAGGCAGGTGG + Intergenic
1075665852 10:124230381-124230403 ATTCCATGTGGAATATCATGTGG - Intergenic
1076885943 10:133262293-133262315 AATCCAGGGAGAAAAGAAGGTGG + Intergenic
1077542274 11:3152549-3152571 ATCCCATGTGGAACAGCAGCGGG + Intronic
1077730147 11:4721871-4721893 ATTCCAGGGGCCAAAGCAGGAGG - Intronic
1078800336 11:14637277-14637299 TTCCCAGGTGGACAAGGAGGAGG - Intronic
1079131533 11:17749640-17749662 ACTCCAGGTGGCCCAGCAGGTGG - Intronic
1079274684 11:19024111-19024133 AACCCAGGAGGAAAAGCTGGGGG - Intergenic
1079372336 11:19862308-19862330 GGGCAAGGTGGAAAAGCAGGAGG + Intronic
1080257820 11:30311617-30311639 ATTTCAGGTGGAAATGCAAAAGG - Intergenic
1085782859 11:79425094-79425116 ATTCAAGACAGAAAAGCAGGAGG - Intronic
1087233175 11:95689243-95689265 ATTGCTGGTGGATAAGCAGATGG - Intergenic
1089286418 11:117410812-117410834 ATGCCAGCTGGAAGAGCATGGGG - Exonic
1089319366 11:117614531-117614553 ATTCAAGGAGGAAGAACAGGAGG - Intronic
1090447928 11:126780059-126780081 ACTTCAGAGGGAAAAGCAGGAGG + Intronic
1092125784 12:6074138-6074160 ATTTCATGGGGAAAAGGAGGAGG - Intronic
1094543611 12:31383612-31383634 ATTCCCAGTGGAAAACAAGGTGG + Exonic
1094600916 12:31908190-31908212 ACTCCAGATGGACAAGGAGGAGG - Intergenic
1094861498 12:34471541-34471563 ATTCCAGGTTGAAAACTAGAAGG - Intergenic
1095096923 12:38153935-38153957 CTTCCCGGGGGAAAAGCAGTGGG + Intergenic
1095174211 12:39072062-39072084 ATTGCAAGTGGAATAGCTGGTGG + Intergenic
1095958112 12:47818233-47818255 ATTCCAGGTGCAACATCAGGAGG + Intronic
1096006563 12:48178080-48178102 GTTCTAGGTGGAAAAGTTGGGGG + Intronic
1097907813 12:64938441-64938463 ATCCCAGGTGGAAGAAAAGGGGG + Intergenic
1098570715 12:71984671-71984693 AAGCCAGGTGGATGAGCAGGAGG - Intronic
1101650571 12:106673846-106673868 AGTCCAGGTGGGAGAGAAGGTGG - Intronic
1102852541 12:116262565-116262587 ATTCCAGATGGAAAAACAAGTGG - Intronic
1104705894 12:130947165-130947187 ATCCCAGGAGGAAAAGCTTGTGG + Intergenic
1105887390 13:24653504-24653526 AATCAAGGAGGAAAACCAGGAGG + Intergenic
1107273754 13:38653164-38653186 ATTCCATGAGGAAAAGCTAGGGG + Intergenic
1107558757 13:41542191-41542213 ATGCAAGCTGGAAGAGCAGGTGG + Intergenic
1108734037 13:53263834-53263856 ATTTCAGGTCAGAAAGCAGGAGG - Intergenic
1110467129 13:75814869-75814891 ATAGTAGGGGGAAAAGCAGGAGG + Intronic
1110661458 13:78062840-78062862 AGGCCAGGTGGAAAAGAATGAGG - Intergenic
1110955958 13:81552446-81552468 ACTCAGGGTGGAAAAGCAGCAGG - Intergenic
1111127997 13:83936614-83936636 ATTCCAGATGTGAAAGTAGGAGG - Intergenic
1112636777 13:101225162-101225184 ACTCCAGGTGGACAAGGAGGAGG - Intronic
1113130762 13:107034621-107034643 ATTCCAGGTGGCAGAGCGGGAGG - Intergenic
1114394746 14:22347646-22347668 ATTCGATGTGCAAAAGCTGGAGG - Intergenic
1116000075 14:39233308-39233330 ATTCTTGGTGGTAAAGCAAGTGG + Intronic
1117973553 14:61275940-61275962 ATGCAAGGTGGCAAAGCAGTGGG + Intronic
