ID: 1135747778

View in Genome Browser
Species Human (GRCh38)
Location 16:25031931-25031953
Sequence GAATTGCGACGCGGGCGACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 18}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135747768_1135747778 29 Left 1135747768 16:25031879-25031901 CCATGGCCACTAGACAGAGGGAG 0: 1
1: 0
2: 1
3: 12
4: 189
Right 1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG 0: 1
1: 0
2: 0
3: 0
4: 18
1135747767_1135747778 30 Left 1135747767 16:25031878-25031900 CCCATGGCCACTAGACAGAGGGA 0: 1
1: 1
2: 3
3: 7
4: 265
Right 1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG 0: 1
1: 0
2: 0
3: 0
4: 18
1135747769_1135747778 23 Left 1135747769 16:25031885-25031907 CCACTAGACAGAGGGAGTCTTCC 0: 1
1: 0
2: 1
3: 13
4: 118
Right 1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG 0: 1
1: 0
2: 0
3: 0
4: 18
1135747772_1135747778 -4 Left 1135747772 16:25031912-25031934 CCTCCTGCTTTTCCACCTGGAAT 0: 1
1: 0
2: 2
3: 44
4: 312
Right 1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG 0: 1
1: 0
2: 0
3: 0
4: 18
1135747773_1135747778 -7 Left 1135747773 16:25031915-25031937 CCTGCTTTTCCACCTGGAATTGC 0: 1
1: 0
2: 3
3: 17
4: 210
Right 1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG 0: 1
1: 0
2: 0
3: 0
4: 18
1135747770_1135747778 2 Left 1135747770 16:25031906-25031928 CCTTCACCTCCTGCTTTTCCACC 0: 1
1: 0
2: 8
3: 91
4: 1093
Right 1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG 0: 1
1: 0
2: 0
3: 0
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135747778 Original CRISPR GAATTGCGACGCGGGCGACG AGG Intergenic
922959280 1:229632154-229632176 CAATTGCCACGGGGGCGGCGGGG - Intronic
1069664486 10:70145656-70145678 GAAGCGCGTCGCGGGCGGCGCGG + Exonic
1101705971 12:107221610-107221632 GATTTGGGAGGCGGGCGGCGGGG + Intergenic
1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG + Intergenic
1135757731 16:25111934-25111956 GAGCTGCGACGCAGACGACGAGG + Exonic
1145031320 17:19507368-19507390 GGATGGCGGCGCGGGGGACGCGG - Intronic
1152321533 17:79610790-79610812 GCAGAGCGAGGCGGGCGACGAGG + Intergenic
1160872963 19:1285528-1285550 GATTTGGGACGCGTGCGTCGGGG + Intergenic
1163588599 19:18177587-18177609 GATTTGCGAGGCGGGAGGCGGGG + Intronic
932352199 2:71041708-71041730 TAATTGCAACGTGGGAGACGAGG - Intergenic
934846346 2:97663631-97663653 GCTCTGCGACGCGGGCGAGGGGG + Intronic
949007171 2:241656291-241656313 GACGTGGGACGCGGGTGACGTGG - Intronic
1180159359 21:45992196-45992218 GAAAGGAGAGGCGGGCGACGAGG + Exonic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
1006042427 6:31267473-31267495 GAATTGAGAGGCGAGGGACGAGG - Intergenic
1006052016 6:31352560-31352582 GAATTGAGAGGCGAGGGACGAGG - Intronic
1029238695 7:99143668-99143690 GAATTCCGGGGCGGGCGAGGGGG + Intronic
1037825295 8:22156802-22156824 GGACTGCGGCGCGGGCGGCGGGG + Exonic
1059102451 9:111483701-111483723 GAAGGGCGACGCTCGCGACGCGG - Intronic