ID: 1135759440

View in Genome Browser
Species Human (GRCh38)
Location 16:25125499-25125521
Sequence TTGGAGAGGGATAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 950
Summary {0: 1, 1: 1, 2: 7, 3: 97, 4: 844}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135759440_1135759450 14 Left 1135759440 16:25125499-25125521 CCCTCTTCCCTATCCCTCTCCAA 0: 1
1: 1
2: 7
3: 97
4: 844
Right 1135759450 16:25125536-25125558 AAATAATAGTTTTGTTGGGTCGG 0: 1
1: 0
2: 2
3: 48
4: 719
1135759440_1135759451 15 Left 1135759440 16:25125499-25125521 CCCTCTTCCCTATCCCTCTCCAA 0: 1
1: 1
2: 7
3: 97
4: 844
Right 1135759451 16:25125537-25125559 AATAATAGTTTTGTTGGGTCGGG 0: 1
1: 0
2: 1
3: 21
4: 272
1135759440_1135759452 20 Left 1135759440 16:25125499-25125521 CCCTCTTCCCTATCCCTCTCCAA 0: 1
1: 1
2: 7
3: 97
4: 844
Right 1135759452 16:25125542-25125564 TAGTTTTGTTGGGTCGGGCGCGG 0: 1
1: 0
2: 1
3: 21
4: 209
1135759440_1135759449 10 Left 1135759440 16:25125499-25125521 CCCTCTTCCCTATCCCTCTCCAA 0: 1
1: 1
2: 7
3: 97
4: 844
Right 1135759449 16:25125532-25125554 GATTAAATAATAGTTTTGTTGGG 0: 1
1: 0
2: 7
3: 198
4: 507
1135759440_1135759448 9 Left 1135759440 16:25125499-25125521 CCCTCTTCCCTATCCCTCTCCAA 0: 1
1: 1
2: 7
3: 97
4: 844
Right 1135759448 16:25125531-25125553 AGATTAAATAATAGTTTTGTTGG 0: 1
1: 0
2: 5
3: 49
4: 568
1135759440_1135759453 23 Left 1135759440 16:25125499-25125521 CCCTCTTCCCTATCCCTCTCCAA 0: 1
1: 1
2: 7
3: 97
4: 844
Right 1135759453 16:25125545-25125567 TTTTGTTGGGTCGGGCGCGGTGG 0: 1
1: 2
2: 24
3: 288
4: 2248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135759440 Original CRISPR TTGGAGAGGGATAGGGAAGA GGG (reversed) Intronic
900237003 1:1597755-1597777 TTGGCGGGGGAAGGGGAAGACGG - Intergenic
900681674 1:3920129-3920151 ATGGAGGGAGAGAGGGAAGAAGG - Intergenic
901099417 1:6707919-6707941 TGGGAGAGTGATAGGAAAGGAGG + Intergenic
901117871 1:6863312-6863334 TTGGGGAGGGAATGGGGAGATGG - Intronic
901177236 1:7313274-7313296 TGGGAGAGGGAAAGAGGAGATGG - Intronic
901769186 1:11521807-11521829 GTGGACTGGGATAGGGCAGATGG + Intronic
902180160 1:14682049-14682071 CTGGAGATGGATAGTGATGATGG - Intronic
902259850 1:15216501-15216523 TTGGAGAGTTGTAGGGAAGATGG + Intronic
902389713 1:16095970-16095992 TTGGAGGGGAAGAGGGAAAAGGG + Intergenic
902549177 1:17209010-17209032 TTGGAGGGGCATAGGGAGAAGGG + Intronic
902554497 1:17238973-17238995 GTGAACAGGGATAAGGAAGAGGG - Intronic
902763485 1:18599501-18599523 GTGGCCAGGGAGAGGGAAGAGGG + Intergenic
903011056 1:20330725-20330747 AGGGAGAGGGAGAAGGAAGAGGG - Intronic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903882995 1:26524746-26524768 TTTGAGAGGGAGAAGAAAGAGGG + Intergenic
903947067 1:26970682-26970704 ATGCAGAGGGTGAGGGAAGAGGG + Intergenic
904301503 1:29557471-29557493 TGGGAGGGAGAGAGGGAAGAAGG + Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
904824495 1:33265612-33265634 TTGGAGTGGCAGAGGGCAGAGGG + Intronic
904994321 1:34619123-34619145 GAGGAGAGGGAAAGGGAGGATGG + Intergenic
905391836 1:37640900-37640922 TTGCAGAGGGATAGAGAAGGAGG - Intergenic
905585664 1:39115629-39115651 TAGGAGAGTGATAGGTGAGAGGG + Intronic
906720703 1:48002124-48002146 TTGGACAGGGAATAGGAAGAAGG + Intergenic
907364466 1:53946828-53946850 TTGGGGAGAGAGCGGGAAGAAGG + Intronic
907424846 1:54373146-54373168 CTGGAGGGGAAGAGGGAAGAAGG - Intronic
908832317 1:68191557-68191579 TTGTAACGGGTTAGGGAAGAGGG - Intronic
908890274 1:68838921-68838943 TTGGAGAAGCACAGAGAAGAGGG + Intergenic
910302819 1:85726673-85726695 TTGGAGATAGATAATGAAGATGG - Intergenic
910726433 1:90344754-90344776 ATGGAGAGTGAGAGAGAAGAAGG - Intergenic
910852200 1:91659527-91659549 TGGGAAATGGATAAGGAAGAAGG - Intergenic
911236736 1:95420201-95420223 TTGGAGTGGGGTAGTAAAGATGG + Intergenic
911679899 1:100703143-100703165 GAGGAGAGGGAAGGGGAAGAAGG + Intergenic
911967549 1:104386817-104386839 TTGGAGAGGAAGAGTGAAGGAGG - Intergenic
911991347 1:104701390-104701412 TCTTAGAGGGATAGGGAAGTGGG - Intergenic
912132124 1:106616473-106616495 TTGAGGAGGGATAGAGAAGTGGG + Intergenic
912776853 1:112510804-112510826 TTAGAAAGGGAAAGGGGAGAAGG + Intronic
912938348 1:114023393-114023415 CTGGAAAGGAAAAGGGAAGATGG - Intergenic
912977901 1:114346394-114346416 CTGGAGAGGAATCTGGAAGAAGG - Intergenic
913142523 1:115955554-115955576 GTATAGAGGGAGAGGGAAGAGGG + Intergenic
913263225 1:117020020-117020042 TTTGAGAGTGAGAGGGAACATGG - Intronic
913425903 1:118729291-118729313 TTGGCAAGGGTTGGGGAAGAAGG + Intergenic
913449429 1:118983218-118983240 TTGGACTGTGATAGGGAGGAAGG - Intronic
913531793 1:119738799-119738821 TTGCAGAGAGATGGGGAGGAGGG + Intronic
913532066 1:119740533-119740555 TTGCAGAGGGAGGGGGAGGAGGG + Intronic
913599308 1:120407531-120407553 TTGGAGGGGGACAAGGAAGTTGG - Intergenic
913667118 1:121058577-121058599 TTAGAAAGGAAAAGGGAAGATGG + Intergenic
913964258 1:143362151-143362173 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
914018810 1:143845729-143845751 TTAGAAAGGAAAAGGGAAGATGG + Intergenic
914088071 1:144472086-144472108 TTGGAGGGGGACAAGGAAGTTGG + Intergenic
914591566 1:149111021-149111043 TTGGAGGGGGACAAGGAAGTTGG + Intergenic
914657362 1:149753932-149753954 TTAGAAAGGAAAAGGGAAGATGG + Intergenic
915502174 1:156327274-156327296 GTGGAGAGGGAGAGGGGAGAGGG - Intronic
915589355 1:156861758-156861780 TTGGAGAGGGAGATGGGAGTGGG - Intronic
915871314 1:159562552-159562574 ATGGAGTGGGATGGGGCAGAGGG - Intergenic
915974604 1:160376730-160376752 CTAGCTAGGGATAGGGAAGAGGG - Intergenic
916242920 1:162657820-162657842 GTGGGGAGGGGAAGGGAAGAAGG - Intronic
916384034 1:164247141-164247163 TTGGAGTGGTATACGGAAGGTGG + Intergenic
917002759 1:170377996-170378018 TTGGAGATGGATAGTGATGATGG - Intergenic
917053699 1:170954946-170954968 TGGGAGGGGGATAGGGATAAAGG - Intronic
917509786 1:175660664-175660686 TTGGAGAGGGAGTGAGAAGTTGG + Intronic
917811791 1:178665766-178665788 CTGGAGATGGATAGTGATGATGG + Intergenic
918087586 1:181258648-181258670 TAGGAGAGGGGTAGGGAATCAGG + Intergenic
918441810 1:184575452-184575474 TTGCAGAGGGGTATGGAAGAGGG + Intronic
919802495 1:201362067-201362089 TTGGGGAGGGTTAGGGGACAGGG - Intronic
920074268 1:203325419-203325441 TGGGAAAGGGACAGGGATGAGGG - Intergenic
920952997 1:210590430-210590452 TGGTAGGGGGATAGGGATGACGG + Intronic
921168537 1:212525413-212525435 TAGAAGAAGGCTAGGGAAGAAGG + Intergenic
921558345 1:216626528-216626550 TTGGGGAGTGAAAGGGGAGAAGG - Intronic
921705088 1:218313388-218313410 ATGTAGAGGGATATGGGAGAGGG + Intronic
921814683 1:219550171-219550193 CTGGAGGGGGATAGGGGAGCTGG - Intergenic
922081976 1:222306197-222306219 TTGAAGGGGGAAAGGGAAAAGGG + Intergenic
922593322 1:226795416-226795438 CTGGAGAGGGAGAGGCAGGAAGG - Intergenic
922662628 1:227443535-227443557 AGGGAGAGGGAGAGGGAAGATGG - Intergenic
922730586 1:227947064-227947086 TCAGAGAGGGGGAGGGAAGAAGG + Intronic
922751446 1:228071936-228071958 GTGTAGAGGGATAGTGTAGAAGG + Intergenic
922849145 1:228717521-228717543 CTGGAGAGGGATAGGTAGGATGG + Intergenic
923254058 1:232204555-232204577 TGGGATAGGGATATGGATGATGG + Intergenic
923409932 1:233697343-233697365 CTGGAGATGGATAGAGATGATGG + Intergenic
923723523 1:236487135-236487157 TGGGAGAGGGAAAGGGGAGGAGG + Intergenic
924355997 1:243176550-243176572 TTGGAGTGGGATAGGGAGGGAGG - Intronic
924925469 1:248676275-248676297 AGGGAGAGGGAGAGGGGAGAGGG - Intergenic
1063023683 10:2156222-2156244 TTGGAGAGATATAGGAAAGAAGG + Intergenic
1063606795 10:7529647-7529669 GAGGAGAGGGAAAGGGAGGAGGG + Intergenic
1063640488 10:7825415-7825437 CTGGAGAAGGATGGGGATGATGG - Intronic
1063728272 10:8664921-8664943 TTGGAGAGGGAGAGGGAAAGAGG + Intergenic
1064038421 10:11935904-11935926 ATGGAGAGGGATATGGAGAAGGG + Intronic
1064953186 10:20877629-20877651 TTGGAAAGGAAAAGGGAAGATGG - Intronic
1065113701 10:22464176-22464198 ATGGAGAGAGAAAGGGAGGAAGG + Intergenic
1065186772 10:23175922-23175944 TTGGCCAAGGATAAGGAAGATGG + Intergenic
1065219252 10:23479399-23479421 GAGGAAAGGGAGAGGGAAGAGGG - Intergenic
1065488363 10:26255904-26255926 CTGGGGAGGGATGGGGAGGAAGG + Intronic
1066045277 10:31589273-31589295 TGGGAGAGGGAGAGGCAGGAAGG - Intergenic
1066336231 10:34481233-34481255 AGGGAGAGGGAAAGGGAGGAGGG - Intronic
1067339593 10:45391045-45391067 AGGGAGAGGGAGAGGGGAGAGGG - Intronic
1067368469 10:45659278-45659300 GTGGTGAGGTATTGGGAAGAGGG - Intronic
1067759512 10:49033542-49033564 TTGGACAGTGATAGAGAAGTAGG - Intronic
1068223444 10:54074268-54074290 TTAGAGATGGATAGTGATGATGG - Intronic
1068304036 10:55180149-55180171 TTGGAGAGGGATTTGGCAGATGG + Intronic
