ID: 1135750125

View in Genome Browser
Species Human (GRCh38)
Location 16:25051513-25051535
Sequence CCAGCTTATAAGGATCAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135750125_1135750139 28 Left 1135750125 16:25051513-25051535 CCAGCTTGATCCTTATAAGCTGG No data
Right 1135750139 16:25051564-25051586 TGAAGCCTCAGATGAGGAAATGG No data
1135750125_1135750136 22 Left 1135750125 16:25051513-25051535 CCAGCTTGATCCTTATAAGCTGG No data
Right 1135750136 16:25051558-25051580 ATTCCCTGAAGCCTCAGATGAGG No data
1135750125_1135750132 -10 Left 1135750125 16:25051513-25051535 CCAGCTTGATCCTTATAAGCTGG No data
Right 1135750132 16:25051526-25051548 TATAAGCTGGGTGAATGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135750125 Original CRISPR CCAGCTTATAAGGATCAAGC TGG (reversed) Intergenic
No off target data available for this crispr