ID: 1135758154

View in Genome Browser
Species Human (GRCh38)
Location 16:25115156-25115178
Sequence TCAAGCAACTTGGAAAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 1, 2: 1, 3: 29, 4: 315}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135758154 Original CRISPR TCAAGCAACTTGGAAAAAAG GGG (reversed) Intronic
901114868 1:6835242-6835264 TCATCCAACTTAGAAAAATGTGG - Intronic
901615034 1:10532174-10532196 GTCAGCAACTTGGAAAAAAGCGG - Intronic
903108479 1:21106792-21106814 TAAAGCAACTTGCAGAGAAGTGG + Intronic
904789722 1:33010268-33010290 TCAAGCAAACTGGAATCAAGGGG - Intronic
906101665 1:43267783-43267805 TCAAGTAACTTGGAGTCAAGTGG - Intronic
907128203 1:52071218-52071240 TGAAGCAACTTGGAACAATTAGG - Intronic
907238547 1:53067788-53067810 TCAAGCAACTGGGACTATAGGGG - Intronic
907800014 1:57755260-57755282 TAAATCAACTTGGGAAAAAGTGG + Intronic
908223556 1:62033568-62033590 TCAAGCAGATTGGATAAAGGGGG - Intronic
908525401 1:64983126-64983148 TCCAGCAACATAGGAAAAAGGGG + Intergenic
909315737 1:74215706-74215728 ACTAGCATTTTGGAAAAAAGAGG + Intronic
909646277 1:77920764-77920786 TCCATCAGCTTAGAAAAAAGAGG + Intronic
910087878 1:83425593-83425615 TGAAGCAACTTGGAAAAACATGG + Intergenic
911736359 1:101340908-101340930 TTAAGCAACTGGGAAATTAGGGG - Intergenic
914463632 1:147907840-147907862 TCTGGCAACTTGGAAAGGAGAGG + Intergenic
914749719 1:150526447-150526469 CCCAGCAACTTGGAAAGATGAGG - Intergenic
914947845 1:152081441-152081463 TCAGGCAAATTTGTAAAAAGTGG - Intergenic
916243871 1:162667397-162667419 TCAAGCCACTGGGAAACACGGGG - Intronic
917043411 1:170831137-170831159 TCAAGCTACTTGGGAAACTGAGG + Intergenic
917320350 1:173774647-173774669 TCCAGCAGCTTGGAAAGCAGGGG - Intronic
919205761 1:194420435-194420457 ACAAGCACCTGGGCAAAAAGGGG - Intergenic
919421522 1:197375441-197375463 GCAAGCAACTTTGAAACATGAGG - Intronic
919984494 1:202663360-202663382 CCCAGCAACCTGGAAAGAAGAGG - Intronic
921105282 1:211970821-211970843 TAAAGCCACTGGGAAAAAACTGG + Intronic
923151671 1:231239013-231239035 TCAAGGAACTTAGAGAAGAGCGG - Exonic
923446225 1:234073772-234073794 ACAAGCAAATGGGAAAAATGAGG - Intronic
924249330 1:242115830-242115852 TTAAGCAAAATGAAAAAAAGAGG + Intronic
924678596 1:246206395-246206417 TAAAGAAACTTGTAATAAAGAGG + Intronic
1063687659 10:8253635-8253657 TCAAGGAACTTGGAGACATGAGG - Intergenic
1064788896 10:18932881-18932903 TCAGGAAATTTGAAAAAAAGTGG + Intergenic
1065190813 10:23206531-23206553 TCAAGCAACTTGAAAGCAATAGG - Intronic
1065511354 10:26481346-26481368 CAAAGCAATTTGGAAATAAGTGG - Intronic
1066008911 10:31174717-31174739 CAAAACAACTTGGAAAAAAATGG - Intergenic
1066026682 10:31364682-31364704 TCAGGCAAATTTGTAAAAAGTGG - Intronic
1066193133 10:33074239-33074261 TCATCCAACTGGGAAAACAGAGG + Intergenic
1067366852 10:45639452-45639474 TCAATCACTTTGGAAAAAACTGG + Intronic
1070227716 10:74527823-74527845 TCAAGACACTTGGAAGCAAGAGG - Intronic
1070631089 10:78085272-78085294 TCCAGCTACTTGGAAAACTGAGG - Intergenic
1072130664 10:92491120-92491142 TCCAGCTACTTGGAAAACTGAGG + Intronic
1072779206 10:98233916-98233938 TCAAGTAACGGGGAAAAAAGGGG - Intronic
