ID: 1135747773

View in Genome Browser
Species Human (GRCh38)
Location 16:25031915-25031937
Sequence GCAATTCCAGGTGGAAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 210}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135747773_1135747778 -7 Left 1135747773 16:25031915-25031937 CCTGCTTTTCCACCTGGAATTGC 0: 1
1: 0
2: 3
3: 17
4: 210
Right 1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG 0: 1
1: 0
2: 0
3: 0
4: 18
1135747773_1135747780 -1 Left 1135747773 16:25031915-25031937 CCTGCTTTTCCACCTGGAATTGC 0: 1
1: 0
2: 3
3: 17
4: 210
Right 1135747780 16:25031937-25031959 CGACGCGGGCGACGAGGGCGTGG 0: 1
1: 0
2: 2
3: 14
4: 154
1135747773_1135747781 0 Left 1135747773 16:25031915-25031937 CCTGCTTTTCCACCTGGAATTGC 0: 1
1: 0
2: 3
3: 17
4: 210
Right 1135747781 16:25031938-25031960 GACGCGGGCGACGAGGGCGTGGG 0: 1
1: 0
2: 0
3: 10
4: 84
1135747773_1135747779 -6 Left 1135747773 16:25031915-25031937 CCTGCTTTTCCACCTGGAATTGC 0: 1
1: 0
2: 3
3: 17
4: 210
Right 1135747779 16:25031932-25031954 AATTGCGACGCGGGCGACGAGGG 0: 1
1: 0
2: 0
3: 0
4: 6

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135747773 Original CRISPR GCAATTCCAGGTGGAAAAGC AGG (reversed) Intergenic
901229339 1:7633316-7633338 GCATTTCCAGGAGGCACAGCTGG + Intronic
901359498 1:8684741-8684763 GCAATTGCAGGAGGCAAAGATGG - Intronic
901626025 1:10625572-10625594 GCCATCCCAGGAGGAAGAGCAGG - Intronic
904314775 1:29653130-29653152 TCTTTTCCAGGTGGAAAAGGTGG - Intergenic
905128308 1:35731812-35731834 GCAAATACAGGAGGAAGAGCAGG + Intronic
907117105 1:51978650-51978672 GAGATTTCAGGTGGAGAAGCAGG - Intronic
907646904 1:56253417-56253439 GAATTTCCAGGAGGAGAAGCAGG - Intergenic
909935571 1:81546734-81546756 GTAAATCCAGGTGGAGAGGCCGG - Intronic
911294137 1:96093652-96093674 GCAATTCCAGGAGCAAAAGTAGG + Intergenic
912109048 1:106317644-106317666 AAAATTCCTGGTGTAAAAGCTGG - Intergenic
914381569 1:147121104-147121126 GCAGTTCAAGGAGGAGAAGCTGG - Intergenic
917664429 1:177210319-177210341 GCAGTTGGAGGTGGAAAATCAGG + Intronic
918906983 1:190509165-190509187 GAAATTGCATGTGGAAAAACTGG + Intergenic
921934484 1:220784552-220784574 GGAATTCCAGGTGGTATATCTGG - Exonic
923201160 1:231712867-231712889 TAAAGTCCAGGTGCAAAAGCTGG + Intronic
924011680 1:239672003-239672025 AAAATTCCAGGTGGAAAAGCTGG - Intronic
1063313251 10:4976380-4976402 GCAATTCCATGTGAAAGAGGTGG - Intronic
1063314703 10:4991362-4991384 GCAATTCCATGTGAAAGAGGTGG + Intronic
1064242309 10:13641636-13641658 ACGATACCAGGTGGAAAACCAGG + Intronic
1065250182 10:23803103-23803125 ACTTTTCCATGTGGAAAAGCTGG + Intronic
1065492142 10:26292777-26292799 GCAATTCCTGATTGAAAAGTGGG + Intronic
1065724966 10:28660571-28660593 GCAAGGTCAGGTGGAGAAGCTGG + Intergenic
1066207307 10:33202232-33202254 GCCATTCCAAGTGGAAGAGAAGG + Intronic
1067985553 10:51139792-51139814 GCAATTCCAGGTGGAAGGAGAGG - Intronic