1068564999 10:58564915-58564937 TTAAAGAGGAATAGGAAAGAAGG + Intronic
1068667812 10:59696079-59696101 ACGGAGAGGGAGAGGGGAGAGGG - Intronic
1068797796 10:61103117-61103139 GTAAAGAGGGATGGGGAAGATGG + Intergenic
1068962016 10:62876679-62876701 TCACAGAGGGAAAGGGAAGATGG + Intronic
1069024940 10:63529358-63529380 CTGGAGATAGATAGGGAAGTAGG + Intronic
1069177605 10:65312871-65312893 TGGCAGGGGGATAGGGAAGGGGG - Intergenic
1069547434 10:69338785-69338807 GTGTAGAGAGAGAGGGAAGAGGG + Intronic
1069769893 10:70891537-70891559 GTGGAGAGGGATTGAGAAGGTGG + Intergenic
1069965572 10:72112474-72112496 CTGGAGATGGATAGTGATGATGG + Intronic
1070201712 10:74212972-74212994 TAGGAGGAGGATATGGAAGAGGG + Intronic
1070325300 10:75384886-75384908 TTGGAGAGGCAGAGGGATGAAGG - Intergenic
1070391099 10:75971211-75971233 ATGGGGAGAGAAAGGGAAGAAGG - Intronic
1070586049 10:77767115-77767137 TTGGAGAGGGATACAGTGGATGG - Intergenic
1070605876 10:77898304-77898326 TTGGAGAAGGAGAGAGAAAAAGG + Intronic
1070813069 10:79307874-79307896 TGGGAGAGGGAGAGGGCTGATGG - Intronic
1070979077 10:80630096-80630118 GTGGAGGGAGAGAGGGAAGAAGG + Intronic
1071149350 10:82615795-82615817 TTGGAGAGGGAGATGGGAAAGGG + Intronic
1071197171 10:83175220-83175242 TTTGAAAAGGGTAGGGAAGAGGG - Intergenic
1071213333 10:83369750-83369772 TTAGAGAGGGAGAAGGGAGATGG - Intergenic
1071213355 10:83369974-83369996 TTAGAGAGGGAGAAGGGAGATGG - Intergenic
1071726983 10:88208760-88208782 TTGGAGAGTGAAAGTGAAAAAGG + Intergenic
1071892011 10:90019592-90019614 TTGCAGGCGGAAAGGGAAGAGGG + Intergenic
1072167585 10:92829116-92829138 TTGGAAAGGAAAAGGGAAGATGG - Intergenic
1072199043 10:93142560-93142582 ATGGAGAGGGAAAGGAAAAAAGG - Intergenic
1072613509 10:97034774-97034796 TTGCAGAGGGATGGGGGTGAGGG - Intronic
1072622649 10:97090228-97090250 ATGGAGAGGGAGTGGGAAGCAGG + Intronic
1072851902 10:98904708-98904730 TTGGAGAGGCATAGGAAATATGG - Intronic
1073081847 10:100865450-100865472 TTGGAGGGGTATAGGGACGGGGG - Intergenic
1073275023 10:102302258-102302280 AGGGAGAGGGAAAGGGGAGAGGG + Intronic
1073297367 10:102449428-102449450 TTGGAGGGAGATGGTGAAGAGGG + Intergenic
1073470706 10:103720494-103720516 TGGAAGATGGAAAGGGAAGACGG + Intronic
1074537911 10:114341887-114341909 TTTGAGAGGCATAAGGCAGAAGG + Intronic
1075291937 10:121238325-121238347 GTGGAGAAAGATAGGAAAGAAGG - Intergenic
1075386717 10:122060433-122060455 TTGGAGAGGGAAAGGCAATGAGG - Intronic
1075470268 10:122683635-122683657 TTGCAGAGGGAGAGGGGAGGAGG - Intergenic
1075650606 10:124126353-124126375 GTGGAGAGGGGAGGGGAAGAGGG - Intergenic
1075861705 10:125682926-125682948 TGGGAGATGGGTAAGGAAGATGG - Exonic
1075912026 10:126132989-126133011 GTGGAAAGGGTTAGGGAAAAGGG - Intronic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076752794 10:132552096-132552118 TTGGAGTGGGATAGGGAGGGAGG + Intronic
1076811322 10:132888076-132888098 TGAGAGAGGGAGAGGGGAGAGGG - Intronic
1077163248 11:1123096-1123118 AGGGAGAGAGAGAGGGAAGAGGG - Intergenic
1077532877 11:3105523-3105545 GTGGAGAGGGTTAAGGAGGACGG - Intronic
1077626331 11:3775083-3775105 TTTGAGAGGGATTGGGTGGAGGG - Intronic
1077747119 11:4919221-4919243 TTGGAGAGAGAAATGGTAGAAGG - Intronic
1078143014 11:8705246-8705268 GTGGAGAGAAATAGGGAAGAGGG - Intronic
1078415971 11:11165165-11165187 CTGCAGAGAGATGGGGAAGAGGG - Intergenic
1078582904 11:12552746-12552768 TTGAAGAGGGACAGGAAAGAAGG + Intergenic
1078586798 11:12598839-12598861 AGGGAGAGGGATAGGAAGGAAGG + Intergenic
1078775263 11:14388147-14388169 TTAGAGAGTAATATGGAAGATGG + Intergenic
1079199758 11:18366029-18366051 TTGGAGACTGAAAGGAAAGAAGG + Exonic
1079444343 11:20545869-20545891 GTGGAGAGGGATAGGGAATGGGG - Intergenic
1079609909 11:22419468-22419490 TTGGAGAGGGAATGGTAAAAAGG - Intergenic
1079995602 11:27292182-27292204 CGGAAGAGGGATAGGAAAGAAGG + Intergenic
1080688007 11:34531611-34531633 CTAGAGAGGGATGGGGATGATGG + Intergenic
1081668455 11:44930137-44930159 TTGGGGAAGGACAGGGAAGGGGG - Exonic
1081794067 11:45807797-45807819 CTGGAGAGGGAAATGGAAGCAGG - Intronic
1081805942 11:45890625-45890647 TTGGTGAGGGATACAGAATAGGG + Intronic
1082800818 11:57413724-57413746 CTGGAGAGAGAGAGGTAAGAAGG - Intronic
1083128584 11:60599227-60599249 TTGAGGAGGGATAAGCAAGAGGG - Intergenic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1083160369 11:60850567-60850589 TTGGAGAAGGAGAGGAAGGAGGG - Exonic
1084470171 11:69354855-69354877 CTGTAGAGGGATAGAGTAGAAGG + Intronic
1085056299 11:73406078-73406100 GTGGGGAAGGAGAGGGAAGAAGG - Exonic
1085123392 11:73981708-73981730 TTGGAGGGGGATGGGGAACAGGG + Intronic
1085139882 11:74130134-74130156 AGGGAGAGGGAGAGGGGAGAGGG + Intronic
1085235098 11:75008483-75008505 GTGGATAGGAATAGGGAGGATGG + Exonic
1085468188 11:76738283-76738305 CTGAACAGGGATAGGGAAGTGGG + Intergenic
1086052758 11:82613459-82613481 TTGGCAAGGAAAAGGGAAGATGG - Intergenic
1086122787 11:83317811-83317833 GGGGAGAGGGAGAGGGAAGAGGG + Intergenic
1086520244 11:87661009-87661031 CTGGAGTGGGAAAGGGAAGGGGG - Intergenic
1087099346 11:94349657-94349679 AGGGCGAGGAATAGGGAAGAAGG - Intergenic
1087232841 11:95685309-95685331 TTGGGGAGGGGCAGGGCAGAGGG + Intergenic
1087300192 11:96424132-96424154 GTGGGGAGGAATATGGAAGAGGG - Intronic
1087322198 11:96676754-96676776 TTGGAAAGGAAAAGGGAAGATGG + Intergenic
1088848560 11:113687706-113687728 GTGGAGAGGGAGAGTGGAGAGGG + Exonic
1089053741 11:115567411-115567433 GTGCAGTGGGATAGGGAAGGCGG + Intergenic
1089138697 11:116269737-116269759 TTGGAGAGGCAGAGGGGAGGAGG - Intergenic
1089152087 11:116372094-116372116 TTGGACAAGTATGGGGAAGAGGG - Intergenic
1089641851 11:119853033-119853055 TTGGACAGGGAGAGTGGAGAGGG - Intergenic
1090159309 11:124475610-124475632 TTGGACAGGGAGAGGGGAAAAGG - Intergenic
1091044065 11:132310242-132310264 TAGGGGTGGGATAGGAAAGAAGG - Intronic
1091095955 11:132822244-132822266 TGGGAGAGGGAGAGTGAGGAGGG - Intronic
1091135642 11:133186537-133186559 ATGGAGAGGGGTAAGGGAGAAGG + Intronic
1091215591 11:133899494-133899516 TTGGGGAGGGAAAGGGAAGATGG - Intergenic
1091406852 12:214466-214488 CTGGAGGGGGATAGGGGAAAAGG - Intronic
1091446203 12:545602-545624 TTGTAGAGGGGTAGGGGTGAGGG - Intronic
1091821126 12:3475788-3475810 TTGGGGAGGGAGGGGGAAGGCGG + Intronic
1092038708 12:5364152-5364174 TTGCAGAGGGATGGGCCAGAGGG - Intergenic
1092191831 12:6526865-6526887 GAGGAGAGGGAGAGGGAAGGTGG - Intronic
1092495961 12:8995463-8995485 GTGGGGAGGGAGAGGGAAGAAGG - Intronic
1093235370 12:16603958-16603980 TGGGAGAGGGAAGAGGAAGAGGG + Intronic
1093833970 12:23802943-23802965 TTGGAGAATGTTGGGGAAGAGGG - Intronic
1094248198 12:28327363-28327385 TTTGGAAGGGACAGGGAAGATGG - Intronic
1094334385 12:29332022-29332044 TGGGGGAGGAGTAGGGAAGAAGG - Intronic
1095199666 12:39368606-39368628 TTGGAGGGTGAAAGGGAAGATGG + Intronic
1095790934 12:46166228-46166250 TTGGAGAGTATTATGGAAGAGGG + Intergenic
1096139448 12:49230635-49230657 TTTGAGAGGGAGAGGGAAAAGGG - Intronic
1096189976 12:49610120-49610142 GGGGAGAGGGAAAGGGAAGGTGG + Intronic
1096556832 12:52409023-52409045 AGGGAGAGGGAGAGGGAGGAGGG - Intergenic
1096573699 12:52539848-52539870 CTGGAGAGGGAGAGAGGAGATGG - Intergenic
1096709918 12:53447881-53447903 TTGAGGAGGAACAGGGAAGAAGG + Intergenic
1096792628 12:54054397-54054419 GTGGGGAGCGCTAGGGAAGAAGG - Intronic
1096896233 12:54822958-54822980 TTGGCAAGGAAAAGGGAAGATGG - Intergenic
1097008543 12:55936249-55936271 AGGTAGAGGCATAGGGAAGAGGG + Intronic
1097206190 12:57323267-57323289 TTGGAGAAGGACAGGAAGGAAGG + Intronic
1097377572 12:58858276-58858298 GAGGAGAGAGAGAGGGAAGAGGG - Intergenic
1097712452 12:62932054-62932076 TAGGTGAGGGCTGGGGAAGAGGG + Intronic
1097979660 12:65724899-65724921 TGGGAGAGAGAGAGTGAAGAGGG - Intergenic
1098027067 12:66214921-66214943 TTGGATAGGAGTGGGGAAGAAGG + Intronic
1098179662 12:67832711-67832733 TTGGAGAGGGACAGGAAGGGAGG - Intergenic
1099099967 12:78427024-78427046 TTGAAGGGGGATAAGGCAGAGGG - Intergenic
1099324020 12:81189061-81189083 TTGGAGGGGGAGAGGGTAGTTGG - Intronic
1099776062 12:87132792-87132814 TTGGAAAGGCAAACGGAAGATGG + Intergenic
1100366738 12:93928459-93928481 TTTGGGAGGGATAGGGAACCAGG - Intergenic
1102013355 12:109632379-109632401 TTGGAAAGTGACACGGAAGAGGG - Intergenic
1102073940 12:110045014-110045036 TTGGTGAGTGAGGGGGAAGAAGG + Intronic
1102111084 12:110366260-110366282 ATGGAGACTGATAGGGAAGATGG + Intergenic
1102198083 12:111038537-111038559 TTGGAGAGGCAGAGGGAATGGGG - Intronic
1102547334 12:113666263-113666285 ATGGGGAGGGAGAGGGAAGCCGG + Intergenic
1102598741 12:114012875-114012897 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1103105385 12:118219939-118219961 TTGGAGAGAGGGAGGAAAGAAGG - Intronic
