ID: 1135757731

View in Genome Browser
Species Human (GRCh38)
Location 16:25111934-25111956
Sequence GAGCTGCGACGCAGACGACG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 41}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135757723_1135757731 30 Left 1135757723 16:25111881-25111903 CCCATGGCCACTAGGCAGAGGGA 0: 1
1: 1
2: 0
3: 17
4: 200
Right 1135757731 16:25111934-25111956 GAGCTGCGACGCAGACGACGAGG 0: 1
1: 0
2: 0
3: 6
4: 41
1135757727_1135757731 -4 Left 1135757727 16:25111915-25111937 CCTCCTGCTGTTCCACCTCGAGC 0: 1
1: 0
2: 0
3: 12
4: 210
Right 1135757731 16:25111934-25111956 GAGCTGCGACGCAGACGACGAGG 0: 1
1: 0
2: 0
3: 6
4: 41
1135757726_1135757731 5 Left 1135757726 16:25111906-25111928 CCTCTATCACCTCCTGCTGTTCC 0: 1
1: 0
2: 0
3: 36
4: 453
Right 1135757731 16:25111934-25111956 GAGCTGCGACGCAGACGACGAGG 0: 1
1: 0
2: 0
3: 6
4: 41
1135757725_1135757731 23 Left 1135757725 16:25111888-25111910 CCACTAGGCAGAGGGAATCCTCT 0: 1
1: 1
2: 4
3: 22
4: 209
Right 1135757731 16:25111934-25111956 GAGCTGCGACGCAGACGACGAGG 0: 1
1: 0
2: 0
3: 6
4: 41
1135757728_1135757731 -7 Left 1135757728 16:25111918-25111940 CCTGCTGTTCCACCTCGAGCTGC 0: 1
1: 0
2: 1
3: 14
4: 293
Right 1135757731 16:25111934-25111956 GAGCTGCGACGCAGACGACGAGG 0: 1
1: 0
2: 0
3: 6
4: 41
1135757724_1135757731 29 Left 1135757724 16:25111882-25111904 CCATGGCCACTAGGCAGAGGGAA 0: 1
1: 0
2: 2
3: 20
4: 329
Right 1135757731 16:25111934-25111956 GAGCTGCGACGCAGACGACGAGG 0: 1
1: 0
2: 0
3: 6
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135757731 Original CRISPR GAGCTGCGACGCAGACGACG AGG Exonic
915828713 1:159105358-159105380 GAGCTGCGGCCCAGACCAAGGGG - Intronic
922518268 1:226223920-226223942 GCGCTGCGACGCCGACGGGGCGG - Exonic
1078108499 11:8373469-8373491 GAGCTGCGAGGAAGACGATGAGG + Intergenic
1091710665 12:2737924-2737946 GAGCTGTGACGCAGAGGACAAGG - Intergenic
1091713516 12:2759985-2760007 GAGCTGCGACACAGAGGACAAGG - Intergenic
1119520123 14:75278994-75279016 GGGCTTCAACGCAGACTACGAGG + Exonic
1124922361 15:34039083-34039105 GAGCTGCGGCGGAGACGCCCTGG + Exonic
1128213270 15:65916873-65916895 GAGCTGCAGCGCCGAGGACGGGG - Exonic
1129120286 15:73392249-73392271 GAGCAGGGAGGCAGACGAAGAGG + Intergenic
1129606716 15:77028577-77028599 GTGCCGGGACGCGGACGACGCGG + Exonic
1132936876 16:2485768-2485790 GATCTGCGACCCAGAAGATGCGG - Intronic
1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG + Intergenic
1135757731 16:25111934-25111956 GAGCTGCGACGCAGACGACGAGG + Exonic
1142373341 16:89694895-89694917 GAGCTGAGGCGCAGAGGGCGTGG - Intronic
1142560460 17:806252-806274 GAGCTGGGGTGCAGACGGCGGGG - Intronic
1142560478 17:806297-806319 GAGCTGGGGTGCAGACGGCGGGG - Intronic
1145897279 17:28466479-28466501 GAGCTTCAAAGCAGACGAGGTGG - Intronic
1148565297 17:48629110-48629132 GAGCTGGGATGCAGACTACAGGG - Intronic
1152660226 17:81538641-81538663 AAGCTGCGACGCAGACCCTGAGG - Intergenic
1157312110 18:46560290-46560312 GGGCAGCGACGAAGAGGACGAGG - Intronic
1158601981 18:58863694-58863716 GAGCTGCGGCCCAGACGCCCGGG + Intronic
1161255639 19:3307704-3307726 CAGCTGAGATGCAGACGACGAGG - Intergenic
1163316321 19:16542716-16542738 GGGCTGCGACGCCGACCAAGGGG - Intronic
1165307954 19:35013670-35013692 CAGCAGCGACGCAGACCATGGGG + Exonic
1165803223 19:38565531-38565553 GGGCGGAGACGCAGACGGCGAGG + Exonic
925143867 2:1568363-1568385 CAGCCGCGACGCAGGGGACGTGG + Intergenic
941494131 2:166180471-166180493 GAGAGGCGATGCAGACAACGAGG + Intergenic
1175082292 20:56430761-56430783 GAGCTGAGACCCAGAGGAGGAGG + Intronic
1179655886 21:42844582-42844604 GAGCTGCGTCTCAGCCGACGTGG - Intronic
1179893208 21:44348077-44348099 GAGCTGGGACAGAGACCACGTGG + Intergenic
1180230359 21:46423682-46423704 CAGCTGCGAAGCAGAGGAGGAGG + Intronic
1181948027 22:26533473-26533495 GAGCTGAGACCCAAACGACAAGG + Intronic
1184112262 22:42402275-42402297 GTGCTGGGACGCAGAGGACTCGG + Intronic
1184711289 22:46250772-46250794 GAGGGGCGCCGCAGGCGACGTGG - Intergenic
954316682 3:49805343-49805365 GAGCTGTGAGGGTGACGACGAGG - Exonic
959579819 3:107971832-107971854 GAGCAGAGACGCAAATGACGTGG - Intergenic
986003553 5:3649109-3649131 GAGCTGTGGCGCAGAAGATGAGG + Intergenic
992078928 5:73216237-73216259 GAGCTGTGGCGCAGAGCACGCGG + Intergenic
1001928500 5:175656963-175656985 GGGCTGCGATGCAGAGGATGAGG - Intergenic
1004271911 6:14203208-14203230 GAGCCGGGCCGCAGACGAAGAGG - Intergenic
1018853885 6:167662176-167662198 GAGCTGAAAAGCAGACGCCGTGG + Intergenic
1019198459 6:170295979-170296001 GAGCCGCGGCGCAGAGGAGGGGG - Intronic
1036236800 8:7045738-7045760 GAGCTGGGACAAAGAGGACGGGG + Intergenic
1036723944 8:11201779-11201801 GAGCTGCGACGCTGAGGAAGGGG - Intergenic
1043502739 8:80873618-80873640 GGACGGCGACGAAGACGACGAGG - Intronic
1047316604 8:123740641-123740663 GAGGTGGGACACAGAGGACGTGG - Intergenic
1049747374 8:144268741-144268763 GAGCTGCGTGGCAGAAGATGGGG + Intronic
1197754530 X:129984376-129984398 GAGCCGGGACGACGACGACGAGG + Intronic