1069168058 10:65188524-65188546 GCAATACTATGTGGAATAGCAGG + Intergenic
1069714547 10:70512316-70512338 CCATTTCCAGGCTGAAAAGCTGG + Intronic
1070564392 10:77592547-77592569 GCAAATCCAGTTGGGAAAGATGG + Intronic
1070595624 10:77830842-77830864 GGAATCCCAGTTGGAAAAGGAGG - Exonic
1070596299 10:77835178-77835200 GTTTTTCCAGGTGGAAAAGGGGG - Intronic
1074229448 10:111519279-111519301 GTAATAGCAGGTGGAAAAGAAGG - Intergenic
1077979067 11:7280721-7280743 GTATTTCCAGGTGGAGAAGAAGG + Intronic
1078651380 11:13197075-13197097 GCAGTTCCAGGTTGTCAAGCTGG - Intergenic
1081606659 11:44531382-44531404 GCAACTCCATCTGGAACAGCGGG + Intergenic
1083089187 11:60182484-60182506 GCAATGCCAGGTGGGAAATTAGG - Intronic
1084114098 11:67031804-67031826 GCACAGCCAGGTGGCAAAGCAGG - Intronic
1089649305 11:119902004-119902026 TCAATGACAGGTGGAAAAGTAGG - Intergenic
1090258854 11:125304340-125304362 ACAGCTCCAGCTGGAAAAGCAGG - Intronic
1090378237 11:126306629-126306651 GCCATTTCAGGTGGAACAGGTGG + Exonic
1090831971 11:130426581-130426603 GCTTTTCCAGGAGGAAAAGAGGG - Intronic
1097962386 12:65545376-65545398 GCAACTGCATGTGGAAAAGCAGG - Intergenic
1099382173 12:81968510-81968532 CCAATTCCAGGGTGAAATGCAGG + Intergenic
1101443378 12:104719918-104719940 CCATTTCCTGGAGGAAAAGCGGG + Intronic
1101902974 12:108804961-108804983 GCAAGTCCGGGAGAAAAAGCAGG - Intronic
1101946532 12:109141439-109141461 GCACTTCCAGGTAGAAAATTTGG + Intronic
1103091671 12:118102492-118102514 CCAATTCCAACTGGGAAAGCAGG + Intronic
1103518587 12:121523235-121523257 GCAAGTCCCGGGGGAAAGGCTGG + Intronic
1106659595 13:31784741-31784763 GCAAGTCCAGGTGAAGAAGCTGG - Intronic
1106966842 13:35081150-35081172 GCAATTCATGGGGGAATAGCAGG + Intronic
1107212135 13:37870095-37870117 GCTATTCGAGGGGGACAAGCTGG - Exonic
1107795856 13:44051010-44051032 ACATTTCCAGGTGCAAAAGGAGG - Intergenic
1111901791 13:94208500-94208522 GAAATTCAAGGTGAAAAAGAAGG + Intronic
1113386306 13:109851458-109851480 GTATTTCAAGGTGGAAAAGAAGG + Intergenic
1115873128 14:37828584-37828606 GAAATTACAGGTGGAAAATCTGG - Intronic
1118437045 14:65781057-65781079 GAAATTCCTGTTGGAAAAGGTGG - Intergenic
1121016392 14:90551925-90551947 TAGAATCCAGGTGGAAAAGCTGG - Intronic
1121614097 14:95301331-95301353 CCACTCCCAGGTGGAAATGCGGG + Intronic
1121885875 14:97542314-97542336 GGAATTCCAGATGGAAAACCAGG - Intergenic
1121929957 14:97963484-97963506 GCAATTCCAGGTTGCTTAGCTGG + Intronic
1123476185 15:20593783-20593805 GCAAATCCTGGTGGACAAACTGG - Intergenic
1123480559 15:20627612-20627634 AAAAATCCAGGTGGAAAAACTGG + Intergenic
1123637449 15:22372755-22372777 AAAAATCCAGGTGGAAAAACTGG - Intergenic
1123641827 15:22406581-22406603 GCAAATCCTGGTGGACAAACTGG + Intergenic
1123901696 15:24883529-24883551 GCAATTGCAGGTGTAAAGCCTGG - Intronic
1124116210 15:26845654-26845676 GCACTTCCCAGTAGAAAAGCTGG - Intronic
1124181500 15:27479923-27479945 ACAGTTGCAGGTAGAAAAGCAGG + Intronic