1119038224 14:71248496-71248518 GTGCAAGGTGGGAAAGCAGGAGG - Intergenic
1119425971 14:74534961-74534983 ATACCAGGAGGAAAAGCAACTGG + Intronic
1120239557 14:81934194-81934216 ATTCTAGTTGGAAGAACAGGAGG + Intergenic
1121614100 14:95301334-95301356 CTCCCAGGTGGAAATGCGGGGGG + Intronic
1122800105 14:104225144-104225166 ATCCCAGGAGGAAATGCAGCTGG - Intergenic
1123712062 15:22995625-22995647 ATTACTGGTGGAAATGCAGATGG - Intronic
1126332259 15:47545957-47545979 ACTCAAGGTGGAAAAGCATAGGG + Intronic
1127336928 15:57996120-57996142 ATTATAGGTGGAAATGAAGGTGG + Intronic
1128094949 15:64947180-64947202 ATTCCGGGTGGAAGAACAGTGGG + Intronic
1128326169 15:66725628-66725650 ATGCCAGGTGGGGAAGAAGGAGG + Intronic
1128631442 15:69272523-69272545 AGTCCAGGTGGAAGAAGAGGAGG + Intergenic
1128735328 15:70050426-70050448 TTTCCTTATGGAAAAGCAGGTGG - Intronic
1128844037 15:70873656-70873678 ACTCCATGTGGAGAAGCAGCTGG - Intronic
1128920729 15:71607703-71607725 TTTCCAGGTGGACAAACATGAGG + Intronic
1128961662 15:72012734-72012756 ATTACAAGTGGCAAGGCAGGGGG + Intronic
1129517475 15:76165506-76165528 GCTCCAGGTGGGAAAGGAGGAGG + Intronic
1129664683 15:77572911-77572933 CTTCCTGGAGGAAAAGGAGGAGG + Intergenic
1129869474 15:78931491-78931513 CTTCCAGGCGGAACAGCAGCTGG - Exonic
1130071940 15:80654843-80654865 ATTTAATGTGGAAAAGAAGGAGG - Intergenic
1132198569 15:99932287-99932309 TTTCCAGGTGGAAACAAAGGGGG + Intergenic
1133050322 16:3113787-3113809 GTTCCAGGTGGAGAAGCACGGGG - Intronic
1133551802 16:6863155-6863177 AGTCTAGGTGAAAAAACAGGAGG + Intronic
1134044139 16:11089005-11089027 GTTCCTGCTGGAGAAGCAGGTGG - Intronic
1135470444 16:22724641-22724663 ACTACAGGGGGAAAAGCAGAAGG - Intergenic
1135747772 16:25031912-25031934 ATTCCAGGTGGAAAAGCAGGAGG - Intergenic
1135757727 16:25111915-25111937 GCTCGAGGTGGAACAGCAGGAGG - Exonic
1138156346 16:54708429-54708451 TTTCCATGTGGAAAAACATGCGG - Intergenic
1138278749 16:55756594-55756616 ATTCCTTGTGGAAAGGCAGGGGG - Intergenic
1138289803 16:55837040-55837062 ATTCCTTGTGGAAAGGCAGGGGG + Intergenic
1138963334 16:62053327-62053349 AGTCCAGGTGGGAAAATAGGAGG + Intergenic
1139557926 16:67724411-67724433 ATTCCAGCTGCAAAAGCCTGTGG + Exonic
1139926689 16:70492122-70492144 CTTCCAGATGGATAAACAGGTGG + Intronic
1139970031 16:70768553-70768575 ATGCCACCTGGAAAAGCAGCAGG - Intronic
1141777432 16:86133756-86133778 GTTCCAGGAGGAGAGGCAGGTGG - Intergenic
1142046720 16:87930271-87930293 CTTACAGGTGGGAAAGCAGAGGG + Intronic
1142364522 16:89643064-89643086 ACTCCAGGAGGTAAGGCAGGAGG - Intergenic
1142397956 16:89843402-89843424 AGTCCGAGTGGAAATGCAGGTGG - Intronic
1142552306 17:748360-748382 ATGCCAGGTGGAAGTTCAGGAGG + Intronic
1142579095 17:929726-929748 AGTCCAGGTTGCAAAGCAGCTGG + Intronic
1143068615 17:4270067-4270089 AGGGCAGGTGGAAAAGCATGTGG + Exonic
1143505432 17:7362081-7362103 ATGACAGATGAAAAAGCAGGAGG + Intergenic