1073621959 10:105059213-105059235 TCAAGCACGGTGGAGAAAAGAGG - Intronic
1074201675 10:111243106-111243128 TCCATCAACTTAGAAAATAGAGG - Intergenic
1076153592 10:128185397-128185419 AAAAGCAACTTGGAAGAATGAGG - Intergenic
1077929505 11:6716189-6716211 TCAATCAACTTTGGAAAAAGTGG - Intergenic
1078579325 11:12526354-12526376 CCAAGCCACTGGGAAAGAAGGGG - Intronic
1078670383 11:13359512-13359534 TCTATTAAATTGGAAAAAAGTGG + Intronic
1081431438 11:42980730-42980752 ACAAGCAACTAGAAAAAAAGGGG + Intergenic
1082057071 11:47827020-47827042 TCAAGAAACTAGGAATAAAGGGG + Intronic
1083594196 11:63911299-63911321 TCCAGAAACTTGGAGAAATGGGG - Exonic
1084810042 11:71606674-71606696 TCCAGCTACTTGGGAAACAGAGG + Intergenic
1086103316 11:83124279-83124301 TCCAGCAACTTGGGAAACTGAGG - Intergenic
1086103345 11:83124516-83124538 TCCAGCAACTTGGGAAACTGAGG + Intergenic
1086440277 11:86822877-86822899 TCCAGCATCTTGGAATTAAGAGG - Intronic
1087303829 11:96465952-96465974 TAAAGGAAATTGAAAAAAAGTGG + Intronic
1087412934 11:97814829-97814851 TAAAGAGACTTGGAAAAAATAGG + Intergenic
1087939796 11:104082060-104082082 ACAAGCAACTGGGAAGAAATTGG - Intronic
1087943588 11:104130463-104130485 TCTAGCCATTTGGAGAAAAGTGG - Intronic
1087968377 11:104448541-104448563 TCAAGCAACCAAGAATAAAGTGG - Intergenic
1088783340 11:113157440-113157462 CCAAGAAAGTAGGAAAAAAGAGG - Intronic
1088885176 11:114000611-114000633 TAAAGCAACGTGGATAAAAGGGG - Intergenic
1090272757 11:125399351-125399373 GCAAGAAACTTGCATAAAAGAGG + Intronic
1092687397 12:11065821-11065843 TCCTGCAACTTGGAAGAAACTGG + Intronic
1092689889 12:11096579-11096601 TCATGAAACTCGGAAAAAACTGG + Intronic
1092690206 12:11100362-11100384 TCCTGCAACTTGGAAGAAACTGG + Intronic
1092693097 12:11137018-11137040 TCCTGCAACTTGGAAGAAACCGG + Intronic
1097200171 12:57271620-57271642 ACAATCAACATGGAAATAAGAGG + Intronic
1099321465 12:81155669-81155691 TCAAGAGGCATGGAAAAAAGAGG - Intronic
1099477621 12:83126568-83126590 TGAACCAAGTTGGACAAAAGGGG + Intronic
1099661511 12:85568818-85568840 GGAAGCAAGTAGGAAAAAAGGGG - Intergenic
1100049586 12:90431047-90431069 TCAAGGAACTTGGAAAAAAGAGG - Intergenic
1101210333 12:102529138-102529160 ACATGAGACTTGGAAAAAAGAGG + Intergenic
1101258266 12:103001983-103002005 TTAAGTTACTTGAAAAAAAGTGG + Intergenic
1101514516 12:105421811-105421833 TTAAGCATCTTGGATAAAGGGGG + Intergenic
1101833321 12:108276397-108276419 TCAGCCAGCTTGGAAAAGAGGGG - Intergenic
1102879512 12:116473649-116473671 TCAAGTAACTTGCAAACAACAGG - Intergenic
1103109512 12:118263033-118263055 CAAAGCAACTTTGAAAAAGGAGG + Intronic
1103262956 12:119604582-119604604 ACATGCAAGTTGGAAGAAAGGGG - Intronic
1104359656 12:128120830-128120852 TCAAGGATCTTGAAAATAAGGGG - Intergenic
1105327001 13:19379905-19379927 TCAATCAATATGGAAAAAACCGG - Intergenic
1105541337 13:21319797-21319819 TCAAGAAGCTAGAAAAAAAGCGG + Intergenic
1105622911 13:22086627-22086649 TAATGCAATTTGGGAAAAAGTGG - Intergenic
1106272073 13:28164701-28164723 TCAAGAAACTTGGAAAATTCTGG - Intronic
1106853588 13:33821647-33821669 TCAAGTGACTTGGTAAAGAGTGG + Intronic