1124858984 15:33419377-33419399 TCCATTTCAGGTGGAAAAGTTGG + Intronic
1127463044 15:59217404-59217426 GCAGTTCTAGAAGGAAAAGCAGG + Intronic
1127750362 15:62033753-62033775 GAAATTACAGGTAGAAAGGCAGG + Intronic
1127978799 15:64018710-64018732 GCAGCCCCAGGTGTAAAAGCTGG - Intronic
1134232572 16:12439989-12440011 GCAATTCCAGGAGGCAGAGTTGG - Intronic
1135747773 16:25031915-25031937 GCAATTCCAGGTGGAAAAGCAGG - Intergenic
1135757728 16:25111918-25111940 GCAGCTCGAGGTGGAACAGCAGG - Exonic
1137380810 16:47997812-47997834 GCAATCCCAGATGGAATAGTTGG + Intergenic
1138278752 16:55756597-55756619 GGAATTCCTTGTGGAAAGGCAGG - Intergenic
1138289800 16:55837037-55837059 GGAATTCCTTGTGGAAAGGCAGG + Intergenic
1138887870 16:61102188-61102210 GCAATTTCACTTGGAAAAACTGG + Intergenic
1140966323 16:79969580-79969602 GCACTTACAAGTGGTAAAGCTGG - Intergenic
1143268330 17:5657433-5657455 GCAATCCCAGGAGGAACAGGAGG - Intergenic
1143505431 17:7362078-7362100 GCAATGACAGATGAAAAAGCAGG + Intergenic
1147402373 17:40188731-40188753 GCAATTTCAGGTGGTTAAGGGGG - Intronic
1151438936 17:74115709-74115731 GCAGGTGCAGTTGGAAAAGCAGG - Intergenic
1151753114 17:76053151-76053173 GCTATTCCAGGAGGCAAAGGTGG + Intronic
1153163703 18:2238383-2238405 GCAACACCAGGCGGGAAAGCAGG - Intergenic
1153339705 18:3961315-3961337 GCAATTGGAGGAGGAAAAGGTGG - Intronic
1158952662 18:62509380-62509402 CCATTTCCAGGTGGAAGAGCCGG + Intergenic
1160109806 18:76015650-76015672 GCAGTTAGAGGAGGAAAAGCCGG - Intergenic
1164941510 19:32254982-32255004 GCAGCTCCAGGTGCCAAAGCTGG + Intergenic
1165243482 19:34484333-34484355 GCAACCCCAGGGGGAAGAGCGGG - Intronic
1166752003 19:45168727-45168749 GTAATTCCAGGTGGAAACAGGGG + Intronic
925003274 2:423058-423080 CCATTTCCAGCTGGACAAGCAGG + Intergenic
925345349 2:3168379-3168401 GCCTTTCCAGGTGGATATGCAGG + Intergenic
925815876 2:7748198-7748220 GAAATCCCAGGTAGAAAAGACGG + Intergenic
925901231 2:8510831-8510853 GCAACCCCAGGTGGAAACACTGG - Intergenic
926541993 2:14192593-14192615 GCCATTCCATGTGGAAATGGGGG + Intergenic
927053151 2:19349289-19349311 GTAACTACAGGTGGAAAGGCCGG - Intergenic
927930462 2:27040404-27040426 GCACATTCTGGTGGAAAAGCAGG - Exonic
928344711 2:30480873-30480895 GGAATGACAGGTGGAAAACCAGG + Intronic
929768720 2:44873351-44873373 CCAATCCCAGGTGGCAAAGGAGG - Intergenic
932570928 2:72938054-72938076 GCACGGGCAGGTGGAAAAGCAGG - Intergenic
933090793 2:78113381-78113403 GCACTTCCAGGTGGAAAATCTGG - Intergenic
933705196 2:85284412-85284434 GCAATACCAGCTGGAAAGGAGGG + Intronic
936880640 2:117246134-117246156 AAAATGCAAGGTGGAAAAGCAGG - Intergenic
938061099 2:128254796-128254818 GCACTTCCAGGTGTAGATGCAGG - Intronic
939420905 2:141967101-141967123 TCAATTCCATGTGGAACAACAGG - Intronic
940757327 2:157698597-157698619 ACAATTGCAGGTGGGAATGCAGG - Intergenic
943919764 2:193690213-193690235 GCAATTCCAGGTGCTTAACCAGG - Intergenic