1144598657 17:16593454-16593476 AATTCATGTGGAAAAGTAGGAGG + Intergenic
1147182601 17:38696028-38696050 ATTCCAGGTGGAAGAGGGGCTGG + Intergenic
1147186508 17:38716181-38716203 ATTACAGGTGGGAAAGCTGGAGG + Intronic
1148530266 17:48383660-48383682 TTTCCAGGTGGGAAAGGAGTTGG - Intronic
1149395924 17:56243657-56243679 ATTCCAGATGGAAGCCCAGGTGG + Intronic
1150463392 17:65371523-65371545 AATACAGGTGAAATAGCAGGTGG - Intergenic
1152008708 17:77697714-77697736 ATGCCAGGTGGACACCCAGGTGG + Intergenic
1155635144 18:27943913-27943935 ATTCCAGGTGAAAAAACTGTGGG + Intergenic
1156139260 18:34085070-34085092 TTTCAAGTTGGAAATGCAGGTGG + Intronic
1157071298 18:44411939-44411961 AGTACAGGAGGAAAAGGAGGAGG + Intergenic
1158768921 18:60491136-60491158 ATTCCAGCTGAAGAGGCAGGTGG - Intergenic
1161748120 19:6074242-6074264 AGTTCAGGTGGAACATCAGGCGG + Intronic
1161918566 19:7249262-7249284 ATTCCTGGTGGTAAAGAAGATGG - Intronic
1162425236 19:10591122-10591144 ATTTCAGGTGGAGAGGCAAGTGG - Intergenic
1163173376 19:15548432-15548454 AGTCCAGGTGGAAAGGAAGGAGG + Intronic
1165255714 19:34576414-34576436 ATTCCAGGTTGAGGAGAAGGAGG + Intergenic
1166916117 19:46196980-46197002 GGTCCAGGTGGAAGGGCAGGTGG - Intergenic
1167210950 19:48133812-48133834 ATTCCAAGGAGAAAAGCAGTGGG + Intronic
1167419690 19:49395592-49395614 TGGCCAGATGGAAAAGCAGGAGG - Intronic
1202644919 1_KI270706v1_random:130962-130984 ATTACAGGTAAAATAGCAGGGGG + Intergenic
925799789 2:7586872-7586894 ATTCCATGTGGAAAACCAGTTGG - Intergenic
925898568 2:8492271-8492293 ATTCTTGGAGGAAAGGCAGGGGG + Intergenic
927966716 2:27275075-27275097 TTTCCGGGTGGAAGAGAAGGAGG + Intronic
928980941 2:37134650-37134672 ACTCCAGGTGGTCAAGGAGGAGG - Intronic
929326662 2:40620140-40620162 ATTCCAGGTGGAAGTGCAGTGGG + Intergenic
931063674 2:58560173-58560195 CTTGCAGGTGGACAAGCAGTGGG - Intergenic
931088864 2:58864473-58864495 ACTCCAGGTGTCAAAGCAGCTGG + Intergenic
932461572 2:71885223-71885245 ATTCCAGTTGCAAATGAAGGTGG - Intergenic
932470532 2:71952250-71952272 ATTCCAGTGGGAACACCAGGAGG + Intergenic
935085631 2:99841941-99841963 GTGCCACGTGGAAAAGGAGGAGG - Intronic
935468512 2:103429155-103429177 ATTACAAGTGGAAGATCAGGAGG - Intergenic
935650700 2:105379587-105379609 ATTTCAGGTGGAAGGGCAGTGGG - Intronic
938238525 2:129724921-129724943 ATCCCATGTGGAAGAGCAGGAGG - Intergenic
938770234 2:134495256-134495278 TTTCCAAGTAGGAAAGCAGGAGG + Intronic
939248497 2:139656261-139656283 ATTTCAATTGGAAAAACAGGAGG - Intergenic
939468887 2:142594040-142594062 ATTCCATGTTGAAAGGCAGAAGG - Intergenic
940138277 2:150463652-150463674 ATGCCATGTGCAGAAGCAGGCGG - Intergenic
941693038 2:168521482-168521504 GTTCCAGGTGGAAGAAGAGGAGG + Intronic
943525335 2:189009020-189009042 ATTGGAGGTGAAAAAGCTGGCGG + Exonic
943526768 2:189026181-189026203 TTTCCAGGGGAAAAAACAGGGGG + Intergenic