1103244699 12:119446599-119446621 AGGGAGAGGGAGAGGGAGGACGG + Intronic
1105527264 13:21187423-21187445 AGGGAGAGGGAGAGGGGAGAGGG + Intergenic
1105892723 13:24693355-24693377 ATGGAGAGGAAAAGGGAGGAAGG - Intronic
1106111040 13:26777140-26777162 GTGAAGAGGGAAGGGGAAGAGGG + Intergenic
1106595553 13:31132416-31132438 CGGGAGAGGTATAGGGAAGTTGG + Intergenic
1107098253 13:36559985-36560007 TTGGAGAAGGGGAGGTAAGAGGG + Intergenic
1107562514 13:41571306-41571328 CGGGAGAGGGAGAGGGAGGAGGG - Intronic
1107584556 13:41830855-41830877 TTTGATAGGGATATGAAAGAGGG + Intronic
1107872431 13:44759689-44759711 TGGAAGAGGGATAGGGAGGAAGG + Intergenic
1107950455 13:45456838-45456860 TTGGAGGTGGAGAGAGAAGATGG + Intergenic
1108318130 13:49258276-49258298 TTGGAAGGGGATGGGGAATAGGG + Intronic
1108373427 13:49792567-49792589 TTGGAGCGGGAGGGGGAGGAGGG + Exonic
1108376671 13:49820453-49820475 TTGTAGATGGAAAGTGAAGAAGG + Intergenic
1108670012 13:52676671-52676693 TAAGAAAGGGAGAGGGAAGAAGG - Intronic
1108728363 13:53205312-53205334 ATGGAGAGTGACAGGGAGGAGGG - Intergenic
1108909259 13:55522518-55522540 TAGGAGAGGGAGACAGAAGAGGG + Intergenic
1108962449 13:56251679-56251701 TTGGGGATGGGTAGGGAGGATGG - Intergenic
1109665140 13:65524796-65524818 TGGAAGAGGGAGAAGGAAGAGGG - Intergenic
1109714532 13:66204352-66204374 TTGGAGATGAATAAGGAAGTTGG - Intergenic
1109979866 13:69893928-69893950 TTGGAGAGTGATGTGTAAGATGG - Intronic
1110126331 13:71947519-71947541 CTGGAAAGGGATAAGTAAGATGG + Intergenic
1110164491 13:72423058-72423080 TTGGAGTAGGAAAGAGAAGATGG - Intergenic
1110647105 13:77900352-77900374 GTTGAGAGGGACAGGGAAGGGGG - Intronic
1111910855 13:94310643-94310665 TTGGAAAGGGATAGTGGAGGAGG - Intronic
1112505697 13:99974244-99974266 TTGGGTAGCGATAGGAAAGAGGG + Intergenic
1112741131 13:102473699-102473721 TTGGAGATGGATAGTGGTGAGGG + Intergenic
1112772765 13:102809741-102809763 TTGGAGATGAATAGTGATGATGG - Intronic
1112949268 13:104970878-104970900 TTGCAGAGGGAGAGGAAATATGG + Intergenic
1113274336 13:108711691-108711713 TTGGAGTGCCATAGGAAAGAAGG + Intronic
1113294595 13:108944349-108944371 TTGAAGAGGAAAAGGGAAAAAGG + Intronic
1113516805 13:110909350-110909372 GGGGACAGGGGTAGGGAAGAAGG + Intronic
1113698654 13:112366522-112366544 TTAGAGAGGTGGAGGGAAGAAGG + Intergenic
1115539962 14:34411279-34411301 ACGGAGAGGGAGAGGGGAGAGGG - Intronic
1115742146 14:36399630-36399652 TGGTAGAAGGAGAGGGAAGAAGG - Intergenic
1116192223 14:41675605-41675627 AGGGAGAGGGAGAGGGGAGAGGG + Intronic
1117450061 14:55841407-55841429 TAAGAGAGGGAGAGGGAAGAGGG - Intergenic
1117494220 14:56285715-56285737 TTGGAGTGGGTTGAGGAAGAAGG + Intronic
1117803488 14:59467301-59467323 TTGGAGATGGGGAGTGAAGAAGG + Intronic
1118075278 14:62291472-62291494 TTGGAGGGGGAAAGGGAAGAAGG - Intergenic
1118729845 14:68658563-68658585 TTGTAGAGGGATTGTGAAGTAGG - Intronic
1119117920 14:72044491-72044513 AAGGAGAGGGAGAGGGAGGAAGG - Intronic
1119185651 14:72640366-72640388 TTGGAGATGGCTGGGGAAGGGGG + Intronic
1120086327 14:80278312-80278334 TTGGATATAGATGGGGAAGAGGG + Intronic
1120237622 14:81910870-81910892 TGGGGCAGGGGTAGGGAAGATGG - Intergenic
1121102785 14:91261515-91261537 TTGGATAAGGACAGGGAGGAGGG + Intergenic
1121242973 14:92443081-92443103 TTGCAGAGGGAGATGGAAGTGGG + Intronic
1121676784 14:95760039-95760061 TTGCAGAGGGATGGGGAGGAAGG - Intergenic
1121876689 14:97459208-97459230 TTAGAGAGAGAGAGAGAAGAGGG + Intergenic
1122017492 14:98808544-98808566 AGGGAGAGAGACAGGGAAGAAGG - Intergenic
1122234445 14:100323811-100323833 GGGGAGATGGGTAGGGAAGATGG + Intronic
1122363887 14:101183159-101183181 TGGAAGAGGGGAAGGGAAGAAGG - Intergenic
1122538032 14:102479855-102479877 TTGGAGAGGCATTGGGCAGATGG + Intronic
1122924010 14:104891571-104891593 TTGGGGGAGCATAGGGAAGAAGG + Intronic
1123427834 15:20187353-20187375 GTAGAGAGGGAGAGGAAAGAGGG - Intergenic
1123742919 15:23297147-23297169 TTCGGGAGGCATAGGCAAGAGGG - Intergenic
1123887512 15:24741550-24741572 TTGGAGAGGGATAGCATACAGGG - Intergenic
1124030922 15:26011000-26011022 TTGGAGATAGATAGGGAAATTGG - Intergenic
1124145653 15:27123034-27123056 ATGGAAAGGGAGAGGGAAAAAGG - Intronic
1124410815 15:29435082-29435104 CTGGAGAGTGATAGGGAAGAGGG - Intronic
1125003891 15:34796813-34796835 GAGGAGAGGGAGAAGGAAGAGGG + Intergenic
1126136444 15:45396985-45397007 TTGGAAGAGGAAAGGGAAGAGGG - Intronic
1126216098 15:46156812-46156834 TTGGAAAGAAAAAGGGAAGATGG + Intergenic
1126405679 15:48320310-48320332 TTGGCGAGGAAGACGGAAGAAGG + Intergenic
1126703365 15:51386467-51386489 CAGGAAAGGGATAGGGAGGAGGG + Intronic
1127126781 15:55819713-55819735 TTGGAGAGGGAAGGGCAGGAAGG - Intergenic
1127697394 15:61463816-61463838 TTGGAGAGGACTAAGGGAGAAGG - Intergenic
1128154715 15:65385229-65385251 TTGGAGAGGGAGAGAGCAGCGGG - Intronic
1128796320 15:70469340-70469362 CTGGAGTGGGATAGGGAGGTAGG - Intergenic
1129242371 15:74259235-74259257 GTGGAGAGGCCTAGGGAAGCAGG + Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1131065612 15:89433393-89433415 TTGGAGGGAGGGAGGGAAGAAGG - Intergenic
1131826950 15:96330114-96330136 TTGCAGAGGGATAGGGAGTGAGG - Intronic
1132399408 15:101496361-101496383 TTGGAGAGGGACAGGGCAGGGGG - Intronic
1132612726 16:825293-825315 TCGGAGAGGGACAAGGAGGAAGG - Intergenic
1133228626 16:4355416-4355438 TTGGAGTGGGAGAGGGAACAGGG - Intronic
1133253495 16:4501160-4501182 TTGGAAAGAAAAAGGGAAGAGGG - Intronic
1133392753 16:5422766-5422788 ATGGAGAGGGAGAAGGGAGAGGG + Intergenic
1133485511 16:6215031-6215053 ATGGAGAGGGAGAGGGGAGAAGG + Intronic
1133546218 16:6810140-6810162 ATGGACAGGGATAGGGATTACGG + Intronic
1133978639 16:10617833-10617855 CTGGAGAGGGAGAGGGAGCAAGG + Intergenic
1134729604 16:16450089-16450111 TTGTGGTGGGATAGGGATGAGGG + Intergenic
1135073428 16:19372323-19372345 TTGGAGATAGCTAGGGATGATGG - Intergenic
1135165512 16:20135524-20135546 TTGCAGAAGGACAGGGTAGAAGG - Intergenic
1135549611 16:23388062-23388084 TGGGAGAGGGAGGGAGAAGAAGG - Intergenic
1135583184 16:23645482-23645504 TTGGAAATGGATAGTGGAGATGG - Intronic
1135661770 16:24303161-24303183 CTGGAGAGGGAAGGGGAAGATGG - Intronic
1135694706 16:24575793-24575815 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135694758 16:24575915-24575937 GAGGAGAGGGAGAGGGAGGAGGG + Intergenic
1135759440 16:25125499-25125521 TTGGAGAGGGATAGGGAAGAGGG - Intronic
1135822467 16:25696222-25696244 TTGGAAAGGGAGAGGGAAGAGGG - Intronic
1135834096 16:25807300-25807322 GTGGAGAGTGTTGGGGAAGAAGG - Intronic
1135910890 16:26559611-26559633 CTGAGGGGGGATAGGGAAGAGGG - Intergenic
1135927546 16:26708839-26708861 CTGCAGAGGGCTTGGGAAGAAGG + Intergenic
1135983567 16:27167370-27167392 CTGGAGAGGGATGGGAGAGAGGG + Intergenic
1136107463 16:28040342-28040364 ATGGAGAGTGATTGAGAAGAGGG - Intronic
1136856462 16:33662408-33662430 GTAGAGAGGGAGAGGAAAGAGGG + Intergenic
1137625513 16:49905541-49905563 ATGGAGAGGGATAAAGTAGAGGG - Intergenic
1138534355 16:57652120-57652142 TTGGAGTGGGGTAGGGGTGAGGG + Intronic
1138873302 16:60919207-60919229 TTGGAGAGGGATCAGGAAGCTGG + Intergenic
1138969702 16:62129960-62129982 TGGGAGAGACATAGGGAAAAGGG + Intergenic
1139219305 16:65163596-65163618 AAGGAGAGGGCTCGGGAAGAGGG - Intergenic
1139285402 16:65809024-65809046 TTGGACACGGATAGTGCAGAAGG + Intergenic
1139335314 16:66227083-66227105 TGGGAGAGGTAGAGGAAAGAAGG - Intergenic
1139372872 16:66479485-66479507 GTGGAGAGGGGTGGGGAAGGTGG + Intronic
1139494922 16:67309410-67309432 GGGGAGAGGGACAGGGATGAAGG + Intronic
1139754364 16:69131604-69131626 TTGGAGGGGGGTGGAGAAGAGGG - Intronic
1139811733 16:69624605-69624627 GTGGATAGGGATAAGGAGGAAGG - Intronic
1140306377 16:73806807-73806829 CTGGAGAGGGCTTGGGGAGATGG - Intergenic
1140444502 16:75014253-75014275 TTGGAGAGGGAAAGAGAAAATGG - Intronic
1140641952 16:76985235-76985257 GTGGAAAGGGGAAGGGAAGAGGG - Intergenic
1140721358 16:77775232-77775254 TTGGAGAGGGATAGGGGGATAGG + Intergenic
1140825708 16:78704019-78704041 TTGGAGATGGATAGGGGTGATGG - Intronic
1141230990 16:82167427-82167449 GTGGAGAGGGGAAGGGTAGATGG + Intronic
1141323060 16:83030125-83030147 GTGGGAAGGAATAGGGAAGATGG - Intronic
1141341413 16:83207168-83207190 CTGGAGATGGATGGGGATGATGG - Intronic
1142090872 16:88208521-88208543 TGGGAGAGAGAGAGGGAAGAAGG + Intergenic
1142343465 16:89538733-89538755 TTGGAGACGCATGTGGAAGACGG - Intronic
1142415749 16:89940625-89940647 TGGGAGAGGGTTAGGGATAAAGG - Intergenic
1203118042 16_KI270728v1_random:1510885-1510907 GTAGAGAGGGAGAGGAAAGAGGG + Intergenic
1142863767 17:2778269-2778291 TTGGAGAGGGATGGGGCTGGGGG + Intronic