945809573 2:214532285-214532307 GAGATTCCAGATGTAAAAGCTGG + Intronic
946999249 2:225434317-225434339 TCATTTACACGTGGAAAAGCTGG - Intronic
947587801 2:231367394-231367416 GCAATTCCAGGAGGGATAGCTGG - Intronic
1168864642 20:1075074-1075096 TCAACTACAAGTGGAAAAGCAGG + Intergenic
1172229892 20:33329713-33329735 GCAGCTCCAGCTGGGAAAGCTGG - Intergenic
1173758486 20:45539187-45539209 GGAATTCCAGGTGGGAAAGAGGG - Intronic
1175608173 20:60328502-60328524 CCAAGGCCAGGTGGAAAGGCTGG - Intergenic
1176241764 20:64078781-64078803 CCAATGCCAGGTTGACAAGCAGG - Intronic
1177046582 21:16178136-16178158 TGAATTCCAGGTGGAAGAGTGGG - Intergenic
1178713431 21:34941308-34941330 GAAATTCCAGGAGGAAAGGAGGG - Intronic
1179140105 21:38717905-38717927 TCAATCCCAGGTGAGAAAGCTGG + Intergenic
1179219293 21:39392247-39392269 CCAATTCCAGTCGGAAAAGCTGG - Intronic
1180226356 21:46394894-46394916 GCAATCCCAGCTGGCGAAGCAGG - Intronic
1181313888 22:21959922-21959944 ACATTTCCAGGTGGGAAATCAGG - Intronic
1182141192 22:27959887-27959909 GTAATTCAAAGGGGAAAAGCTGG + Intergenic
1182850250 22:33467797-33467819 GCAATTCCAGATGTTAGAGCCGG - Intronic
1182959628 22:34460077-34460099 GGAATTCCTGGGGGAAAAGAGGG - Intergenic
1183812237 22:40266791-40266813 CCAATTCCAGCTGGAGCAGCGGG + Exonic
949740858 3:7232034-7232056 TGAATTCCTGGTGGAGAAGCAGG + Intronic
952071467 3:29642209-29642231 GCAATTCTAAGTGGAAATGCTGG + Intronic
952090103 3:29875047-29875069 GTAATTACAAGTGGAAAAGTTGG + Intronic
952730536 3:36633585-36633607 GCAGTTCAAGGAGGAGAAGCTGG - Intergenic
953321150 3:41972954-41972976 GCTCTTCCAGGTTGTAAAGCTGG + Intergenic
953750923 3:45607757-45607779 GCCATTTCAGGTGGTAAAGCAGG + Intronic
954942981 3:54392147-54392169 CCAATTCCAGGTGGAGAAGCAGG + Intronic
955226690 3:57066124-57066146 GCAATTACAGGTGGACCAGATGG - Intronic
955999159 3:64710333-64710355 GCAATCCCAGGTGGAGGACCAGG + Intergenic
956955056 3:74328744-74328766 CCAATTCCAGCTGGAAAAGGGGG - Intronic
958054158 3:88387636-88387658 GCAGTTCCAGGTGGAAGAAAAGG - Intergenic
958983129 3:100748355-100748377 GCCATTCCAGGTTGAGAGGCAGG - Exonic
960325122 3:116286097-116286119 GAAATTCCAGGAGGAGAAGAGGG + Intronic
961351132 3:126304575-126304597 GCATTTCCAGGTGGAGGTGCTGG - Intergenic
961412523 3:126733111-126733133 GCTCTTCCAGGTGGCAAAGAGGG + Exonic
962108337 3:132416868-132416890 GCATTTGCAGGTGGGAATGCTGG - Intergenic
962963317 3:140331283-140331305 GCCAGCCCAGGTAGAAAAGCAGG - Intronic
967291095 3:187921057-187921079 GCAATTCCAGCTGCACAATCTGG + Intergenic
968141791 3:196264098-196264120 GAAATACCAGGAGGAAAAGCAGG - Intronic
968312782 3:197697767-197697789 GGAAGAACAGGTGGAAAAGCAGG + Intronic
968604645 4:1528328-1528350 GCTATTCCAGGTAGCAGAGCTGG + Intergenic
969218594 4:5744243-5744265 CCATTTCCAGGTGAGAAAGCTGG - Intronic
969610673 4:8226189-8226211 GCATTTCCTGTTGGAAAACCTGG - Intronic
973077955 4:45954164-45954186 GCCATTCCAGCTGGAACATCAGG + Intergenic
