ID: 1135752907

View in Genome Browser
Species Human (GRCh38)
Location 16:25071031-25071053
Sequence GGGCCCTGAACACAAACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135752907_1135752913 30 Left 1135752907 16:25071031-25071053 CCCTGGGTTTGTGTTCAGGGCCC No data
Right 1135752913 16:25071084-25071106 TAATGAGCTTCTCTGTGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135752907 Original CRISPR GGGCCCTGAACACAAACCCA GGG (reversed) Intergenic
No off target data available for this crispr