1142896889 17:2985875-2985897 TAGGAAAGAGGTAGGGAAGATGG - Intronic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143115005 17:4577165-4577187 GTGGAGGGGGTGAGGGAAGAAGG + Intergenic
1143277380 17:5721922-5721944 AGGGAGAGGGAGAGGGGAGAGGG + Intergenic
1144018665 17:11221102-11221124 TTGGAGAGGGACAAGGGACAAGG - Intergenic
1144094380 17:11886696-11886718 GTGAAGAGGGATGGGGATGATGG - Intronic
1145271350 17:21406511-21406533 ATGATGAGGGATGGGGAAGAAGG + Intronic
1145309555 17:21693915-21693937 ATGATGAGGGATGGGGAAGAAGG + Intronic
1145886818 17:28387824-28387846 TTGGTGGGAAATAGGGAAGAAGG + Intronic
1146128062 17:30244728-30244750 TTGCAGAGGGAAAGGAAATAGGG - Intergenic
1146430034 17:32784342-32784364 TTGGAGAAGGAGAGGGAATCTGG - Intronic
1146679891 17:34799503-34799525 GTGGAGAGGGATGGGGTAGGTGG + Intergenic
1147167908 17:38603159-38603181 CTGGCGAGAGAGAGGGAAGAGGG + Intronic
1147229001 17:39003466-39003488 TTGGAGAGAGAAAAGGAAAATGG - Intergenic
1147316220 17:39621671-39621693 TTGGAGAGGTTGGGGGAAGAAGG + Intergenic
1147749416 17:42720216-42720238 AGTGACAGGGATAGGGAAGAAGG - Intronic
1148249594 17:46064625-46064647 TTGGAGAGGGAGGAGGAGGAGGG - Intronic
1148489546 17:48014268-48014290 TCAGAGAGGGGTTGGGAAGAAGG + Intergenic
1148530463 17:48385429-48385451 TTGGAGAGACATAATGAAGAAGG + Intronic
1148560967 17:48605844-48605866 TTGGATAGAAAGAGGGAAGAGGG - Intergenic
1148688847 17:49515220-49515242 TTGGAGAGGGAAAGTGAAAATGG + Intergenic
1149253507 17:54797297-54797319 GAGGAGAGGGATACAGAAGATGG + Intergenic
1149658119 17:58320720-58320742 GGGAAGAGGGATAGGGAAGGGGG + Intronic
1150000694 17:61437134-61437156 AAGGAGAGGGAGAGGGAGGAAGG - Intergenic
1150140437 17:62724056-62724078 AAGGAGAAGGATATGGAAGACGG + Intronic
1150458243 17:65325620-65325642 TTGGCCAGGGATAGGGTGGAGGG + Intergenic
1150849658 17:68692634-68692656 TTGGCCAGGGATTGGGTAGATGG + Intergenic
1150998314 17:70344894-70344916 TTGAAGAGGCAGAGGGAAGAGGG - Intergenic
1151080507 17:71324002-71324024 TTGGAAAGGAAAAGGGAAGATGG - Intergenic
1151181266 17:72330515-72330537 TTGGAGCAGGAAAGGGAAGGTGG - Intergenic
1151261672 17:72920586-72920608 TTGTAGAGGGGGTGGGAAGAGGG - Intronic
1151649946 17:75460897-75460919 CTGGAGATGGATAGTGATGAGGG - Intronic
1152053523 17:78001795-78001817 TTTGACAGGGATATGGAAGGGGG + Intergenic
1152333168 17:79685181-79685203 TTGGGGAGGGGCAGGGAAGGAGG - Intergenic
1153066172 18:1047554-1047576 TTGGTGAGGGATAGACTAGAGGG - Intergenic
1153305538 18:3627474-3627496 TGGGAGAAGGACAGGAAAGATGG - Intronic
1153524937 18:5985913-5985935 TTGGAGAGGGATGCTGTAGAGGG + Intronic
1153987778 18:10368551-10368573 GAGGAGAGGGAGAGGGAGGAAGG + Intergenic
1154134288 18:11762118-11762140 GTGGAGAGGGAGAGGCAACATGG + Intronic
1155142864 18:23058732-23058754 TTGTGGAGGGGTAGGGAAAAAGG - Intergenic
1155508757 18:26556240-26556262 TTGGAGAGGGGCAGAGAAGCAGG + Intronic
1156596890 18:38557799-38557821 TTTGAGAGCAATAGGGAATATGG - Intergenic
1156715644 18:40006718-40006740 TTAGAAAGGAAAAGGGAAGATGG - Intergenic
1157093319 18:44661884-44661906 TTTGAAAGTGATGGGGAAGATGG - Intergenic
1157313805 18:46572136-46572158 TTGGACAAGGATAAGGATGATGG - Intronic
1157560865 18:48645146-48645168 TCGGAGAGGTGGAGGGAAGAAGG + Intronic
1158690171 18:59653169-59653191 TTGGAGAGGGCTGGAGGAGAGGG - Intronic
1158697964 18:59719384-59719406 AATGAGAGGGATGGGGAAGAAGG - Intergenic
1158865630 18:61635573-61635595 CTGGAAAGAGAAAGGGAAGAAGG - Intergenic
1159107959 18:64025600-64025622 TTGGGAAGGGATAAGGAAGAGGG + Intergenic
1160409770 18:78667776-78667798 TGGGAGAGGGGTAGGGTGGATGG - Intergenic
1160967177 19:1751918-1751940 CTGGGGAGGGATAGGGCTGAAGG - Intergenic
1161274459 19:3407876-3407898 AGGGAGAGGGGCAGGGAAGACGG + Intronic
1161370571 19:3908744-3908766 GAGGAGAGGGAAGGGGAAGAGGG - Intronic
1161467019 19:4436726-4436748 GTGGAGAGGGGTGGGGAAGGAGG - Intronic
1161573842 19:5044750-5044772 CAGGAGAGGGATGGGGGAGAGGG - Intronic
1162475515 19:10897147-10897169 TTGGTGAGGAATAGGGATGCTGG + Intronic
1162843534 19:13373600-13373622 TTGGAGAAGGAGAGGGGAGGTGG - Intronic
1163677897 19:18664486-18664508 TGGGACAGGGACAGGGCAGATGG + Intronic
1164505171 19:28854294-28854316 TAGGAGTGAGAAAGGGAAGAGGG - Intergenic
1164790353 19:30972298-30972320 TTGGAGTGGGTGAGGGAGGAGGG - Intergenic
1164844996 19:31424535-31424557 CAGGAGAGGGGTGGGGAAGAAGG - Intergenic
1165007223 19:32817210-32817232 CTGGAGATGGATAGCGATGATGG - Intronic
1165255634 19:34576095-34576117 TTGGGGATGGATGGGGAAGGAGG + Intergenic
1165389589 19:35530632-35530654 GTGGAGAGGGATAGAGAAGATGG - Intergenic
1165394958 19:35558915-35558937 CTGAAGAGGGATAGGGAGGTAGG - Intronic
1166184215 19:41128838-41128860 AGGGAGAGGGAGAGGGAGGAGGG + Intergenic
1166337502 19:42117219-42117241 TTGGGGAAGGATGGGGACGAGGG - Intronic
1166673716 19:44726530-44726552 TTGGAGAGGTACAGGGAACCAGG - Intergenic
1166690957 19:44821017-44821039 CTGGGCAGGGAGAGGGAAGAGGG - Exonic
1166917479 19:46205359-46205381 TTGGAAAGGAAAAGGGAAGATGG - Intergenic
1166918726 19:46213771-46213793 TGGGAGAGGGAAGGGGAAGATGG - Intergenic
1166921161 19:46230082-46230104 TGGGAAAGGGAAAGGGAAGATGG - Intronic
1166924935 19:46260858-46260880 TGGGAGAGGGAAGGGGAAGAGGG + Intergenic
1167254174 19:48417405-48417427 TTTGAGATGGATTGGGTAGAGGG + Intronic
1167383167 19:49150021-49150043 CTGGAGAGGAACAGGGAGGAGGG + Intronic
1167406118 19:49309900-49309922 TGGGAGAGGGAAAGAGAAAAGGG - Intronic
1167547939 19:50140418-50140440 GTGGAGAGGGAGACGGGAGACGG - Intergenic
1167590901 19:50403661-50403683 GTGGAGAGGGAGTGGGAAGGAGG - Intronic
1168184632 19:54691745-54691767 CTGGAGATGGATGGGGATGATGG + Intronic
1168379311 19:55906790-55906812 TCTGAAAGGGATGGGGAAGAGGG - Intronic
1168381762 19:55929997-55930019 TGAGAGAGGGACAGGGAAAAAGG + Intronic
1168527442 19:57100188-57100210 TGGGGGAGGGAGATGGAAGAGGG + Intergenic
1168602429 19:57728437-57728459 TTGGAGTGGAAGAAGGAAGAGGG + Intronic
1202698029 1_KI270712v1_random:139642-139664 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
925482647 2:4293224-4293246 GTGGAGAAGGATAAGGATGAGGG - Intergenic
925513614 2:4654612-4654634 TTGTCGGGGGACAGGGAAGAAGG - Intergenic
926273562 2:11386382-11386404 GTGAAGAGAGATGGGGAAGAAGG - Intergenic
926396890 2:12452825-12452847 GTGGGGAGGGATGGGGAAGCTGG - Intergenic
926445055 2:12931342-12931364 TAGAAGAGGGATGGGGAAGATGG + Intergenic
926529605 2:14027244-14027266 TTGGAGGGATATAGGGAAGGGGG - Intergenic
926624961 2:15083299-15083321 GTGGAGATGGAGAGGGAAGAAGG - Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927172404 2:20381104-20381126 TGGGGGAGGGAGAGGGTAGAAGG - Intergenic
927499648 2:23574161-23574183 TTGGAGGAGGAGAGGGAAGAAGG + Intronic
927881106 2:26690777-26690799 TTGAAGAGGGAGGGGGAACATGG + Intergenic
927924584 2:27002127-27002149 TTGGAGACAGGTAAGGAAGAAGG + Intronic
927991130 2:27447921-27447943 TTCTAGAGGTAGAGGGAAGAAGG + Exonic
928049597 2:27976879-27976901 TAGGAGAGGGATATGGCAGAAGG + Intronic
928756043 2:34526816-34526838 GTGAAGAGGGGTAGGGAGGAAGG + Intergenic
928863349 2:35887228-35887250 TTGGAAAGGAAAAGGGAAGATGG - Intergenic
928983326 2:37157294-37157316 TTGGGGTGGGGTTGGGAAGATGG + Intergenic
929510452 2:42562406-42562428 GTGGGGAGGGGGAGGGAAGATGG - Intronic
929588134 2:43128679-43128701 GTGGAGAGGAATGAGGAAGAGGG + Intergenic
929799323 2:45085838-45085860 TTGGAGGGGGGTGGTGAAGAGGG - Intergenic
930737633 2:54795508-54795530 TGGGGGAGGAAAAGGGAAGAGGG + Intronic
931232797 2:60388657-60388679 ATGGAAAGTGATAGGGGAGAGGG + Intergenic
931430438 2:62204955-62204977 CTAGAGAGGGAGAGAGAAGAAGG + Intronic
931584062 2:63808302-63808324 GGGGAGAGGGAGAGGGGAGAGGG - Intronic
931744734 2:65282104-65282126 GTGGAGAGGGAGAGGGAGGGAGG - Intergenic
932498995 2:72164613-72164635 TTGGAGAGAGATAAGCAATAAGG + Intergenic
932534955 2:72582799-72582821 TTGGGGAGTGATGGGTAAGATGG + Intronic
932602021 2:73134031-73134053 TTCCTGAGGGATAGGGAAGAGGG + Intronic
932918905 2:75887318-75887340 TTGGAAGGGGGTAGGGGAGAAGG - Intergenic
933346532 2:81093081-81093103 GAGGAGAGAGAGAGGGAAGAAGG + Intergenic
933537180 2:83590772-83590794 TTTGAAAGGCAGAGGGAAGAGGG + Intergenic
933691442 2:85182118-85182140 TTGGAGAGGAAAAGCAAAGATGG + Intronic
933987593 2:87604706-87604728 TGGGGGAAGGATGGGGAAGAGGG - Intergenic
934279283 2:91597422-91597444 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
934476283 2:94595711-94595733 TTTGAGAGGGCTGTGGAAGATGG + Intronic
935258238 2:101331626-101331648 ATGGATAGGGATGGGAAAGAAGG + Intergenic
935849711 2:107205145-107205167 TTGAAGAAGAATACGGAAGAAGG + Intergenic