1106878744 13:34105842-34105864 TAAAGCAACTGGGAATAAAAAGG - Intergenic
1108315003 13:49228229-49228251 TCAAGTAACTAGGACAACAGGGG - Intergenic
1109316576 13:60756478-60756500 TTAAGCAACTTGGCTCAAAGTGG + Intergenic
1110572254 13:77018308-77018330 TCAAGCATATTAGAAAAAAAGGG - Intronic
1110627049 13:77663259-77663281 TCAGGCAAATTTGTAAAAAGTGG - Intergenic
1111557341 13:89897855-89897877 TCTAGGAACTAGCAAAAAAGAGG + Intergenic
1112270689 13:97966303-97966325 TCAACAAACTAGGAATAAAGAGG - Intronic
1112939991 13:104849755-104849777 TCAATCACCTTGGAAAATAATGG - Intergenic
1114809888 14:25886097-25886119 AGAAGCATCTTGGAAATAAGAGG - Intergenic
1115016584 14:28622931-28622953 TGAAACAGTTTGGAAAAAAGAGG + Intergenic
1116507746 14:45705561-45705583 ACAAGCAACTTAGAATTAAGGGG + Intergenic
1116698686 14:48208521-48208543 TCAAGCAAATTGGAAGTTAGTGG + Intergenic
1118836327 14:69480502-69480524 CCCAGCAACCTGGACAAAAGTGG - Intergenic
1119587277 14:75848165-75848187 TCAGGCAACTTGGAACAGTGAGG - Intronic
1119786642 14:77319529-77319551 GCAAGCAACTTTGAGAGAAGAGG + Intronic
1119826692 14:77662528-77662550 GCAAGCAACCTGGAAAACTGGGG + Intergenic
1119947594 14:78711299-78711321 TCAAACAATTTTGAACAAAGGGG + Intronic
1122435626 14:101694053-101694075 ACAAACAAGTTGAAAAAAAGGGG + Intergenic
1124591578 15:31058618-31058640 TCAAGCACCTTGTAAAAGTGGGG + Intronic
1125328054 15:38556874-38556896 CCCAGCAACTTGAATAAAAGAGG - Intronic
1125607639 15:40950598-40950620 TCATAAAACTTGGAAAATAGAGG + Intergenic
1126077361 15:44924109-44924131 ACAAGCAATTTGGAAAGAAGAGG + Intergenic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1126566847 15:50109629-50109651 TCAAGCAAGATGAAAAAAAAGGG + Intronic
1128460058 15:67860124-67860146 TCAAACATCTTGGAAAAAGGAGG - Intergenic
1131861350 15:96656798-96656820 TCATGCAACAGGTAAAAAAGAGG + Intergenic
1132090906 15:98947403-98947425 TCAAGCCACATGGAAAAACCTGG - Intronic
1133312996 16:4863042-4863064 TTAAGAAACTTTGAAAAATGGGG + Intronic
1133510082 16:6449729-6449751 TCAAGCATACTGGAAAGAAGGGG + Intronic
1133790526 16:9006191-9006213 CCCAGCAACTTGGAAGAATGAGG + Intergenic
1134389468 16:13806091-13806113 TCAAGTAAATGGAAAAAAAGTGG - Intergenic
1135758154 16:25115156-25115178 TCAAGCAACTTGGAAAAAAGGGG - Intronic
1139209416 16:65062300-65062322 TCCAGAAACTTGCAAATAAGCGG - Intronic
1144102682 17:11956861-11956883 TTAAGAAACTAGGAAAAAAATGG + Intronic
1144304335 17:13953981-13954003 TAAACCAAATTGGCAAAAAGTGG - Intergenic
1144688959 17:17246826-17246848 TCAAGCAACTTAAAACAAAAAGG + Exonic
1145861694 17:28216623-28216645 TCATGGAACCTGGAAAACAGAGG + Intergenic
1145866627 17:28246144-28246166 TCAGGCAAGGTGGAAAGAAGTGG - Intergenic
1147344186 17:39776801-39776823 GCAAGCAGCTTTGGAAAAAGAGG + Intronic
1149126803 17:53244469-53244491 TCAGGGAACTTGGACAAGAGAGG + Intergenic
1149205426 17:54238929-54238951 TCAAGCAACAAAGACAAAAGGGG + Intergenic
1151028597 17:70708414-70708436 TCAAGGAAATTGGAACAAAGGGG + Intergenic
1153208469 18:2731703-2731725 TAAAGAAACTTGGAAATAAGAGG + Intronic
1153580572 18:6569427-6569449 TCCAGGGACTTGGAAAAAAAGGG - Intronic