943575514 2:189626795-189626817 ATCCCATATGAAAAAGCAGGAGG + Intergenic
943764624 2:191647421-191647443 ATTACAGGTGTAAAAGTGGGAGG + Intergenic
945099722 2:206252806-206252828 ATTCCAGGATGAAAAGCCTGGGG - Intergenic
947954683 2:234178579-234178601 AAGCCAGGAGGAAAAGGAGGAGG + Intergenic
948140384 2:235668861-235668883 TTTACAGGTGGAAAAGCAAGTGG + Intronic
948474248 2:238206559-238206581 ACTCCAGGTGGACAAGGAGGAGG + Intergenic
949037272 2:241821629-241821651 AATCCTGGTGGAAGAGAAGGGGG - Intergenic
1169079941 20:2791751-2791773 ATGCCAGGTAGAAAAGAAGCTGG - Intergenic
1170340025 20:15314663-15314685 ATTCAGGGTGAAAAAGCAGTGGG + Intronic
1170571583 20:17635774-17635796 CTTCCACGTGGAAAAGGTGGAGG - Intronic
1170821545 20:19758889-19758911 CCCCCGGGTGGAAAAGCAGGAGG + Intergenic
1171430553 20:25081245-25081267 GTACCAGGTGGAAACGCGGGCGG - Intronic
1171894880 20:30749883-30749905 ATTACAGGTAAAATAGCAGGGGG + Intergenic
1172113014 20:32558632-32558654 ATTCCAGCTGCACCAGCAGGTGG + Intronic
1172248997 20:33465769-33465791 ATCCCAGGAGGCAGAGCAGGTGG - Intergenic
1173576407 20:44115428-44115450 ATACCAGGTGCAAAGGTAGGAGG + Intronic
1173900528 20:46584225-46584247 ATTTCAGGTGGAGAATCAGAGGG + Intronic
1173924854 20:46773196-46773218 ACCGCAGGTGGAAAAGCTGGCGG + Intergenic
1174133061 20:48359532-48359554 ATTCTGGGTGGAAGGGCAGGAGG - Intergenic
1174556964 20:51402735-51402757 CTCCCAGGTGGATTAGCAGGTGG + Intronic
1175173674 20:57096672-57096694 ATTTCTGTTGGAGAAGCAGGGGG - Intergenic
1176196091 20:63836830-63836852 GTGCCAGGTGGTGAAGCAGGAGG - Intergenic
1176241763 20:64078778-64078800 ATGCCAGGTTGACAAGCAGGAGG - Intronic
1176606960 21:8841705-8841727 ATTACAGGTAAAATAGCAGGGGG - Intergenic
1179325249 21:40336191-40336213 ATTCCATGAAGAAAAGCAGCTGG - Intronic
1179349069 21:40590385-40590407 ATTCCAGCTGTAAATGCATGGGG - Intronic
1180357041 22:11851481-11851503 ATTACAGGTAAAATAGCAGGGGG - Intergenic
1180381222 22:12140850-12140872 ATTACAGGTAAAATAGCAGGGGG + Intergenic
1181271498 22:21661320-21661342 AGGACAGGTGGAAAACCAGGGGG + Intronic
1182095171 22:27621104-27621126 GGGCCAGGTGGAAAAGCAGGAGG - Intergenic
1182638071 22:31744960-31744982 AGTCCAGGAGAAAAAGGAGGGGG - Intronic
1183665247 22:39242910-39242932 AATCCAGGTGGGAAAGGGGGCGG - Intronic
1185062052 22:48612196-48612218 ATTACAAATGGAAAAGCATGAGG - Intronic
949713256 3:6897140-6897162 ATTCCAGCTGGGAAATCAGCTGG + Intronic
949887704 3:8709600-8709622 ATTCCACGTGGAAACCAAGGAGG + Intronic
950190467 3:10972992-10973014 ATTCCATGAGGAAAAGCACACGG + Intergenic
951707425 3:25557514-25557536 ATTCTAAGTGGAGAAGGAGGAGG + Intronic
951707909 3:25562307-25562329 ATTCCTGGTTAAAAAGCAGAGGG + Intronic
952038614 3:29234530-29234552 ATTCCAGGTAGTGAAGAAGGTGG + Intergenic
952697483 3:36285416-36285438 ACTCACGGTGGAAAAGCAAGGGG - Intergenic
952887808 3:38022237-38022259 AGTCCCAGTGGAAAAGAAGGGGG + Intronic