936001005 2:108830319-108830341 TTGGGGATGGATAGTGATGATGG + Intronic
936024762 2:109022604-109022626 TGGGAGGGGGAGAGGGAAGAGGG + Intergenic
936306247 2:111346102-111346124 TGGGGGAAGGATGGGGAAGAGGG + Intergenic
936456948 2:112682575-112682597 TGGGAAGGGGAAAGGGAAGAGGG - Intergenic
936990322 2:118357120-118357142 CTGGAGATGGATAGTGATGATGG - Intergenic
937233798 2:120418361-120418383 TTGGAGAGGGATGGCAAAGCGGG + Intergenic
938502326 2:131836491-131836513 TTGGAAGGGGATGGGGATGATGG - Intergenic
938579770 2:132635521-132635543 TGTGAGAGGAATAGGGAGGAAGG + Intronic
938655700 2:133430862-133430884 GTGGAGAGGGAGAAGGAAGGAGG + Intronic
938720463 2:134063381-134063403 TGGGAGAGGGAGACGGGAGAGGG - Intergenic
938922356 2:136007015-136007037 TAGGAAAGGGATTGGGAAGGAGG - Intergenic
938963209 2:136361485-136361507 ATGGAGAGAGAGAAGGAAGAAGG - Intergenic
938965642 2:136386068-136386090 GGGGAGAAGGACAGGGAAGAAGG + Intergenic
939186995 2:138872362-138872384 AGGGAGAGGGAGAGGGGAGAGGG + Intergenic
939187000 2:138872375-138872397 GGGGAGAGGGAGAGGGGAGAGGG + Intergenic
940343889 2:152609791-152609813 TTGGAGAGAGACAAGGAATAAGG + Intronic
940456090 2:153902596-153902618 TTGTAGAGGGATAAGAATGAAGG + Intronic
940577031 2:155521915-155521937 AGGGAGAGGGATAAGGAAAAGGG - Intergenic
940716574 2:157232037-157232059 CTGGAGATGGATAGTGATGAAGG - Intergenic
941476398 2:165955956-165955978 ATGGACAGGGGTAGGGGAGATGG + Intergenic
941745450 2:169081920-169081942 TGGGACAGGGATAGGGGATAGGG + Intronic
941769445 2:169329458-169329480 TTGGAGAGTGGTAGGCAACAAGG + Intronic
941849427 2:170164421-170164443 CTGGAGAGGCAAAGGGAAGAGGG - Intergenic
942103002 2:172604707-172604729 ATGGAGAGGGCTAGACAAGAGGG - Intronic
942762896 2:179420751-179420773 CTGGAGAGGGATGGTGATGATGG - Intergenic
943024878 2:182615796-182615818 AAGGAGAGGGAGAAGGAAGAGGG + Intergenic
943522867 2:188975820-188975842 GTGGAGAGAGATAAGGAGGAGGG - Intronic
943665457 2:190604178-190604200 TTGGAGAGTGAGTGGGAAAAGGG + Intergenic
944001272 2:194841415-194841437 TGAGGGAGGGATAGGGAAAAAGG - Intergenic
944117366 2:196203793-196203815 CTGGAGATGGATAGTGATGATGG - Intronic
944350249 2:198717949-198717971 TAGGAGAGGGATATGGCAGAGGG + Intergenic
944368511 2:198953859-198953881 ATGGAGAGGGTAAAGGAAGATGG - Intergenic
944483483 2:200180437-200180459 ATGGAGAGGGAAGGGGAAGAGGG + Intergenic
944797488 2:203202967-203202989 TTGGAAAGCAATAGGGAATAAGG - Intronic
945134261 2:206609596-206609618 TGGGAGAGGGGAAGAGAAGAAGG + Intronic
946026080 2:216672735-216672757 TTGGATGGGGAAAGGGAAGGTGG - Exonic
946494427 2:220181514-220181536 TTGGAGTGGGGTAGGGCTGAGGG + Intergenic
947446035 2:230163273-230163295 TTGGCAAGGAAAAGGGAAGATGG + Intergenic
947745731 2:232506454-232506476 GTGGGGAGGGAAAGGGAAGAAGG + Intergenic
947825737 2:233105054-233105076 TTGGGTAGGGATAGGGAATGTGG + Intronic
947926311 2:233925483-233925505 CTGGAGGGGTATGGGGAAGAGGG + Intronic
948401794 2:237690958-237690980 CTTGGGAGGGATAGGGGAGAAGG - Intronic
948406928 2:237728817-237728839 TTGGTCGGGGAGAGGGAAGAAGG - Intronic
948553605 2:238792268-238792290 TGAGAGAGGGAGAGGGAGGAAGG - Intergenic
1168790998 20:575613-575635 TGGGAGAGTGACAGCGAAGAGGG - Intergenic
1168862498 20:1055866-1055888 TTGGACTAGGGTAGGGAAGAAGG - Intergenic
1169184840 20:3605745-3605767 TTGGAGAGTGATGGGGAGGAAGG + Intronic
1170214534 20:13877264-13877286 TTGTAGAGGGACAGGGCAGCAGG - Intronic
1170485152 20:16807980-16808002 TCTGAGAGGAAGAGGGAAGAAGG + Intergenic
1170487096 20:16829455-16829477 TTTGACTGGAATAGGGAAGATGG - Intergenic
1171105957 20:22432551-22432573 GTGGAGAGTGCTAGGGAGGAAGG + Intergenic
1171232399 20:23498031-23498053 GTAGAGAGAGAGAGGGAAGAGGG + Intergenic
1171250420 20:23642035-23642057 TTGGGGAGAGAGAGGGGAGAAGG - Intergenic
1171472392 20:25382635-25382657 TTGGAGAGAGGCATGGAAGATGG - Intronic
1171905837 20:30899311-30899333 AAGGAGAGGGAGAGGGAAGGAGG - Intergenic
1172265967 20:33614491-33614513 TTGGAGATGGATGGTGATGATGG - Intronic
1172798040 20:37556806-37556828 GAGGAGAAGGACAGGGAAGATGG - Intergenic
1173057357 20:39628375-39628397 TTGGAATGGGATGAGGAAGATGG + Intergenic
1173320311 20:41981748-41981770 TGGGAGAGGGAAAGGGAGGTGGG + Intergenic
1173468724 20:43305676-43305698 TTGGAGAAGAGTAAGGAAGAGGG + Intergenic
1173524176 20:43719435-43719457 TGGGAGAGGGACAGGCAGGAGGG + Intergenic
1173815022 20:45981725-45981747 TTGGAGGGGGATGGGGTAGTGGG + Intergenic
1173870496 20:46338978-46339000 GTGGAGATGGATGGGGAGGAGGG + Intergenic
1174045185 20:47728149-47728171 CCGGAGAGGGGGAGGGAAGATGG + Intronic
1174122970 20:48280844-48280866 TTCCTGAGGGATAGGGAGGAGGG - Intergenic
1174299025 20:49568528-49568550 GGGAAGAGGGATGGGGAAGATGG + Intergenic
1174876102 20:54227814-54227836 TGGGGGAGGGATAGGGTAGAAGG + Intronic
1175034689 20:55988863-55988885 TTGGGGAGGAAAAGGGGAGAAGG - Intergenic
1175108454 20:56630168-56630190 TCGGAGAGTGGGAGGGAAGAAGG + Intronic
1175148922 20:56917623-56917645 CTGGAGTGGGAGAAGGAAGACGG - Intergenic
1175803374 20:61813732-61813754 TTGTCGAGGGAAAGGGAACAAGG - Intronic
1177259200 21:18706962-18706984 AAGGAGAGGGAGAGGGAAAAGGG - Intergenic
1177824867 21:26071343-26071365 CTGGAGAGGGAAACTGAAGATGG - Intronic
1177836010 21:26187010-26187032 ATGGAGTGGGATGGGAAAGAAGG - Intergenic
1178997040 21:37412149-37412171 TTGAAAATGGATAGGCAAGAAGG + Intronic
1179040818 21:37800963-37800985 TTGATGAGAGGTAGGGAAGACGG + Intronic
1179270013 21:39843626-39843648 TTGGAGAGTGGTAAGGAAGGAGG + Intergenic
1179479935 21:41670547-41670569 GTGGAGGGGGACAGGGAAGGAGG + Intergenic
1181497771 22:23297534-23297556 ATGGAGAGGGAGAGAGAAGTGGG - Intronic
1181628586 22:24138024-24138046 GTTGAGAGGGATAGGGATTAGGG - Intronic
1181970247 22:26684378-26684400 TTGGAGGGGGACGGGGAAGCAGG + Intergenic
1182065291 22:27427006-27427028 ATGGGCAGGGGTAGGGAAGAGGG - Intergenic
1182090426 22:27591000-27591022 TGGGAGAGAGAAAAGGAAGAAGG + Intergenic
1182100861 22:27656319-27656341 AGGGAGAGAGAGAGGGAAGAAGG + Intergenic
1182554459 22:31121682-31121704 TTGGACAGCGATAGTGGAGATGG - Intergenic
1182852653 22:33489258-33489280 TCGTGGAGGGAGAGGGAAGAGGG + Intronic
1182867282 22:33614681-33614703 ATGGAGAGTGATGGGGGAGATGG - Intronic
1182873889 22:33673615-33673637 CTGGAGATGGATAGTGATGATGG - Intronic
1182894866 22:33850735-33850757 GTGGAGGGGGATAGGGCGGAGGG + Intronic
1182922343 22:34091501-34091523 TCGGAGAGGAAGGGGGAAGACGG + Intergenic
1183051769 22:35268304-35268326 TTGGAGGGGAGTAGGGAAGGGGG - Intronic
1183370040 22:37427169-37427191 TTGGAGAGGGACACGGAAGGGGG - Intronic
1183694765 22:39415476-39415498 TGGAAGAGGGAGAGGGCAGAGGG - Intronic
1183986416 22:41572773-41572795 TTGGAGAGGGGTAGGTAGGCGGG + Intronic
1184377403 22:44123372-44123394 TTTGAGAGGGAGAGAGAGGAAGG + Intronic
1184420315 22:44378358-44378380 AGGGAGAGAGAGAGGGAAGAAGG - Intergenic
1184421146 22:44383656-44383678 AAGGAAAGGGATAGGGGAGAAGG - Intergenic
1184970936 22:48019393-48019415 TTGGGGAGGGGCAGGGCAGAAGG + Intergenic
1185071161 22:48657133-48657155 GTAGAGAGGGATAGAGAAGAAGG + Intronic
949480129 3:4485862-4485884 CTGGTGAGGAATAGGGTAGAGGG - Intergenic
949694928 3:6683261-6683283 TTGGAGAGAGAGAGGAAAGCAGG + Intergenic
950040059 3:9914608-9914630 TTGGGGAGGGGGAGGTAAGAGGG + Intronic
950096493 3:10333733-10333755 ATGAAGAGGGAGAGGCAAGATGG + Intronic
950099881 3:10350200-10350222 CTGGAGAGGGATGGGGAAGGGGG + Intronic
950210933 3:11122584-11122606 TTGGAAAGGGATATGGATGGTGG - Intergenic
950935675 3:16836493-16836515 TTTGTGAGGGAAAGGGAAAAGGG + Intronic
951171545 3:19547752-19547774 TTGAAGAGAGAAAGGGAAGAGGG - Intergenic
951441255 3:22726563-22726585 GTGGAGGGGGATAGACAAGATGG - Intergenic
951865839 3:27306302-27306324 TTGGAGAGGTAGATGAAAGAGGG - Intronic
952115077 3:30169126-30169148 GGGGAGGGGGATAGGGAAGTAGG + Intergenic
952489380 3:33851795-33851817 TGGGAGAGGAAAAGGAAAGAGGG - Intronic
952534742 3:34297696-34297718 TTGGAGAGTGGTGAGGAAGAGGG + Intergenic
952723151 3:36554610-36554632 TGGGAGAGGGATAGAGGAGCTGG + Intergenic
953838700 3:46370401-46370423 TTGGGGTGGGATAGGGGATACGG + Intergenic
953855655 3:46497592-46497614 GAGGAGAGGCACAGGGAAGAAGG - Exonic
953986990 3:47451712-47451734 TTGTAAAGGGATAGGTAGGAAGG - Intronic
954453660 3:50585469-50585491 TTGGACAGGGACAGGGCTGAGGG - Intergenic
954524519 3:51257930-51257952 TTCAAGAGGAATGGGGAAGAGGG + Intronic
954613497 3:51958206-51958228 TTGGAGAGGGAGATGGCATAGGG + Exonic
954967670 3:54625576-54625598 GTGGAGCGGGCCAGGGAAGAGGG + Intronic
955249844 3:57269174-57269196 TTGGACAGGGATGGAGAAAAGGG + Exonic
956121831 3:65974295-65974317 TGGGAGAGTGGGAGGGAAGAAGG + Intronic
