ID: 1135752839

View in Genome Browser
Species Human (GRCh38)
Location 16:25070683-25070705
Sequence CTGGTACTCATTTGGAGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135752835_1135752839 16 Left 1135752835 16:25070644-25070666 CCTTTCTGAAGATCTTTTTTTTT No data
Right 1135752839 16:25070683-25070705 CTGGTACTCATTTGGAGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135752839 Original CRISPR CTGGTACTCATTTGGAGGCC CGG Intergenic
No off target data available for this crispr