953126202 3:40093907-40093929 TATACAGGTGGAAAAGCTGGTGG - Intronic
953149712 3:40313791-40313813 ATTACAGATGAAAAAGTAGGAGG - Intergenic
953808447 3:46091687-46091709 AATCCAGGAGGATAAGCAGCAGG - Intergenic
954299967 3:49695718-49695740 ATTAAAGGTGGAAGAGCAGGTGG + Intronic
954661533 3:52229325-52229347 ATTCCAGGTGGGGAATCAAGGGG - Intronic
954801667 3:53190569-53190591 ATTCCAGGTGGAAGAGGGGCTGG + Intronic
955121299 3:56061368-56061390 AGTCCAGAGAGAAAAGCAGGAGG - Intronic
955839809 3:63099778-63099800 AATACAGATGGAAAAACAGGAGG + Intergenic
956704497 3:71987825-71987847 ATTCCGCTTGGAGAAGCAGGAGG - Intergenic
956733337 3:72216788-72216810 ATTCCAGGTGGAAGTACAGAAGG + Intergenic
957041035 3:75335786-75335808 ATTAAAGTTGGAAAAGCAGGGGG - Intergenic
960447691 3:117767556-117767578 AGTACAGGGGGCAAAGCAGGTGG + Intergenic
960556070 3:119032266-119032288 TTTCAATGTGGAATAGCAGGAGG - Intronic
960682408 3:120263108-120263130 ATACCAGAGGGAAGAGCAGGGGG + Intronic
961045843 3:123707441-123707463 ATCAAAGTTGGAAAAGCAGGGGG - Intronic
961200077 3:125038558-125038580 ATTCCAGGTGGCATCGCAGTGGG + Intronic
962076961 3:132092053-132092075 TTTCTAGGTAGAAAAGCAGGTGG - Intronic
962205124 3:133428133-133428155 TTTCCAGGAGGAAAAGCATGAGG + Intronic
962549641 3:136476460-136476482 ATTCCAGGGGGCAAGACAGGTGG + Intronic
962963315 3:140331280-140331302 AGCCCAGGTAGAAAAGCAGGTGG - Intronic
964174016 3:153803820-153803842 AATCCAGGGGAGAAAGCAGGTGG - Intergenic
965051877 3:163661895-163661917 ATTTCAGTTAGAAAAGCAGATGG - Intergenic
967290675 3:187916797-187916819 ATTTGAGGTAGAAATGCAGGAGG - Intergenic
968312783 3:197697770-197697792 AGAACAGGTGGAAAAGCAGGTGG + Intronic
968609109 4:1549128-1549150 GTTCCAGGTGAGAAAGCAGGCGG + Intergenic
969302957 4:6308113-6308135 CCCCCAGGTGGAAAAGCAGGAGG - Intergenic
972714095 4:41628563-41628585 ATTCAAGCTGGAAAATCAAGAGG - Intronic
972784530 4:42314560-42314582 ATTCCAGACAGAAAACCAGGGGG - Intergenic
973371141 4:49249376-49249398 ATTACAGGTAAAATAGCAGGGGG + Intergenic
973389865 4:49545935-49545957 ATTACAGGTAAAATAGCAGGGGG - Intergenic
975586505 4:75955392-75955414 TTCCCAAGTGGAAAGGCAGGTGG - Intronic
976268440 4:83206806-83206828 ACTCCAGGTGGACAAGGAGGAGG - Intergenic
977736619 4:100424803-100424825 TTTCTTGGTGGAAAAGAAGGTGG + Intronic
981552023 4:145951605-145951627 CTTCCAGATGGAAAAGCCTGTGG - Intergenic
981878577 4:149579329-149579351 ATTCCAGGGGAGAAAGCAGAAGG + Intergenic
984490491 4:180429201-180429223 ATTTCAGCTGGAAAAGATGGGGG + Intergenic
984941590 4:184936794-184936816 ATTCCAGGTGGGGCAGCACGAGG + Intergenic
985762791 5:1759724-1759746 ATTCCATCTACAAAAGCAGGTGG - Intergenic
986967685 5:13295041-13295063 ATTCCTGGTGGAAAAGAGTGAGG - Intergenic
987198900 5:15554712-15554734 ATTCAAGGTGGAAGAGCACTGGG + Intronic
988379075 5:30477790-30477812 AATCCAGGTTGAAATTCAGGTGG - Intergenic