956697089 3:71927810-71927832 TTGGAGAAGCAAAGTGAAGATGG - Intergenic
957731681 3:84147163-84147185 AAGGAGAGGGAAATGGAAGAGGG - Intergenic
958123813 3:89329009-89329031 AAGGTGAGGGATTGGGAAGAGGG - Intronic
959048280 3:101498920-101498942 ATGGACAGGGGTCGGGAAGATGG - Intronic
960399951 3:117184381-117184403 TGGCAGAAGGATATGGAAGAAGG - Intergenic
960470297 3:118055971-118055993 TTGGAAAAGGATGTGGAAGACGG - Intergenic
960672568 3:120167333-120167355 TTGGAGAGGCATGGGGCAGCAGG + Exonic
961070993 3:123926701-123926723 TTGGAGAAGGAAAAGAAAGAGGG + Intronic
961153192 3:124657166-124657188 TTGGATTGGGAGAAGGAAGAGGG + Intronic
961522603 3:127475633-127475655 GTGGAGTGGGTGAGGGAAGAAGG - Intergenic
961635794 3:128331507-128331529 TTGAGGAAGGAGAGGGAAGAGGG - Intronic
961922023 3:130436831-130436853 TTGCATAAGGATAGAGAAGAGGG - Intronic
961994166 3:131223426-131223448 TAGGAGAGGGAAAGGGACTAAGG + Intronic
962571990 3:136722658-136722680 GGGGAGAGGGAGAGGGGAGAAGG - Intronic
962715913 3:138125927-138125949 TTGGAGAGGGGTGGGGAGGGAGG + Intronic
962853505 3:139325139-139325161 TTGGAGAGGGAATGGGCTGATGG + Intronic
962967158 3:140365770-140365792 TTGGAGATAGATGGGGCAGAGGG + Intronic
963190419 3:142464778-142464800 TTGGAGAGGGATGGTGGTGATGG + Intronic
963911868 3:150822062-150822084 AGGGAGAGGGAGAGGGGAGAGGG + Intergenic
964086955 3:152830630-152830652 TGGGAGAGGGAGGAGGAAGAGGG - Intergenic
964147996 3:153489354-153489376 TTGTAGAGGTGGAGGGAAGAAGG - Intronic
964198574 3:154091925-154091947 TGGGAGCGGGGTGGGGAAGAAGG + Intergenic
964652601 3:159028273-159028295 TTGGACAGGGAAAGGAGAGATGG - Intronic
964677833 3:159303497-159303519 ATAGAGAGGGAGAGGGAAGAAGG + Intronic
964830385 3:160877875-160877897 TTGGCAAGGAAGAGGGAAGATGG + Intronic
965267986 3:166572133-166572155 TTGAAGTGGAATAGAGAAGATGG + Intergenic
965688631 3:171332078-171332100 TTGGAAAAGTATAGAGAAGACGG + Intronic
965899297 3:173618890-173618912 TTGCAGAGTGATAGAGAAGAGGG + Intronic
967359688 3:188615285-188615307 TTGGGGAAGGACTGGGAAGAAGG - Intronic
967417532 3:189235382-189235404 TAGAAGAGTGAAAGGGAAGATGG + Intronic
967540775 3:190665139-190665161 CTGGAGAAGGATAGGGCGGATGG + Intergenic
967983375 3:195078535-195078557 TTGGATGGGGATGAGGAAGAGGG - Intronic
968088746 3:195886573-195886595 TTAGAGAGGGTCAGGGAGGAGGG + Intronic
968139277 3:196243515-196243537 GGGGAGAGGGAGAGGGGAGAGGG - Intronic
968944644 4:3657269-3657291 GGGGAGCGGGAGAGGGAAGAGGG - Intergenic
969031472 4:4218471-4218493 ATGGAAAAGGAGAGGGAAGAAGG + Intronic
969032128 4:4223951-4223973 GAGGAGAGAGAGAGGGAAGAGGG + Intronic
969282189 4:6178114-6178136 GAGGGGAGGGATAGGAAAGAAGG + Intronic
969525443 4:7701793-7701815 ATGGAGGGGCAGAGGGAAGACGG + Intronic
969548797 4:7850423-7850445 TGGAGGAGGGAGAGGGAAGAGGG + Intronic
969550214 4:7860979-7861001 TGGGGCAGGGGTAGGGAAGAAGG - Intronic
969591217 4:8122897-8122919 TGGGAGAGGGAGAGGGGTGAGGG + Intronic
969918283 4:10511441-10511463 TTGGAGATGGATAGCGGAAATGG - Intronic
970033457 4:11704174-11704196 TTGAAGGGGTATAGGGAAGTAGG - Intergenic
970564750 4:17320928-17320950 ATGGAGGGTGATGGGGAAGATGG - Intergenic
970748654 4:19331347-19331369 TTGTAGATGTATAGGAAAGAAGG + Intergenic
972178641 4:36438708-36438730 CTGGAGAGTGATAGGGAGAATGG - Intergenic
972744958 4:41923771-41923793 TTGGCAAGGAAAAGGGAAGATGG - Intergenic
972968873 4:44547945-44547967 TGGCACTGGGATAGGGAAGAGGG - Intergenic
973316609 4:48767243-48767265 TAGGAGAGAGAGAGGGAAGGGGG + Intronic
973663262 4:53130575-53130597 GTGTAGAGGGAGAGGGGAGATGG - Intronic
973832845 4:54779279-54779301 TTGGAGTGGGACAGGGAGGGAGG + Intergenic
973833778 4:54789115-54789137 TTAGAGAGGAATAGAGAAGGAGG - Intergenic
974457776 4:62149753-62149775 TTGGGGAGGGTTGGGAAAGAGGG + Intergenic
974493637 4:62599312-62599334 TTCAAGTGGGAAAGGGAAGAGGG - Intergenic
974778169 4:66515423-66515445 AGAGAGAGGGAGAGGGAAGAAGG + Intergenic
974806237 4:66883699-66883721 TAGGAAAGGGAGAGAGAAGAGGG - Intergenic
975146809 4:70976961-70976983 CGGGAGAGGGAGAGGGAAGGAGG - Intronic
975807936 4:78132767-78132789 TTGTAGAGGGTTACTGAAGATGG + Intronic
976370250 4:84279516-84279538 TTGGGGAGGGATGGTGAACAAGG - Intergenic
976372814 4:84309668-84309690 TTGGAGATGGACAAGGAAGCAGG - Intergenic
976753383 4:88473364-88473386 ATTGAGAGGGAAAGAGAAGAGGG - Intronic
977370420 4:96127195-96127217 ATAGAGAAGGAAAGGGAAGAAGG - Intergenic
977444267 4:97109565-97109587 TTGTAGAAGAATATGGAAGAAGG + Intergenic
977851674 4:101837925-101837947 AGGGAGAGGGAGAGAGAAGAGGG - Intronic
978035137 4:103983901-103983923 TTGGAGATGGAGAGGGAAGAGGG + Intergenic
978690871 4:111507661-111507683 ATGGAGAGGGATAAGTAAGGTGG - Intergenic
978749169 4:112227831-112227853 TTTGAAAAGGATGGGGAAGAAGG + Intergenic
979040519 4:115786530-115786552 ATGGAGATGGATAGTGATGATGG - Intergenic
979245814 4:118503079-118503101 TTGGAGTGGGATAGGGAGGGAGG + Intergenic
979509394 4:121535079-121535101 AAGGAGAGTGATAGGGATGAAGG + Intergenic
979808205 4:125001657-125001679 TTGGGGAGGCAAAAGGAAGATGG + Intergenic
980546232 4:134266742-134266764 TTGGAGAATGATAGGGATGATGG - Intergenic
980801138 4:137751609-137751631 TTGGAGAGAGATAAAGAAGATGG - Intergenic
980933729 4:139206487-139206509 GGGGAGAGGGAGAGAGAAGATGG - Intergenic
981220671 4:142229836-142229858 TTTTGGGGGGATAGGGAAGAAGG + Intronic
981460919 4:145012990-145013012 TTGGAGGAAGAGAGGGAAGAGGG - Intronic
981586773 4:146311748-146311770 GGGGAAAGGGAAAGGGAAGAAGG + Intronic
981758840 4:148171472-148171494 TTGGACAGCGATGGGGAGGATGG + Intronic
982261552 4:153498551-153498573 TTGGAGGTGGGTAGGGAAGTGGG + Intronic
982532878 4:156569655-156569677 TTAGAGAGAGAGAGAGAAGAAGG - Intergenic
982990406 4:162266461-162266483 TTGCAGAAGGATGGGGTAGAAGG - Intergenic
984165094 4:176296617-176296639 AGGGTGAGGAATAGGGAAGAAGG + Intergenic
984269252 4:177530688-177530710 ATAGAGAGGGACAGGGCAGAAGG - Intergenic
984388758 4:179100070-179100092 TGGGAGAAGGAAAGGGAGGAAGG + Intergenic
984586306 4:181568754-181568776 TTGGAAAGGATTAGGGAAGTGGG - Intergenic
985767443 5:1787441-1787463 CAGGACAGGGATATGGAAGATGG - Intergenic
985771974 5:1817510-1817532 TGGGAGGGGGAGAGGGAAGAAGG + Intergenic
985983156 5:3488954-3488976 AGGGAGAGAGATAGGGAAAAAGG - Intergenic
986636068 5:9823615-9823637 GAGGAGAGGGAAAGGGAGGAAGG + Intergenic
986693273 5:10331364-10331386 TTGGAGATGGTGAGGGAAGGAGG - Intergenic
986808630 5:11332566-11332588 TTGGAGATGGTTAGTGATGATGG - Intronic
987261071 5:16204008-16204030 TGGGTGTGGGAGAGGGAAGAGGG + Intergenic
987372227 5:17203795-17203817 ATGAAGAATGATAGGGAAGAGGG - Intronic
987912741 5:24170105-24170127 TTTGTGGGGGATGGGGAAGAGGG - Intronic
988486724 5:31673500-31673522 TTGGTGTGGGATAGAGCAGATGG + Intronic
989568311 5:42923492-42923514 TTGGAGGTGGTTAGGGAAAATGG - Intergenic
990050795 5:51497387-51497409 GTGGAGAGGGATGGGCAGGAAGG - Intergenic
990088315 5:52007140-52007162 TTTGAGAAGGATAGTGGAGATGG + Intergenic
990150921 5:52816512-52816534 TTAGGGAGGGATAGGGAGGCTGG + Intronic
990372328 5:55132856-55132878 TTGGAAAGGTATAGAGGAGAAGG - Intronic
990517820 5:56546951-56546973 TAGGAGAGGCAAAGGGAAGAGGG - Intronic
990629051 5:57647723-57647745 CAGGAGAGAGATAGGGAAGGGGG + Intergenic
991045370 5:62217671-62217693 GTAGAGAGGGAGAGGAAAGAGGG - Intergenic
991247314 5:64521677-64521699 TTGGCGAGGGTAAGGGAAAATGG - Intronic
991377178 5:65977945-65977967 AGGGAGAGGGTTAGGGGAGAGGG + Intronic
992040395 5:72825187-72825209 TTGGAAGGGGATAGGGCAGAAGG - Intronic
992559315 5:77934598-77934620 GTGGAGAGGGATAGAGAAATAGG - Intergenic
992563606 5:77976004-77976026 TTGTAGAGTGAGAGGGAAAAAGG + Intergenic
992647093 5:78821089-78821111 GTGGAGGGGGACAGGGAATAAGG + Intronic
992743150 5:79793958-79793980 TGGGTAAGAGATAGGGAAGAGGG + Intronic
993513540 5:88801188-88801210 TTTTAGAGGGTTAAGGAAGAGGG + Intronic
993749465 5:91649228-91649250 GGAGAGAGGGATAGGAAAGATGG + Intergenic
994041818 5:95267596-95267618 TTGTAAAGAGATAGGGAAGTAGG - Intronic
994609200 5:102014562-102014584 AGGGAGAGGGAAAGGGAAAAGGG + Intergenic
994741831 5:103628604-103628626 TTGGATTGGGATAGGGCACATGG - Intergenic
995311989 5:110723842-110723864 TTGGGAAGGGACAAGGAAGAAGG - Intronic
995354635 5:111224136-111224158 TGGGAGAGAGAAAGGAAAGAGGG + Exonic
995364598 5:111343781-111343803 TTGTATAGGGATAAGGCAGAAGG + Intronic
995405111 5:111785896-111785918 ATGGATAGGGAGAGGGAAGAGGG + Intronic
995448974 5:112279494-112279516 TTGGAGATGGACAGTGATGATGG + Intronic
995989875 5:118224496-118224518 TGAGAGAGAGAAAGGGAAGAAGG + Intergenic
996410954 5:123158353-123158375 TTGGAGATGCAGAGGGAGGAAGG + Intronic