1155838474 18:30616940-30616962 TCAAGCAAATTGGAAAGCACAGG - Intergenic
1155996694 18:32338146-32338168 TCAAGCTACTTGGAAATTAGAGG - Intronic
1156114498 18:33771483-33771505 TCAAAAAACTAGGAATAAAGGGG - Intergenic
1156847673 18:41687324-41687346 TTAGGCAACTGGGAAAGAAGAGG + Intergenic
1157030772 18:43905082-43905104 TCAAGCAGCTTGTAAAATACAGG - Intergenic
1157431732 18:47633861-47633883 TCTACCAACTTGCAAAAGAGAGG + Intergenic
1158043852 18:53131442-53131464 TTAAGCATATTGGAAACAAGAGG + Intronic
1158238325 18:55346012-55346034 TCAAGCACCTGGGATAAAAGGGG + Intronic
1159718221 18:71851406-71851428 TCAAGCACCTAGGAATAAACAGG - Intergenic
1160192121 18:76722979-76723001 TGAAGGAACTTAGAATAAAGAGG - Intergenic
1164283458 19:23789600-23789622 TCTAGGACCTTGGCAAAAAGAGG - Intronic
1164972630 19:32545583-32545605 TCCAGCTACTTGGAAGAATGGGG + Intergenic
1165212687 19:34248366-34248388 GCAAGGAACTTGAAATAAAGAGG + Intergenic
1165252424 19:34551068-34551090 TCCAGCTACTTGGAAAACTGAGG - Intergenic
926774340 2:16407218-16407240 TCATGCTACTTTGAAAAATGAGG - Intergenic
926841456 2:17085314-17085336 TAAAACAAGTTGGAAAACAGAGG - Intergenic
930552794 2:52856543-52856565 TGCAGCAACATGGATAAAAGTGG + Intergenic
931489699 2:62731574-62731596 TCAGACAACTAGGAAAAAAGGGG - Intronic
931808683 2:65833039-65833061 TCAAACATATGGGAAAAAAGTGG + Intergenic
932063611 2:68530096-68530118 TCAGGCAAATTTGTAAAAAGTGG - Intronic
933155583 2:78969527-78969549 TCAAGCAACCTTGTAAAGAGTGG + Intergenic
933429353 2:82155572-82155594 TCAACAAACAAGGAAAAAAGTGG - Intergenic
935854925 2:107263428-107263450 TCAAGGCACTTTGAAAAAACTGG + Intergenic
938652055 2:133393298-133393320 TCAAACAACTTGGAACGAAGTGG - Intronic
938920408 2:135989553-135989575 AAAAGCAACTTGTAAGAAAGGGG - Intergenic
939434629 2:142158947-142158969 TCTAGCAAATTGGAAAAAGAAGG + Intergenic
940395624 2:153187245-153187267 ACAAGAAACTCAGAAAAAAGTGG - Intergenic
940910828 2:159208601-159208623 CCAAGCATCATGGAAAAATGTGG - Intronic
942779779 2:179628454-179628476 TCAAGAAACTCAGAAGAAAGAGG - Intronic
943071383 2:183144448-183144470 AAATGAAACTTGGAAAAAAGAGG - Intronic
944851338 2:203722617-203722639 TCAAGAGACTTGGAAACCAGGGG + Intronic
1169635115 20:7681620-7681642 TGAACCAACTGGGAAAAGAGTGG - Intergenic
1169779575 20:9294646-9294668 TCCAGCAAAAAGGAAAAAAGGGG - Intronic
1172550060 20:35792140-35792162 TCAAGTATCTGGGAAGAAAGTGG + Intronic
1174042491 20:47709769-47709791 TAAAGCAATATGGAAAAATGCGG + Intronic
1174252429 20:49229759-49229781 TCCAGCTACTTGGAAAGCAGTGG - Intronic
1175018777 20:55822095-55822117 TCAAGAAACTTGGAATTCAGAGG + Intergenic
1176694763 21:9961451-9961473 TAAAACAACATTGAAAAAAGAGG - Intergenic
1177021762 21:15869130-15869152 TCAAGCTACTTGGGAGACAGAGG + Intronic
1182048648 22:27296766-27296788 ACAAGAAACTGGGAATAAAGGGG - Intergenic
1183156652 22:36080947-36080969 CCAAGAAACATGAAAAAAAGTGG - Intergenic
1183993736 22:41617666-41617688 AAAAGCAATATGGAAAAAAGAGG + Intronic
1184215741 22:43066185-43066207 TCAAGCTACTAGAAAAAAAATGG + Intronic
1184638171 22:45852491-45852513 TAAAGCAGCTTGGAAAATGGGGG + Intergenic
