ID: 1135755253

View in Genome Browser
Species Human (GRCh38)
Location 16:25091932-25091954
Sequence GCAGGTGGTGTGGGAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135755253_1135755262 12 Left 1135755253 16:25091932-25091954 CCAGCCACTCCCACACCACCTGC No data
Right 1135755262 16:25091967-25091989 TGATTGCAGTGTATGAAAATCGG No data
1135755253_1135755263 24 Left 1135755253 16:25091932-25091954 CCAGCCACTCCCACACCACCTGC No data
Right 1135755263 16:25091979-25092001 ATGAAAATCGGCCTTGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135755253 Original CRISPR GCAGGTGGTGTGGGAGTGGC TGG (reversed) Intergenic
No off target data available for this crispr