996892188 5:128434613-128434635 AAGGAGAGGGACAGGGAAGAAGG - Intronic
997273405 5:132561546-132561568 TCCAAGAGAGATAGGGAAGAGGG - Intronic
997301649 5:132810595-132810617 GTGGGGAAGGATAGGGAAGAGGG - Intergenic
997399302 5:133590284-133590306 TTAGAGAGGGCTAGGGAACCAGG - Intronic
998067259 5:139169825-139169847 GGGGAGAGGGAGAGGGGAGAGGG - Intronic
998352657 5:141511526-141511548 TTGGAGTGGGGTGGGGAGGAGGG - Exonic
998734474 5:145120067-145120089 TGGGAGAGGGATAGGGAGGATGG + Intergenic
998734672 5:145122975-145122997 AAGGAGAGAGAGAGGGAAGAAGG - Intergenic
999221213 5:149979336-149979358 GTGGGGAGGGAGAGTGAAGATGG + Intronic
999371325 5:151056958-151056980 CTGGAGAGGGAAAGGGCACACGG + Intronic
999397597 5:151239919-151239941 TTGGAGGGGCAAAAGGAAGAGGG + Intronic
999403386 5:151284971-151284993 CTGGAGATGGATAGGGGTGATGG - Intronic
999589569 5:153130360-153130382 TTGGTGAGGAAAAGGGAAGATGG - Intergenic
999817617 5:155193105-155193127 TTGGAGAGGAGCAGGGAAGCGGG + Intergenic
1001109263 5:168882263-168882285 TTGGAGAGGGGTAGGGAAGAAGG - Intronic
1001244947 5:170098925-170098947 GGGGAGAGGGAGGGGGAAGAGGG + Intergenic
1001511071 5:172322374-172322396 AAGGAGAGAGATAGGGAGGAAGG - Intergenic
1001737821 5:174021195-174021217 AGTGAGAGGGAGAGGGAAGACGG + Intergenic
1002174433 5:177393603-177393625 TTAGGGAGAGATGGGGAAGATGG - Intronic
1002430727 5:179202424-179202446 TAGGAGATGGAGAAGGAAGAAGG - Intronic
1002623393 5:180507031-180507053 TTTGGGAGGGATATGGAGGAAGG + Intronic
1002953081 6:1835057-1835079 ATAGAGAGGGAGAGGGAAGGAGG + Intronic
1003117020 6:3289711-3289733 TGGGAGGGGGCCAGGGAAGAAGG - Intronic
1003121608 6:3322917-3322939 ATGGAGAGGGATGGGAAGGAAGG + Intronic
1003215650 6:4107713-4107735 CTGGAGAAGGATAGTGACGATGG - Intronic
1003460232 6:6321864-6321886 TTGGAGATGCAGAGGGAGGAGGG - Intergenic
1003604411 6:7545989-7546011 TTGGATAGGCAGAGGGAAGCTGG + Intronic
1004664437 6:17736507-17736529 GGGGAGAGGGAGAGGGGAGAGGG + Intergenic
1005219527 6:23571001-23571023 TGGGAGAGAGGTAGGGAAGCTGG - Intergenic
1005225136 6:23634013-23634035 AGGGAGAGAGAGAGGGAAGAAGG + Intergenic
1005774373 6:29114734-29114756 GTGGAGAGAAATAGGGAAAATGG - Intergenic
1005837007 6:29717845-29717867 CGGGAGAGGGAGAGGGGAGAGGG - Intergenic
1005913120 6:30327599-30327621 GGGGAAAGGGTTAGGGAAGAAGG - Intronic
1006061537 6:31423827-31423849 TTGGAAAGGAAAAGAGAAGATGG + Intergenic
1006414917 6:33897855-33897877 TTGGTGAGGGACAGGTAAGGAGG - Intergenic
1006517313 6:34552191-34552213 CTGGAGGAGGGTAGGGAAGAGGG - Intronic
1006610638 6:35292398-35292420 ATGGACAGGGTTGGGGAAGATGG - Intronic
1006710448 6:36064486-36064508 TTGAAGAGGGAAATGGAAGTGGG + Intronic
1006887579 6:37395416-37395438 TGGGAGAGGCCCAGGGAAGACGG - Intergenic
1007360403 6:41351453-41351475 CTGGAGAGGGATAGAAAAGCAGG + Intergenic
1007371608 6:41429872-41429894 TTGAAGAGGGAGAGGGGAGAGGG - Intergenic
1007484757 6:42173428-42173450 GTGGAGAGGGAGAGAGCAGAAGG - Exonic
1008084194 6:47226801-47226823 TTGTGGAGGGATGGGGAAGGTGG + Intergenic
1008368254 6:50707048-50707070 TTGGAGAGGGATGGAGATGGTGG + Intergenic
1008624938 6:53306231-53306253 GGGGAGAGGGAGAGGGGAGAGGG + Intronic
1008624946 6:53306251-53306273 GGGGAGAGGGAGAGGGGAGAGGG + Intronic
1008624969 6:53306306-53306328 GGGGAGAGGGAGAGGGGAGAGGG + Intronic
1009751758 6:67885181-67885203 TGGGTCAGGGATAGGGAAAAGGG + Intergenic
1009761547 6:68013037-68013059 AGGGAGAGAGAGAGGGAAGAAGG + Intergenic
1009796794 6:68479642-68479664 TTGAAGAGGGAAAGGGCAGATGG - Intergenic
1010582860 6:77620857-77620879 CTGGAGATGGATAGTGATGATGG - Intergenic
1011140627 6:84151681-84151703 TTGGGGATGGAGAAGGAAGAAGG + Intronic
1011260439 6:85464832-85464854 ATGGTGAGGGAGAGGGAAGAGGG + Intronic
1011771285 6:90676225-90676247 TTGGGGAGGGAGAAGGAGGATGG + Intergenic
1012858897 6:104535180-104535202 GTGGAGAGGCATTGGGAAGCAGG - Intergenic
1012900177 6:104996147-104996169 TTGCAGAGGGTTAAGGAAGCAGG + Intronic
1013573504 6:111454477-111454499 CTGGAGATGGATAGTGATGATGG - Intronic
1013836363 6:114341191-114341213 AGGGAGAGGGAGAGGGAATAGGG + Intronic
1014129428 6:117813665-117813687 GAGGAGAGGGACATGGAAGAGGG + Intergenic
1014242405 6:119032490-119032512 GGGGAGAGGGAGAGGGAAGAGGG + Intronic
1014942624 6:127460968-127460990 TGAGAGAGGGAAAGGGAGGAGGG + Intronic
1015167663 6:130216239-130216261 TTGGAGAGGGGTGGGGTGGAGGG + Intronic
1015798401 6:137035866-137035888 TTGGAAAGGGAGAGGGATGCTGG + Intronic
1015846553 6:137526045-137526067 TAGGAGAGAGAGAGTGAAGAAGG - Intergenic
1016170920 6:141015559-141015581 ATGGAGAGGAATAGGAAGGATGG + Intergenic
1016571320 6:145516206-145516228 TTTGAGAGAGATAGTGAAGATGG + Intronic
1017712187 6:157180907-157180929 GGGCAGAGGGAGAGGGAAGAAGG - Intronic
1017846949 6:158266890-158266912 CTGGAGATGGATAGCGATGATGG - Intronic
1018392594 6:163351797-163351819 TTGTAGACTGATCGGGAAGAGGG - Intergenic
1018582011 6:165315768-165315790 TTGGCTAGGGATGGGGGAGATGG + Intergenic
1018617013 6:165696103-165696125 TTGGGGAGGGGGAAGGAAGATGG + Intronic
1018750450 6:166799890-166799912 TGGGAGAGGGTGAGGGATGAAGG - Intronic
1019805072 7:3117661-3117683 AGAGAGAGGGAGAGGGAAGAAGG + Intergenic
1020011330 7:4807462-4807484 GGGGAGAAGGAGAGGGAAGAAGG - Intronic
1020230436 7:6314331-6314353 CTGGAGATGGATGGGGACGATGG - Intergenic
1021101355 7:16588119-16588141 TTGGAAAGGAAAAGGGGAGATGG + Intergenic
1021295909 7:18905799-18905821 TTGATGAGGGAGAAGGAAGAAGG - Intronic
1021669755 7:23023480-23023502 TTAGAGATGGAAGGGGAAGAAGG + Intergenic
1022140735 7:27491423-27491445 TTGGAGAAGGAGAGGAAGGAGGG + Intergenic
1022304856 7:29137499-29137521 TTGGAAAGGAAAAGGGAAGACGG + Intronic
1022536107 7:31099594-31099616 GAGGAGAGGGAGAGGGTAGAGGG + Intronic
1022577498 7:31512098-31512120 TTAGAGAAGGCTAAGGAAGATGG + Intergenic
1023259533 7:38344825-38344847 TGGGGGAGGGGTAGGGAACAGGG + Intergenic
1023267148 7:38418649-38418671 TTGGAGGGAGAAAGGGAAAAAGG - Intronic
1025724638 7:64045577-64045599 TGGGAGATCCATAGGGAAGAAGG + Intronic
1025996056 7:66528221-66528243 TTGCAGAGGGATGGGGGAGCTGG + Intergenic
1026028235 7:66765173-66765195 TTGGAGAGGGATATAGGAAAGGG + Intronic
1026234007 7:68510138-68510160 TTGGAGAGAAACAGTGAAGATGG - Intergenic
1026234049 7:68510446-68510468 TTGAAGAGGGTTTGGGTAGAGGG + Intergenic
1026390741 7:69899164-69899186 TGGGAGAGGGATAGGAAAGTGGG - Intronic
1026662178 7:72311922-72311944 TAGGAGAGTGATGGGAAAGAAGG + Intronic
1026789764 7:73324075-73324097 AGGGAGAGGAAGAGGGAAGAGGG + Intronic
1026989454 7:74575369-74575391 ATGGAGATGGACAGGGAAGATGG + Intronic
1027474734 7:78615220-78615242 TTGAAGGGGAATAGGGGAGAAGG + Intronic
1028743474 7:94302113-94302135 TGGATGAGGGATTGGGAAGACGG - Intergenic
1028828739 7:95304061-95304083 CTGGAGAGGGATGGTGATGATGG - Intronic
1029175799 7:98663530-98663552 ATGGAGAAGGACAGGGAAGGTGG + Intergenic
1029177104 7:98672563-98672585 TGGCAGAGGGACAGGGATGAAGG + Intergenic
1029872525 7:103709975-103709997 TTGCAGGGGGATAAGAAAGAAGG + Intronic
1030131865 7:106208291-106208313 CTGGAGATGGATAGTGATGAGGG + Intergenic
1030773370 7:113502471-113502493 TTGCAGAAGGTAAGGGAAGAAGG + Intergenic
1030787215 7:113676599-113676621 TTTGAGAGGTACAGGGAAGTGGG - Intergenic
1031069301 7:117144261-117144283 TGGGAGAGGGAGAGTGAAAAAGG + Intronic
1031630569 7:124038301-124038323 TTGGAGAGGGAGGGTGAAGTTGG + Intergenic
1031909932 7:127505430-127505452 TGGGAGAGGGAAGGGGAAGGGGG - Intergenic
1032012317 7:128354703-128354725 TGAGAGAAGGAAAGGGAAGATGG + Intronic
1032108560 7:129055370-129055392 CTGGAGAGGGATGGGGCAGTCGG - Intergenic
1032247873 7:130228656-130228678 TTGGAGAGGCCCAGGGAAGTTGG + Intergenic
1032697261 7:134348125-134348147 CTGGAGAGGAATAAGGAAAATGG - Intergenic
1032817993 7:135496705-135496727 TAGGAGAGGTAAAAGGAAGATGG - Intronic
1033148598 7:138893210-138893232 TTGGAAAGACATAGGAAAGAGGG + Intronic
1033830853 7:145250608-145250630 AAGGAAATGGATAGGGAAGAAGG - Intergenic
1034004254 7:147451661-147451683 TTGGGTGGGGATAGGCAAGAAGG - Intronic
1034180168 7:149130911-149130933 TTGGTTAGGGGTAAGGAAGAGGG + Intronic
1034450890 7:151136747-151136769 TTGGATGGGGCTAGGGATGAGGG + Intronic
1035081583 7:156220611-156220633 TTTGAGAGGAGCAGGGAAGAGGG - Intergenic
1035309896 7:157960239-157960261 TTGGAGATGGATGGTGGAGATGG + Intronic
1036085004 8:5604054-5604076 TTGCAGAGGGATGGGGAGGGCGG - Intergenic
1036170710 8:6481555-6481577 TGGGAGAGGAGGAGGGAAGACGG - Intronic
1036621013 8:10424585-10424607 GTGGAGAGGGACAGGGAGAAGGG + Intronic
1037329570 8:17730878-17730900 CTGGAGATGGATATGGAGGATGG + Intronic