1185166158 22:49263545-49263567 TCAAGGACCTGGGAAAAATGGGG + Intergenic
949143769 3:669978-670000 TCAATCAACTTGGCAAGATGGGG - Intergenic
950572117 3:13807722-13807744 CCCAGCAACTGGGAAGAAAGAGG + Intergenic
953633889 3:44645244-44645266 TCAATAAAGTTGGATAAAAGAGG + Exonic
955795366 3:62630819-62630841 TCAAGCACCTTGTTAAAAAGTGG - Intronic
956055580 3:65295178-65295200 TAAAGCATCTTGGAAAAAAGCGG - Intergenic
956118781 3:65945039-65945061 ACAAGGAAATTGGAAACAAGTGG + Intronic
956449014 3:69355101-69355123 TCAAACAACTTGGGCAGAAGTGG + Intronic
956455088 3:69412883-69412905 TCAAGGAACTGGGAACAAAGTGG - Intronic
957412144 3:79856131-79856153 CCTAGAAACTTTGAAAAAAGTGG + Intergenic
957635394 3:82777536-82777558 TCCAGCATCTTGGATAAAACTGG + Intergenic
957983111 3:87537987-87538009 TTATGGTACTTGGAAAAAAGGGG - Intergenic
958523810 3:95226430-95226452 TGGAGCAACTTGCAGAAAAGGGG - Intergenic
959254076 3:103988980-103989002 TCCAGCATCTTGGAAAAATCAGG + Intergenic
959652002 3:108759145-108759167 TCAGGCAACTTTGAGAAATGAGG + Intergenic
959832674 3:110883044-110883066 ACAAGCAAGTGGTAAAAAAGAGG + Intergenic
960739746 3:120820057-120820079 TTATGCAACCTGGAAAAAGGAGG + Intergenic
961478037 3:127160787-127160809 CCCAGCAACTTAGTAAAAAGGGG + Intergenic
961602352 3:128071666-128071688 TCAAGTACCTTGTAAAAAACTGG - Exonic
961661149 3:128469464-128469486 TGAAGCAACTTGGAACTCAGAGG - Intergenic
962708849 3:138068866-138068888 TGATGCAATTTGGAAAACAGAGG - Intronic
963583148 3:147152293-147152315 GCATGTAACTTGGAAACAAGAGG - Intergenic
964200070 3:154109065-154109087 TAAAGCATCTGGGAAGAAAGGGG - Intergenic
965195081 3:165584828-165584850 TCAAATAACTTGGAAAATACTGG - Intergenic
965290380 3:166871145-166871167 TGCAGCAACTTGGATAAAACTGG + Intergenic
965455368 3:168893274-168893296 TCCAGCAACTTTTTAAAAAGTGG - Intergenic
966198369 3:177336107-177336129 TCAAAAAACCTGGAGAAAAGAGG + Intergenic
967348723 3:188488378-188488400 AGATGCAACTTGGAAAACAGGGG + Intronic
970084346 4:12329436-12329458 CCAAGCAAGATGGCAAAAAGAGG - Intergenic
971058227 4:22937477-22937499 ACAAGCAATTTGGAAGAGAGAGG + Intergenic
971109847 4:23572819-23572841 CCTAGCCACATGGAAAAAAGAGG - Intergenic
971175555 4:24279163-24279185 TCAAGCAGGTTGGAACAGAGTGG - Intergenic
971576624 4:28282734-28282756 TCAAGAAACTTAGAGTAAAGGGG + Intergenic
971673862 4:29598508-29598530 TCACTCAAATTGGAAAGAAGAGG - Intergenic
972312925 4:37898293-37898315 TAAAACACCTTGGAAAAAAGAGG + Intronic
972602594 4:40586310-40586332 TCAAACACCTTGAAAAGAAGAGG + Intronic
973131160 4:46650444-46650466 TCAAGGAACTAGGAAAACAAGGG + Intergenic
973581078 4:52344863-52344885 TAAAACAAATTGGAAATAAGTGG - Intergenic
973996077 4:56460493-56460515 GCAATCAACTTGGAAAAGGGTGG - Exonic
974034228 4:56803308-56803330 TCAAGCTACTTGGAAAGCTGAGG + Intergenic
974111282 4:57528549-57528571 TCAAGTAACTTGGAACAACAGGG - Intergenic
974324914 4:60401413-60401435 TCAAGCAATGTGGAAAAATTTGG + Intergenic
975269595 4:72416107-72416129 TCAAGCAACATAGAAATAAAAGG + Intronic
975461349 4:74657164-74657186 ACATACAATTTGGAAAAAAGAGG + Intergenic