988601702 5:32646241-32646263 ATTCCTGCTGGCAAAGTAGGGGG + Intergenic
988879824 5:35489329-35489351 ATTCCAGGTGGGAACAGAGGTGG + Intergenic
990003778 5:50922717-50922739 GTTCCAGGTGAGAAAGCAGGCGG - Intergenic
990589170 5:57244471-57244493 AATCCAGGTGTTAAAGCAGGGGG - Intronic
992600751 5:78396703-78396725 ATTGGAGGTGGAAGGGCAGGAGG + Intronic
992862666 5:80928008-80928030 TTTCCAGGTGGAGGAACAGGAGG - Intergenic
993967634 5:94376890-94376912 ATTCCTGGTGCAGCAGCAGGCGG - Intronic
994303098 5:98170870-98170892 ATACCAGATGGAAAACCAGAGGG - Intergenic
994765316 5:103908844-103908866 TTTGCAGGTGGAAAAGCAGTCGG + Intergenic
994817002 5:104597334-104597356 ACTCCAGGTGAACAAGGAGGAGG - Intergenic
995436438 5:112141582-112141604 ATTAAAGGAGGAAAAGCAGAGGG - Intergenic
995460937 5:112402202-112402224 AGACCAGGAGGAAAAGGAGGAGG - Intronic
997690708 5:135825851-135825873 CTCCCAGATGGAAAGGCAGGAGG - Intergenic
997695351 5:135856992-135857014 GTGCCAGGTGGTAAAGGAGGCGG - Intronic
997753270 5:136370549-136370571 ATTCCAGGTGTAAAAGCTGGAGG + Intronic
998390684 5:141785303-141785325 ATTCCAGGTGGGCCGGCAGGTGG + Intergenic
998888209 5:146717593-146717615 AGTTCAGGTGAAGAAGCAGGAGG - Intronic
999282597 5:150375070-150375092 GGTCCAGGTGGGGAAGCAGGAGG + Exonic
999318682 5:150600325-150600347 ACTCCAGTGGGAAAGGCAGGCGG + Intergenic
1001425853 5:171621938-171621960 ATTCCAGGTGGAAGACCCAGTGG - Intergenic
1001548573 5:172586225-172586247 TTTGCAGGTGAAAAGGCAGGTGG + Intergenic
1001853483 5:174990178-174990200 ATTCTAGATAGAAAAGCAGGAGG + Intergenic
1001914363 5:175547222-175547244 ATTCCTGGTGGGAAGGAAGGGGG + Intergenic
1002357713 5:178644353-178644375 ATTCAAGGAGGAACACCAGGTGG + Intergenic
1003293841 6:4806171-4806193 TTTCCAGGTGGCACAGCCGGTGG - Intronic
1003427849 6:6009124-6009146 ATCCCAGGTGGATAAGCAGGAGG - Intergenic
1003611239 6:7616693-7616715 AATTCAGGGGGAAAAGCTGGTGG - Intergenic
1003810884 6:9779271-9779293 ATTCCAGCTGAAAAATTAGGGGG - Intronic
1003973713 6:11323380-11323402 ATTCCAGCTGGAAGAGCATGTGG + Intronic
1004314207 6:14571965-14571987 CTTGCTGGAGGAAAAGCAGGAGG - Intergenic
1004781569 6:18914113-18914135 TTTCCAGGTGGTAAAGCAAAGGG - Intergenic
1005040707 6:21596844-21596866 ATTTCACGTAGAAAAGAAGGCGG - Exonic
1006243411 6:32707435-32707457 ACTCCAGATGGACAAGGAGGAGG - Intergenic
1007316656 6:40994661-40994683 ATTCCAAATGGAATATCAGGAGG + Intergenic
1007425170 6:41741942-41741964 CTTCCTGGTGGAGAAGCGGGTGG - Intronic
1008010893 6:46466526-46466548 ACTCAAGGAGGAAAGGCAGGGGG + Intronic
1008062990 6:47018115-47018137 ATCCCAGCTGGAAAACCAAGTGG + Intronic
1008063638 6:47025107-47025129 ATTTCAGGTGTAATAGAAGGGGG - Intronic
1008309914 6:49954599-49954621 ATTCCTGGTGCAAAATTAGGGGG - Intergenic
1012565108 6:100639294-100639316 ATTCCAGGTAGAAAATTGGGTGG + Intronic