1037504161 8:19514254-19514276 CTGGAGGGGGTCAGGGAAGAAGG - Intronic
1037600696 8:20391497-20391519 ATGGAGTGGGAGAGGGAAGTGGG + Intergenic
1037696545 8:21228782-21228804 GTGGAGTGGGAGAGGGAAGCAGG + Intergenic
1037701152 8:21274848-21274870 GTGGACATGGATTGGGAAGAAGG - Intergenic
1037839236 8:22232199-22232221 TGGGAGGGGGAAAGGGCAGAGGG + Exonic
1038070044 8:24003742-24003764 TAGGAGAGTGATGTGGAAGAGGG + Intergenic
1038355824 8:26828415-26828437 TTTAACAGGGATAGGGAAAAGGG - Intronic
1038444028 8:27590821-27590843 CTGGAGAGGGATGGGGGTGATGG + Intergenic
1038687902 8:29735301-29735323 TTGGGGAGGGAGAGGGAGGGAGG - Intergenic
1038988765 8:32843128-32843150 TTGTTGAGGGATATAGAAGACGG + Intergenic
1039848521 8:41343144-41343166 GTGGTGAGGGATAGGGAAGTGGG + Intergenic
1041182252 8:55260820-55260842 TTGGCAAGGAAAAGGGAAGATGG + Intronic
1041433119 8:57806457-57806479 TTTCAGAGGGATACGGAAGAAGG - Intergenic
1041594895 8:59637925-59637947 TTGTAGAATAATAGGGAAGATGG + Intergenic
1041601075 8:59717902-59717924 TTGGCAAGGAATAGGGAAGATGG - Intergenic
1042334083 8:67612173-67612195 GCAGAGAGGGATATGGAAGAAGG + Intronic
1042579289 8:70258625-70258647 TTGTAGAGGGATTGGAAAGAAGG - Intronic
1043296384 8:78668158-78668180 TAGGGGAGGGAGAGGGGAGAAGG - Intronic
1043559659 8:81477195-81477217 TTGAAGAGGGTTCTGGAAGATGG - Intergenic
1044211723 8:89558520-89558542 TTTGAGAGGTAAAGGGAAGGTGG + Intergenic
1044306256 8:90645077-90645099 TTGGAGAGGGATAGGCCAGCGGG + Intronic
1044656920 8:94557938-94557960 TTGGAAAAGAAAAGGGAAGATGG + Intergenic
1046034821 8:108827918-108827940 TTGGAGAGGGAGGGGAAAGGAGG + Intergenic
1046155030 8:110277276-110277298 TTGGAGAGGCAGAGGTAAAATGG + Intergenic
1046344877 8:112910441-112910463 TTGTAGGGGGAAATGGAAGAAGG - Intronic
1046534096 8:115486325-115486347 TTGGAGAGGGAGAGAGATGAGGG - Intronic
1046773434 8:118138934-118138956 TTGGAAAGTGGAAGGGAAGAGGG - Intergenic
1046942752 8:119946899-119946921 CTGGAGAGGGTGAGGGAAGAAGG - Intronic
1047631015 8:126708583-126708605 TTGGGGATTGAGAGGGAAGATGG - Intergenic
1047640903 8:126820878-126820900 TTGGAGAGGAAGAAGGGAGATGG + Intergenic
1048417636 8:134243959-134243981 AGGGAGGGGGAAAGGGAAGAGGG + Intergenic
1049136597 8:140907479-140907501 TTATACAGGGCTAGGGAAGAAGG - Intronic
1049284230 8:141765959-141765981 TGGGAGAGGGGCAGGGGAGAGGG + Intergenic
1049401596 8:142430030-142430052 ATGGAGAGGGACAGGGACAAAGG - Intergenic
1049683731 8:143930970-143930992 GTGGGGAGTGACAGGGAAGAGGG - Intronic
1049748037 8:144271231-144271253 TTGGGGAGGGGGAGGGAAGGGGG - Intronic
1049840329 8:144766939-144766961 CTGGAGAGGGGCAGGGGAGAGGG - Intergenic
1050320023 9:4442820-4442842 ATAGAGAGGGAAAGCGAAGAGGG - Intergenic
1050887819 9:10787370-10787392 TAGGAGAGTGACAGGGAAAAGGG + Intergenic
1050930682 9:11320869-11320891 TTGAAGAAGGAAAGAGAAGAGGG - Intergenic
1051300312 9:15643733-15643755 TTGCAGGAGGATAGGGAAGAAGG - Intronic
1051807840 9:21015889-21015911 TTGGATATGGTTAGGTAAGAAGG - Exonic
1052358351 9:27528741-27528763 GTGGGGAGGGTTAGGGGAGAGGG + Intronic
1053004748 9:34596983-34597005 GGGGGCAGGGATAGGGAAGATGG + Intergenic
1053009977 9:34627648-34627670 GAAGAGAGAGATAGGGAAGAGGG + Intronic
1053681780 9:40490365-40490387 TTTGAGAGGGCTGTGGAAGATGG - Intergenic
1054281934 9:63134569-63134591 TTTGAGAGGGCTGTGGAAGATGG + Intergenic
1054392892 9:64630369-64630391 TTTGAGAGGGCTGTGGAAGATGG - Intergenic
1054427542 9:65135578-65135600 TTTGAGAGGGCTGTGGAAGATGG - Intergenic
1054502836 9:65885962-65885984 TTTGAGAGGGCTGTGGAAGATGG + Intronic
1054727787 9:68668969-68668991 TTGGAGATGGATGGTGGAGATGG + Intergenic
1054874495 9:70081152-70081174 TGGGACAGGGAAGGGGAAGAAGG + Intronic
1055246169 9:74246310-74246332 TTGGAATGTGATAGGGCAGAAGG - Intergenic
1055297821 9:74852446-74852468 AGGGAGAGGGAGAGGGAGGAGGG - Intronic
1055463596 9:76542385-76542407 TTGGAAAGGAAGAGGGAAGTTGG - Intergenic
1055775988 9:79767632-79767654 TGGGAGAGGGAAAAGGAGGATGG - Intergenic
1056056196 9:82826445-82826467 TTGGAGCTGGACAGGGAAGCGGG + Intergenic
1056105274 9:83341015-83341037 TTACAGAGTAATAGGGAAGATGG - Intronic
1056105277 9:83341062-83341084 TTACAGAGTAATAGGGAAGATGG - Intronic
1056407527 9:86289490-86289512 TTGGAAATGGGTAGAGAAGAAGG - Intronic
1057517428 9:95734034-95734056 GTGGAGAGGGGAAGGGTAGAAGG - Intergenic
1057825172 9:98367536-98367558 TTGGAGATGGATGGTGATGATGG + Intronic
1057847478 9:98536779-98536801 TTGGAGAGGGATAGGCAGGCAGG - Intronic
1057851547 9:98570564-98570586 TTGGAGCTGGGTGGGGAAGATGG - Intronic
1057906978 9:98990729-98990751 TTGGACAGAGATAGAGAAGTGGG + Intronic
1058409337 9:104713757-104713779 TTGGAGAAGAATAAGGAAAAGGG - Intergenic
1059461113 9:114430801-114430823 TTGAAAAGAGATTGGGAAGATGG - Intronic
1060036640 9:120261534-120261556 CTGGAGAGGGAGAAGGCAGAGGG + Intergenic
1060190793 9:121591148-121591170 GCAGAGAGGGATGGGGAAGATGG + Intronic
1060241381 9:121906663-121906685 TTGGAAAGGGAAAGGGGAAAGGG + Intronic
1060396268 9:123319033-123319055 TTGGCAAGGGACAGGGAGGAGGG + Intergenic
1060449578 9:123724071-123724093 TTTGAGAAGGGAAGGGAAGAAGG - Intronic
1061073767 9:128328301-128328323 TGGGACAGGGACAGGGAAGATGG - Intronic
1185623746 X:1468766-1468788 GGGGAGAGGGAGAGGGGAGAGGG - Intronic
1186348336 X:8717633-8717655 ATAGAAAGGGAGAGGGAAGAGGG + Intronic
1186656689 X:11619745-11619767 TTGGAGAGAGATAGGAAAGCGGG - Intronic
1187362602 X:18642191-18642213 TCGGGGAGGGAAAAGGAAGAAGG + Intronic
1187424960 X:19168985-19169007 TTTGAGAGTCAGAGGGAAGAGGG - Intergenic
1187482125 X:19667258-19667280 CTGGAGATGGATAGTGATGACGG + Intronic
1187493764 X:19777059-19777081 CTGGAGAGGGTTAAGGGAGATGG - Intronic
1187647362 X:21363244-21363266 CTGGAAAGGGATAGTGCAGATGG - Intergenic
1187695147 X:21912129-21912151 TTGCCGAGGGACAGGGCAGATGG + Intergenic
1188160270 X:26791739-26791761 GTGAAGACAGATAGGGAAGAGGG - Intergenic
1188195178 X:27224198-27224220 TAGGAGAGGGATAAGGGAGAGGG - Intergenic
1189303186 X:39967637-39967659 TGGGGGAGGGATAGCTAAGACGG - Intergenic
1189328777 X:40130145-40130167 ATGAAGAGGGACAGGGAAGGAGG - Intronic
1189339534 X:40194211-40194233 TTGGGGTGGAAAAGGGAAGATGG - Intergenic
1189504769 X:41601163-41601185 CTGGAGATGGATAGTGATGATGG + Intronic
1189672120 X:43422598-43422620 TTGGAGTGGGAAAGGTATGAAGG - Intergenic
1189863719 X:45300924-45300946 TTGAAAAGGAAAAGGGAAGATGG + Intergenic
1189958780 X:46305596-46305618 TGAGAGAATGATAGGGAAGAAGG + Intergenic
1190088226 X:47414821-47414843 TTGGGGCTGGAGAGGGAAGAAGG + Intergenic
1190158863 X:48016258-48016280 AGGGAGAGGGAGAGGGATGAGGG - Intronic
1190174560 X:48138529-48138551 AGGGAGAGGGAGAGGGATGAGGG - Intergenic
1190335541 X:49259547-49259569 TTGGACAGGGAAAGAGGAGAAGG - Intronic
1190464327 X:50710515-50710537 GGGGAGAGGGAGAGGGACGAGGG + Intronic
1190480344 X:50870734-50870756 TGAGGGAGGGATAGGTAAGAGGG + Intergenic
1191678513 X:63816726-63816748 TCAGAGAGGGATAGGGAGGTGGG - Intergenic
1191785575 X:64914093-64914115 TGGGAGAGAGAGAGAGAAGAAGG - Intergenic
1192034282 X:67546170-67546192 TTGTAGAGAGACAGGGTAGACGG - Exonic
1192448027 X:71224807-71224829 AGAGAGAGGGAGAGGGAAGAGGG - Exonic
1192938536 X:75887632-75887654 TTAGAGAGGGGCAGGGAAGTAGG - Intergenic
1193600663 X:83505760-83505782 TTGGAGGGGGAGAGGTAAGGAGG - Intergenic
1194640664 X:96400111-96400133 TGGGAGAGGGATGGAGAGGAAGG - Intergenic
1194868294 X:99096704-99096726 TTGGGGAGGTAAAGGGAATATGG - Intergenic
1195720864 X:107866783-107866805 GGGGAGAGGGAGATGGAAGAAGG + Intronic
1196008113 X:110856809-110856831 TGGGAGATGTAAAGGGAAGAAGG - Intergenic
1196036924 X:111155596-111155618 CTGGGGAGGGAAAGGGAAGCAGG + Intronic
1196425202 X:115562086-115562108 TTGGAGAGGGAGAGGCAAAGGGG + Intronic
1196717907 X:118827685-118827707 TAGGAGAGGGAGAGAAAAGAGGG + Intergenic
1197275654 X:124475910-124475932 TTGGAGAGTAATAGGAAAGGGGG - Intronic
1197903777 X:131401367-131401389 TGGGAGAGGGAGGAGGAAGATGG + Intergenic
1197963404 X:132030401-132030423 TTGGGGAGTGGGAGGGAAGAGGG - Intergenic
1198100488 X:133417634-133417656 TGGGAGTGGGAGAGGGAAGAAGG - Intergenic
1198262203 X:134974749-134974771 TGGGAGGGGGAATGGGAAGAGGG - Intergenic
1198388542 X:136150345-136150367 AAGGAGAGGCATGGGGAAGAAGG - Intronic
1198596361 X:138240428-138240450 TTGGGTTGGGCTAGGGAAGATGG - Intergenic
1199090354 X:143684365-143684387 TAGGAGAGGGAAAAGGAAGAAGG + Intergenic
1199503855 X:148539618-148539640 TTGGGTGGGGAAAGGGAAGAGGG - Intronic
1200123428 X:153802092-153802114 TTGGGGTGGGAGAAGGAAGAGGG - Intergenic
1201540079 Y:15096555-15096577 ATGGAGAGGGAGGGAGAAGAAGG - Intergenic
1202093407 Y:21217592-21217614 GGGGAGTGGGAGAGGGAAGAGGG + Intergenic