976236122 4:82899577-82899599 TCAAGGAACTTTGGAAAAATTGG - Intronic
976880125 4:89911506-89911528 TCAAACAACTTGAAACAAATTGG - Intronic
978374665 4:108062209-108062231 TCAAACAACTTGCCCAAAAGGGG - Intronic
979737750 4:124108809-124108831 TTAGGAAACTTGGAAAAGAGAGG + Intergenic
980069930 4:128233459-128233481 TAAAGCTAGTTGGAAAGAAGGGG + Intergenic
980367387 4:131821668-131821690 TAAAACAACATTGAAAAAAGAGG - Intergenic
981056822 4:140371690-140371712 TAAAGCAACTTTTAAAAAAGTGG - Intronic
983294954 4:165855220-165855242 TTAATCAGCTTGGAAAAAAATGG - Intergenic
983435697 4:167712107-167712129 TTAAGCAACTTCCAAAAAGGAGG - Intergenic
983780110 4:171659605-171659627 TCAAGCTACATGGAACATAGAGG - Intergenic
983924233 4:173380358-173380380 TATAGCAACTTGGAAAAGATTGG - Intergenic
984130641 4:175871352-175871374 TCAAGCTACTTGGAAAGCTGAGG + Intronic
984933893 4:184873084-184873106 TCAGGCACCCTGGAAAAAAGAGG - Intergenic
985294783 4:188424591-188424613 TCAATTAACATGGAAAAAGGTGG - Intergenic
985389324 4:189478658-189478680 TCAGGCTGCCTGGAAAAAAGAGG + Intergenic
986079410 5:4374657-4374679 TCAAGAGAGTTGGAAAAAATAGG - Intergenic
986189077 5:5476853-5476875 TCAAGCAAGTATGAAAAAATTGG - Intronic
986408600 5:7452399-7452421 TGAAGCAACTTGTATAAAACTGG - Intronic
986598710 5:9449824-9449846 TCTAGCAACTTGTAAGAAAGGGG - Intronic
986630049 5:9763176-9763198 TCAAGAAAGTTGCAAAAAAAGGG + Intergenic
986975924 5:13393784-13393806 ATAAGCAACTTGCAAAAATGAGG - Intergenic
989504111 5:42206182-42206204 TGAAGCAACATGGAGAAAAATGG + Intergenic
990878945 5:60518507-60518529 TAAAGCAACCAGGAAAGAAGAGG + Intronic
991174072 5:63665526-63665548 TCAAGCAAAGAGGAAAAAAAAGG + Intergenic
992190383 5:74285816-74285838 TGAAGCAACATGGGAACAAGTGG - Intergenic
993042286 5:82827987-82828009 TCAGGCAAGATGGAAAAAAGAGG + Intergenic
993511664 5:88778420-88778442 TCAAGCAAATTGAAGAGAAGAGG - Intronic
993829192 5:92732399-92732421 TATAGCAAAGTGGAAAAAAGTGG - Intergenic
994301485 5:98153279-98153301 ACAAGCAACCTGGAGAAAGGAGG - Intergenic
995876803 5:116798837-116798859 TTAAACAACTTTGGAAAAAGAGG - Intergenic
996695077 5:126385316-126385338 TCTTGCAACTGGGAAAAGAGAGG + Intronic
997625443 5:135327829-135327851 TCAATCAACAGGGAAAACAGTGG - Intronic
998658858 5:144213437-144213459 ACAAGTAAGTTGTAAAAAAGAGG - Intronic
1002029155 5:176415756-176415778 TCCTGCAGCTGGGAAAAAAGAGG - Intronic
1004315858 6:14587113-14587135 ACAAGCAAATAGAAAAAAAGAGG + Intergenic
1005368701 6:25107125-25107147 TCTAGCCACTGGGAATAAAGTGG + Intergenic
1006671654 6:35733054-35733076 TCCAGCAACTTGGTAAACTGAGG + Intergenic
1007169420 6:39852228-39852250 AGAAGCAATTTGGAGAAAAGGGG - Intronic
1007942147 6:45791483-45791505 TTAAGCAGCCTGGAAAAAACAGG - Intergenic
1008446367 6:51596894-51596916 ACATACAACTTGGAAAAAAAAGG - Intergenic
1008648670 6:53542297-53542319 TCAAGGGGCTTGGAAAAGAGTGG - Intronic
1008969163 6:57346660-57346682 TCAGGGAACTTGGAGGAAAGAGG - Intronic
1009158141 6:60248478-60248500 TCAGGGAACTTGGAGGAAAGAGG - Intergenic
1009398902 6:63230969-63230991 TCAGGCAAATTTGTAAAAAGTGG - Intergenic