975270616 4:72428092-72428114 GCAATTACAGGGGGAAAGGATGG + Intronic
976151256 4:82094537-82094559 GAAATTTTAGGTGGAAAAGTTGG + Intergenic
976235476 4:82891555-82891577 GCCAAACCAGGTGGAAAATCGGG + Intronic
977152076 4:93525361-93525383 GCAATTCCAGTTAGAAGAGAAGG + Intronic
977764298 4:100778453-100778475 CCAGTTCCGGGTTGAAAAGCTGG + Intronic
978632631 4:110764537-110764559 GCAAGTCAAGGGGGAAAAGATGG + Intergenic
982646994 4:158037014-158037036 CCAATTCCAGGTTGCCAAGCTGG - Intergenic
982897777 4:160955930-160955952 GCAATACCAGGTGAAAAACTGGG + Intergenic
983988452 4:174089498-174089520 GCAATTACAAGTGGAAGGGCAGG - Intergenic
984601804 4:181736382-181736404 GCAATTACATGTGAAAGAGCAGG - Intergenic
985025210 4:185733480-185733502 GCAGAGCCAGGTGGAGAAGCAGG + Intronic
985789332 5:1916757-1916779 GCAATGCCAGGCGGTAAACCTGG + Intergenic
987261691 5:16210853-16210875 GCAGGACCAGGTGGAAGAGCAGG + Intergenic
987986387 5:25152719-25152741 GCAATGCCAGAGGGACAAGCAGG + Intergenic
988575085 5:32414642-32414664 TCAATTTCATTTGGAAAAGCAGG + Intronic
990329199 5:54708963-54708985 ACAATTCCATCTGGAAAAGATGG - Intergenic
991568537 5:68030418-68030440 GAAACTCCAGGTTGCAAAGCTGG - Intergenic
992154338 5:73939988-73940010 GGAAGTCCAGGTGGGAAAGGAGG - Intronic
993810895 5:92474407-92474429 GCAATGCCAAGTGGAAATGTGGG + Intergenic
994040728 5:95256778-95256800 GCAAGACGAGGTGGTAAAGCAGG + Intronic
996529298 5:124510709-124510731 CCAATTTCAGGTGGGAAAGGGGG + Intergenic
996845778 5:127897499-127897521 GCAATTCTTGATGTAAAAGCAGG + Intergenic
997753269 5:136370546-136370568 AGAATTCCAGGTGTAAAAGCTGG + Intronic
997872952 5:137521271-137521293 ACCATTCCAGGTAGAAAAGGGGG - Intronic
998863012 5:146463724-146463746 ACCATTACTGGTGGAAAAGCAGG - Exonic
998894801 5:146788055-146788077 TCATTTCCAGCTGGAAAATCAGG - Intronic
999277827 5:150343608-150343630 GCAAGTCCAGGTTCAAAATCAGG - Intergenic
1000512407 5:162199797-162199819 GAAATTCCAGGGTGAAATGCAGG - Intergenic
1001689135 5:173619473-173619495 GGAATCCCAGCTGGCAAAGCTGG + Intergenic
1001853482 5:174990175-174990197 GAAATTCTAGATAGAAAAGCAGG + Intergenic
1004712574 6:18186278-18186300 GTACTTCCAGCTGGCAAAGCTGG + Intronic
1006285974 6:33094640-33094662 GCATTTCCAGCAGGAGAAGCAGG + Intergenic
1012565107 6:100639291-100639313 GTAATTCCAGGTAGAAAATTGGG + Intronic
1013434570 6:110089467-110089489 GGAATTTCAGGAGGAAAAGAAGG + Intergenic
1013727906 6:113122730-113122752 GCAATCCCAGGAGAAAAAGAAGG + Intergenic
1017558698 6:155603600-155603622 GCATTTGAAGGTGGAAAAGAGGG + Intergenic
1019680020 7:2342242-2342264 GCAATTCCAGGTAGAAGGCCTGG + Intronic
1019990362 7:4686119-4686141 GCAATACCAGGTACCAAAGCCGG - Intronic
1020003067 7:4766525-4766547 ACAATGCCAAGTGAAAAAGCTGG + Exonic
1021417050 7:20398877-20398899 GAAAGTTCAGGTGGAAAACCAGG + Exonic
1021698775 7:23298172-23298194 GCAAATACAGGTGGTAAAGCAGG + Intergenic
1023976700 7:45035611-45035633 GCTATTCCAGGTGAAGAAGGCGG + Intronic