1012927052 6:105278251-105278273 TGTCCACGTGGATAAGCAGGGGG + Exonic
1014136008 6:117890764-117890786 ATGCCAGGTGCCACAGCAGGAGG + Intergenic
1014252337 6:119127645-119127667 CTACCAGGTAGGAAAGCAGGAGG + Intronic
1014339842 6:120190635-120190657 AATCCAGGTGGCTAAGCAAGAGG + Intergenic
1015990757 6:138940009-138940031 ATTTCAGGTGGAGAAACAGAAGG + Intronic
1016705840 6:147106760-147106782 GTTCCAGGCACAAAAGCAGGGGG + Intergenic
1016830966 6:148432685-148432707 TTCACAGCTGGAAAAGCAGGAGG - Intronic
1017127625 6:151080559-151080581 ATTGAAGGTGCTAAAGCAGGAGG + Intronic
1017207847 6:151823259-151823281 TTTCCTGGTAGAAAAGCAGGTGG - Intronic
1019168740 6:170116839-170116861 GTTCCAGGAGGAAGAGCAGGAGG + Intergenic
1020689950 7:11341780-11341802 ATGCCAGGTAGAAGAGGAGGTGG - Intergenic
1022016094 7:26349704-26349726 ACTCCAAATGGAAAGGCAGGTGG + Intronic
1022055488 7:26728961-26728983 AATGCAGGTGGAAATGCATGAGG + Intronic
1022345275 7:29508633-29508655 ACTCCAGGAGGAATAGCAGGAGG + Intronic
1022804615 7:33809105-33809127 ATGCCATGAGAAAAAGCAGGGGG - Intergenic
1023476151 7:40579900-40579922 ATTTCAGGAGGAAAGGCAAGAGG - Intronic
1023760595 7:43462122-43462144 GTCCCAGGTGGGAAAGCACGGGG - Intronic
1023847704 7:44131995-44132017 CTTCTAGATGGAAAAGCTGGGGG - Intergenic
1024563391 7:50662851-50662873 ATTCCAGATGGACAAGGAAGAGG - Intronic
1024674041 7:51622245-51622267 ACTCTATGTGGAAAACCAGGGGG - Intergenic
1024826113 7:53391490-53391512 AATCCATGTGGAAAAGTAAGGGG - Intergenic
1025887684 7:65613891-65613913 AATCCAGGAGGATAAGGAGGAGG - Intergenic
1026117551 7:67508813-67508835 CTTCCAGGGTGAAATGCAGGAGG + Intergenic
1026270271 7:68830549-68830571 ACTCCAGGTGGAAATGCATCAGG - Intergenic
1026300593 7:69094570-69094592 ATTCATGGTGGAAAGGGAGGTGG + Intergenic
1027743780 7:82047058-82047080 ATGTCAGGTGGAGATGCAGGGGG - Intronic
1028477710 7:91268266-91268288 ATTTCAGGAGGTAAAGAAGGTGG + Exonic
1028985469 7:97005653-97005675 ATCCAAGGGGGGAAAGCAGGCGG + Exonic
1028987274 7:97018301-97018323 ATTACTGGTGGAAAAGAAGGGGG - Intergenic
1030658085 7:112190439-112190461 TTTCCAGGTAAAGAAGCAGGAGG + Intronic
1031436394 7:121737351-121737373 ATACCAGATGGAAGATCAGGAGG + Intergenic
1031854725 7:126908027-126908049 AATCCAGGAGGATAAGGAGGAGG + Intronic
1032217543 7:129969280-129969302 GTGCAAGGTAGAAAAGCAGGAGG - Intergenic
1032258233 7:130313920-130313942 ACTCCAGGTGGACAAGGAGGAGG + Intronic
1033811885 7:145023865-145023887 ATTTCACTTGCAAAAGCAGGTGG - Intergenic
1035203965 7:157282578-157282600 CTTCCAGGGGGACACGCAGGTGG - Intergenic
1035561677 8:608831-608853 ATTACAGATGGACCAGCAGGTGG + Intergenic
1037366646 8:18129238-18129260 ATTCCATGTGGAAAATAAGAGGG + Intergenic
1037517972 8:19652699-19652721 ATTTTAAGTGGAACAGCAGGAGG - Intronic
1038646000 8:29362737-29362759 ATTCCAAGTGGAAATCCTGGTGG - Intergenic
1039461445 8:37748841-37748863 ATTGCAGCTGGAAAGGAAGGTGG + Intronic