1010635082 6:78248973-78248995 TCAAGCAACTTGGGAATAGAAGG - Intergenic
1010725440 6:79327468-79327490 GCAAACAACTTAGAACAAAGTGG - Intergenic
1011869514 6:91875126-91875148 GCCAGCAACGTGGAAAGAAGTGG - Intergenic
1012301799 6:97598707-97598729 TCAAGGAACTAGAGAAAAAGGGG - Intergenic
1012350073 6:98239499-98239521 TTAAGCAACATGGCAAAGAGTGG - Intergenic
1012851281 6:104448541-104448563 TCAAGTAACTTGAAAAAAGTTGG - Intergenic
1013118554 6:107121634-107121656 TTCAGCAACTTGAAAAAAGGAGG - Intergenic
1014126905 6:117786694-117786716 TTAAGCAAATTGAAATAAAGAGG + Intergenic
1014735211 6:125086466-125086488 TCAAGCAACATACACAAAAGTGG - Exonic
1015831850 6:137378335-137378357 ACAAGCAAGGAGGAAAAAAGAGG - Intergenic
1016903910 6:149130544-149130566 TTTATCCACTTGGAAAAAAGGGG - Intergenic
1018323302 6:162636446-162636468 TGAAGAAACTTGGCACAAAGAGG + Intronic
1019884945 7:3895643-3895665 TTACGCAACTTGAAAAGAAGAGG - Intronic
1022572065 7:31464506-31464528 TCAAGCATCTTGGGAAAGAAAGG + Intergenic
1022770110 7:33461453-33461475 TTAAGTAACTTTGGAAAAAGTGG - Intronic
1023232223 7:38046118-38046140 ACATCCAACTTGGAAAAACGAGG - Intergenic
1023344584 7:39258517-39258539 TGAAGCAACCAGGAAAAAGGTGG - Intronic
1023766736 7:43518652-43518674 TCTTGCAACTTGAAAAAAAGAGG + Intronic
1024888355 7:54171035-54171057 TCAACAAACTAAGAAAAAAGGGG - Intergenic
1026212644 7:68319403-68319425 TCAAGCAACTTTGCAAAGATTGG + Intergenic
1027304759 7:76882067-76882089 TGAAGCAACTTGGAAAACCATGG + Intergenic
1029146633 7:98450979-98451001 TCCAGCAACTTGGATGAAACTGG - Intergenic
1030750034 7:113220676-113220698 ATAAGCAACTTTGAAAAAAATGG + Intergenic
1030908774 7:115220405-115220427 TCTACACACTTGGAAAAAAGGGG + Intergenic
1034066513 7:148141978-148142000 TCAAGGAATTTGGAAACAAAAGG + Intronic
1034101737 7:148456809-148456831 ACCTGCAACTTGGAAAACAGGGG + Intergenic
1034866572 7:154647400-154647422 TCAAGAAACTTGGAGAAATAAGG + Intronic
1035015894 7:155765739-155765761 TCAAGGAACTTTTAAAGAAGAGG - Intronic
1036001823 8:4613604-4613626 TCAAGTCACTTAGCAAAAAGAGG - Intronic
1037043493 8:14266959-14266981 TGAAGGAACTAGGACAAAAGTGG + Intronic
1037161633 8:15780397-15780419 TTCATCAACTTGGAACAAAGGGG + Intergenic
1038373285 8:27013000-27013022 TCAGGCAAATTTGTAAAAAGTGG - Intergenic
1038706387 8:29897885-29897907 TCCAGGAACTTGGAGCAAAGTGG + Intergenic
1038817137 8:30915601-30915623 ACAAGAAAATTGAAAAAAAGAGG + Intergenic
1042445896 8:68884780-68884802 TCAAGCATCCAGGAAAAACGAGG + Intergenic
1044220244 8:89662215-89662237 ATAAGCAATTAGGAAAAAAGGGG + Intergenic
1045849673 8:106679048-106679070 TCAAGCAACTGTCAAAAAAAAGG - Intronic
1045876667 8:106989859-106989881 TAAAGGATCTTGGGAAAAAGTGG + Intergenic
1046666711 8:117011385-117011407 TCAAGGAACTTCGCAATAAGAGG - Intronic
1047145833 8:122198318-122198340 TCAAGAAACTTAGAAACAAAGGG + Intergenic
1047753895 8:127903697-127903719 TCAACAAACTTGACAAAAAGAGG - Intergenic
1047797765 8:128275277-128275299 TGAAGAAATTTTGAAAAAAGAGG + Intergenic
1048511854 8:135070167-135070189 TCCAGCAACCAGGAAAAATGAGG - Intergenic
1050328544 9:4521860-4521882 TCAATCAACATGCAAACAAGTGG - Intronic