1024507928 7:50178710-50178732 GCAATCCCAGGAGCAAAGGCAGG - Intergenic
1027760536 7:82273194-82273216 ACAATTCCAGATGGATAATCTGG + Intronic
1028623051 7:92845771-92845793 GCAGGACCAGGAGGAAAAGCTGG - Intergenic
1030364588 7:108630859-108630881 GAAGTTGCAGGTGGAAATGCTGG - Intergenic
1031127598 7:117792063-117792085 GCACTTGGAGGTGGGAAAGCGGG + Exonic
1031267020 7:119593886-119593908 GCACTTTCAGCTGGAAAAACAGG + Intergenic
1032819213 7:135509574-135509596 GAAAATGCAGGGGGAAAAGCTGG + Intronic
1035175461 7:157046826-157046848 GAAAGTCCAGCTGGACAAGCTGG - Intergenic
1035187642 7:157138967-157138989 GCAGTTCCAGGTGCAAGCGCCGG + Exonic
1035870965 8:3135825-3135847 GCAATTGCAGTAGGAGAAGCAGG + Intronic
1037209449 8:16368219-16368241 GCATTTCCAGGTGGACAGACTGG + Intronic
1037690265 8:21176021-21176043 TAAATTCAAGGAGGAAAAGCTGG + Intergenic
1038646001 8:29362740-29362762 GAAATTCCAAGTGGAAATCCTGG - Intergenic
1040407679 8:47122762-47122784 GAAAATCCAGGTGGTAAAGATGG - Intergenic
1042384881 8:68162702-68162724 GCATGGCCAGGAGGAAAAGCTGG + Intronic
1044916294 8:97115903-97115925 GAAATTCCAAGTGGAAAACAAGG + Intronic
1044941252 8:97346226-97346248 AGAATTCCAGGTGGACAGGCTGG + Intergenic
1047208200 8:122820140-122820162 TCAAACCCAGGGGGAAAAGCCGG + Intronic
1049943729 9:574388-574410 TCAATTTAAGGTGGAAAAGCAGG - Intronic
1049943738 9:574445-574467 TCAATTTAAGGTGGAAAAGCAGG - Intronic
1050717137 9:8542693-8542715 CCAATTCCTGAAGGAAAAGCTGG - Intronic
1051164104 9:14243350-14243372 GCATTTGAAGGTGGAGAAGCTGG + Intronic
1052337941 9:27338620-27338642 CCAAGTCCATGTGGCAAAGCGGG + Intronic
1052695733 9:31875504-31875526 GAAATTGCAGGTGGAAGAGGGGG - Intergenic
1053212339 9:36241550-36241572 GAAGTGCCAGGTGGAGAAGCAGG - Intronic
1055211483 9:73799758-73799780 GAAATTCTGGGTGGAACAGCTGG - Intergenic
1055790068 9:79914164-79914186 GCACTTTCACCTGGAAAAGCTGG + Intergenic
1058633741 9:107016617-107016639 GACATTCCAGGTGCAAAAGGAGG + Intergenic
1061923611 9:133795375-133795397 CCAATGCCTGGGGGAAAAGCAGG + Intronic
1186330757 X:8530134-8530156 GGAGTTCCAGGTAGAAAAACAGG + Exonic
1186815850 X:13237379-13237401 GCAAGTCCAGAGGGAAAATCCGG + Intergenic
1189156250 X:38759868-38759890 GCATTTCCAGGTTGACAAACAGG + Intergenic
1190025649 X:46920236-46920258 GCATTTCTAGGGGGAAAAACTGG - Intronic
1191728283 X:64305089-64305111 GCAATTCAAGGTGGAACATTTGG - Intronic
1192263358 X:69522590-69522612 GCAAATCCAGGTGGATAATAGGG - Intronic
1195450088 X:105001480-105001502 GCAAATCAAGATGAAAAAGCTGG + Intronic
1196613635 X:117742804-117742826 CCAATTCCAGGTTGCCAAGCTGG - Intergenic
1196690250 X:118551297-118551319 GCAATTCCAGAGGGAACTGCAGG - Intronic
1197785630 X:130193981-130194003 CCAATTCCAGGTAGAAACCCTGG + Intergenic
1201385189 Y:13432659-13432681 GCAATTCCAGGTGGACCACGTGG - Intronic
1201432485 Y:13918669-13918691 GGAGTTCCAGGTAGAAAAACAGG - Intergenic