1039501242 8:38019172-38019194 ATTTAAAGGGGAAAAGCAGGTGG - Intergenic
1042106600 8:65333925-65333947 ATTCCAGAAGAAAAAGAAGGAGG + Intergenic
1045118186 8:99006182-99006204 ATTTCAGGAGGCCAAGCAGGAGG - Intergenic
1045537690 8:103047718-103047740 ATAAGAGGTGGAAAAGCAGTAGG - Intronic
1045897129 8:107233141-107233163 ATTCAAGGAGTAAAATCAGGAGG + Intergenic
1046020263 8:108656420-108656442 ATTCAAGAGGGAAAACCAGGGGG + Intronic
1046675782 8:117106688-117106710 ATTCCAGGTGGAAAATCAAATGG - Intronic
1052900818 9:33793572-33793594 CTGCCAGGAAGAAAAGCAGGAGG + Intronic
1053015960 9:34662315-34662337 CATCCAGGTGGAACTGCAGGAGG - Exonic
1053275538 9:36780576-36780598 ACTGCAGGGGGAAAAGCAAGGGG - Intergenic
1054729534 9:68686791-68686813 ATTACAGATGCAAAAGCAGAGGG - Intergenic
1056241607 9:84653474-84653496 ATCCCAGGATGAAAAGGAGGAGG + Intergenic
1057942545 9:99297613-99297635 ATTCCAGGTAGGAAAGAGGGAGG - Intergenic
1060207537 9:121690992-121691014 ATTGAAGGTGGGACAGCAGGTGG - Intronic
1060574571 9:124678917-124678939 ATTCTAGGAAGAAAAGCAGCTGG + Intronic
1060822743 9:126671047-126671069 ATGCCAGGTGGCAGAGAAGGGGG + Intronic
1061002953 9:127912734-127912756 ATTCCAGGGGGAGCTGCAGGGGG - Intronic
1061435735 9:130560571-130560593 ATGCCAGCAGGAAAAGAAGGAGG + Intergenic
1061773051 9:132942640-132942662 ATTCCTGGTTAGAAAGCAGGTGG - Intronic
1061923614 9:133795378-133795400 ATGCCTGGGGGAAAAGCAGGGGG + Intronic
1062088652 9:134662385-134662407 AGTCAAAGTGGAAAAGAAGGAGG - Intronic
1203695564 Un_GL000214v1:94320-94342 ATTACAGGTAAAATAGCAGGGGG + Intergenic
1203702294 Un_KI270742v1:6585-6607 ATTACAGGTAAAATAGCAGGGGG - Intergenic
1203554272 Un_KI270743v1:192641-192663 ATTACAGGTAAAATAGCAGGGGG - Intergenic
1203640709 Un_KI270751v1:9743-9765 ATTACAGGTAAAATAGCAGGGGG - Intergenic
1186754669 X:12658015-12658037 TTTCCAGTTGGACAAGCATGGGG + Intronic
1188534916 X:31186041-31186063 ATTTCAGATAGAAAGGCAGGAGG + Intronic
1188983088 X:36745239-36745261 ATTTAGGGAGGAAAAGCAGGTGG + Intergenic
1189316009 X:40057045-40057067 ATTCCAGGAGGAAAGACAGAGGG - Intronic
1189614509 X:42769631-42769653 ACTCCAGATGGACAAGGAGGAGG - Intergenic
1190072737 X:47292455-47292477 GTTACAGGTGGAGAAGGAGGAGG + Intergenic
1193426524 X:81346732-81346754 ACTCGAGGTGGAAAACCAGTGGG - Intergenic
1193909501 X:87284995-87285017 AATCCACGTGAAATAGCAGGTGG - Intergenic
1193975821 X:88117534-88117556 ACTCCATGTTGAAAAGCAGCTGG - Intergenic
1195509195 X:105694673-105694695 ATTCCAGATGGAAGAGTAAGTGG - Intronic
1195577565 X:106468202-106468224 ATTTGAGGAGGAAAAGGAGGAGG - Intergenic
1196743964 X:119051410-119051432 TTTGCAGGTGGAAATGAAGGTGG + Intergenic
1198242011 X:134796543-134796565 AGGATAGGTGGAAAAGCAGGAGG + Intronic
1200949391 Y:8879453-8879475 TTTCCAGGGGGAAAAGCACAAGG + Intergenic
1201155632 Y:11129471-11129493 ATTACAGGTAAAATAGCAGGGGG - Intergenic