1052054489 9:23888212-23888234 TCAACCAACAAAGAAAAAAGAGG - Intergenic
1052161707 9:25269587-25269609 CCAAGCAAATTGGAGAAGAGGGG + Intergenic
1052413051 9:28147331-28147353 TCAGGCAAATTTGTAAAAAGTGG + Intronic
1052560250 9:30076180-30076202 TCAAACAAGTTGGAAAAAACTGG + Intergenic
1053417764 9:37957476-37957498 TCAACCACTTTGGAAAACAGTGG + Intronic
1053631733 9:39947389-39947411 TAAAACAACATTGAAAAAAGAGG - Intergenic
1053774028 9:41516140-41516162 TAAAACAACATTGAAAAAAGAGG + Intergenic
1054212154 9:62303309-62303331 TAAAACAACATTGAAAAAAGAGG + Intergenic
1054312830 9:63545525-63545547 TAAAACAACATTGAAAAAAGAGG - Intergenic
1054453791 9:65419176-65419198 TCAAGCAACTTTTACAGAAGAGG - Intergenic
1056020558 9:82433763-82433785 TCAGGCAAATTTGTAAAAAGTGG - Intergenic
1057071339 9:92103552-92103574 TCAGGCAAATTTGTAAAAAGCGG + Intronic
1059404045 9:114089103-114089125 TCATGCCACTGGGAAAAAGGGGG + Intronic
1059478108 9:114565405-114565427 CCCAGCAACTTGGAAGAATGAGG + Intergenic
1061722002 9:132557599-132557621 GCCAGCCACTTGGAAAAAATCGG - Intronic
1185940425 X:4312666-4312688 TCAAGGAAGTTGGAAAATTGGGG - Intergenic
1186086862 X:6000195-6000217 TCAGGAAAGCTGGAAAAAAGAGG - Intronic
1186316323 X:8374371-8374393 GCAAGCAACTTCAAAAAAATGGG + Intergenic
1186887158 X:13925440-13925462 TCCAGCTACTTGGGAAACAGAGG - Intronic
1187996177 X:24929367-24929389 TCAACCAACTTGGCACACAGTGG + Intronic
1188154818 X:26728279-26728301 TCAAGCCACTTGGAATAAAATGG + Intergenic
1188406959 X:29823323-29823345 TGAAGCATCTTGGAAAAACGAGG - Intronic
1190256066 X:48763140-48763162 TCAAGAAACTGGGAAAAGAATGG + Intronic
1190810011 X:53874114-53874136 TCAACAAACATGAAAAAAAGAGG + Intergenic
1191088921 X:56599159-56599181 CTAACCAACTTGGGAAAAAGGGG + Intergenic
1193938201 X:87648573-87648595 AAAAGCAACTTGGAAGAAATTGG + Intronic
1194564436 X:95466964-95466986 TCAAACGACTTGGAAGAGAGGGG - Intergenic
1194811956 X:98398299-98398321 TCTAGCAAATATGAAAAAAGAGG - Intergenic
1195837962 X:109140795-109140817 TCAAAAAACTTGGAAAAAAAGGG + Intergenic
1196236206 X:113283693-113283715 TCAGGCAACTTGATAAAAGGTGG - Intergenic
1196557697 X:117109216-117109238 TCAAGAGACCTGAAAAAAAGAGG + Intergenic
1196925324 X:120628653-120628675 TCATACAAATGGGAAAAAAGTGG + Intronic
1197849429 X:130841926-130841948 TAAATCAAATTGGAAAAGAGGGG - Intronic
1198326824 X:135582695-135582717 TCAAGAAACTTGGAAAACACTGG + Intergenic
1198804233 X:140477694-140477716 TCAACAAACTAGGAAAAAAATGG + Intergenic
1199388751 X:147255035-147255057 TCAGGCAACTTTGTAAAAATAGG + Intergenic
1199522783 X:148755321-148755343 TAAGGCAAATTGGAAAAAAAAGG - Intronic
1199995153 X:153019522-153019544 TGAAGAAATTTGGAACAAAGAGG - Intergenic
1201478988 Y:14416902-14416924 TATAGAAACTTGTAAAAAAGGGG + Intergenic
1201509284 Y:14740138-14740160 TCAAGAAAGCTGGAGAAAAGAGG + Intronic
1202256123 Y:22922081-22922103 CCAAGCAAATAGAAAAAAAGGGG + Intergenic
1202409114 Y:24555834-24555856 CCAAGCAAATAGAAAAAAAGGGG + Intergenic
1202461669 Y:25114244-25114266 CCAAGCAAATAGAAAAAAAGGGG - Intergenic
1202594008 Y:26517519-26517541 TCAATCTAGTTGGATAAAAGAGG + Intergenic