ID: 1135762908

View in Genome Browser
Species Human (GRCh38)
Location 16:25151871-25151893
Sequence CACTTTGAAGGAGGGGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 2, 1: 5, 2: 20, 3: 52, 4: 319}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135762901_1135762908 28 Left 1135762901 16:25151820-25151842 CCATTCTAACAGGCTGGGAAGCA 0: 6
1: 39
2: 62
3: 114
4: 268
Right 1135762908 16:25151871-25151893 CACTTTGAAGGAGGGGCAAAAGG 0: 2
1: 5
2: 20
3: 52
4: 319
1135762902_1135762908 2 Left 1135762902 16:25151846-25151868 CCTCCTGCTAGAAGTCAACAACA 0: 1
1: 0
2: 1
3: 17
4: 173
Right 1135762908 16:25151871-25151893 CACTTTGAAGGAGGGGCAAAAGG 0: 2
1: 5
2: 20
3: 52
4: 319
1135762903_1135762908 -1 Left 1135762903 16:25151849-25151871 CCTGCTAGAAGTCAACAACAGAC 0: 1
1: 0
2: 0
3: 22
4: 123
Right 1135762908 16:25151871-25151893 CACTTTGAAGGAGGGGCAAAAGG 0: 2
1: 5
2: 20
3: 52
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135762908 Original CRISPR CACTTTGAAGGAGGGGCAAA AGG Intronic
900777019 1:4593160-4593182 GTCTTTGAAGAAGGAGCAAAAGG + Intergenic
900868021 1:5282664-5282686 CCCCTTGAAGAAGGGGCAGAAGG + Intergenic
901235024 1:7663119-7663141 ATCTTTGGAGGAGGGTCAAAGGG + Intronic
901553838 1:10016205-10016227 GACTTTGAGGGATGGGCAGATGG + Intergenic
903691075 1:25173966-25173988 CACATTGAAGTGGGAGCAAAAGG + Intergenic
904220221 1:28961219-28961241 GACTCTGAATGAGGGCCAAAAGG + Intronic
904285779 1:29452506-29452528 CACTTTGAAGGATGGGGAGCAGG + Intergenic
904327803 1:29738900-29738922 AACATGGAAGGAGGGGAAAAGGG - Intergenic
906995246 1:50786441-50786463 GAGTTTGAGGGAGGGGAAAATGG + Intronic
908392509 1:63696510-63696532 CACATGGCAGAAGGGGCAAAAGG - Intergenic
909277639 1:73708708-73708730 TACTTTGAGGGAGAGGTAAAGGG - Intergenic
909570306 1:77102500-77102522 GACTTTGAAGGTGGAGGAAAGGG + Intronic
910680180 1:89854944-89854966 CACTCAGCAGGAGGGGCAAAGGG - Intronic
910805126 1:91182063-91182085 CACTTGGCAGAAGGGGCAGAAGG + Intergenic
910860878 1:91741532-91741554 CCCTCTGAAGGAGGGGAGAAGGG - Intronic
913406299 1:118495776-118495798 CACGGTGAAGGAGGAGCAGAGGG + Intergenic
915365006 1:155310045-155310067 CATTCTGAGGGAGGAGCAAAGGG - Exonic
915541074 1:156566617-156566639 CACTTAAAAGGAGGGACAGAGGG - Intronic
916561127 1:165934877-165934899 CCCTTGGAAGAAGGGGCAACAGG + Intergenic
916899252 1:169202782-169202804 CAATTGGAGGGAGGGGTAAAGGG + Intronic
917731765 1:177881662-177881684 CATTATATAGGAGGGGCAAAGGG + Intergenic
918545260 1:185675498-185675520 CAGCTTGAAGGAGAGGGAAATGG + Intergenic
918607552 1:186446827-186446849 CACTTTGAACTACTGGCAAAAGG + Intronic
918697576 1:187563041-187563063 CATTCTGAGGGAGGAGCAAAGGG - Intergenic
919561206 1:199121772-199121794 GACTGGGAAGGAGGGGTAAAGGG - Intergenic
919980575 1:202640468-202640490 CAGGTGGAAGGAGTGGCAAAGGG - Intronic
920058701 1:203212910-203212932 CTCTTTGAAGGAAGGACTAATGG + Intronic
920312795 1:205058380-205058402 CACTTTGGGGGAGGGGGAGAGGG + Intronic
920377413 1:205516653-205516675 CCCATTGAAGGAGGGGCACCTGG + Intronic
920801005 1:209187344-209187366 CACTTTGAGGGAAGGATAAATGG + Intergenic
921071426 1:211661250-211661272 CATTCTGAGGGAGGAGCAAAGGG + Intronic
923121015 1:230991602-230991624 TACTTTGAAGGTGGAGCCAATGG - Intronic
923130028 1:231067011-231067033 CACTTCAAGGGAAGGGCAAAGGG + Intergenic
923256168 1:232223432-232223454 CACTCTGAGGGAGGGGCAAAGGG - Intergenic
923329144 1:232906605-232906627 CACTGTGAGGAAGGGACAAAGGG - Intergenic
923363523 1:233236183-233236205 CATTTTGGAGGAGGGGTAATGGG - Intronic
923596954 1:235367759-235367781 CACTTTGGAAGAGGTGAAAATGG + Intronic
1065849171 10:29772555-29772577 CACTTTTTTGGAGGTGCAAACGG + Intergenic
1065963830 10:30754857-30754879 CTCTCTGAAGAAGGGGCAAGAGG + Intergenic
1066654730 10:37687085-37687107 CACTGTCAGGGAGGGACAAATGG + Intergenic
1067093161 10:43281708-43281730 CACTGAGAAGGTGGGGCATAAGG - Intergenic
1067893936 10:50159860-50159882 GAATTTGACGGAGGGGCATAAGG - Intergenic
1068138172 10:52971680-52971702 TACTTTGAGGAAGGGTCAAAGGG - Intergenic
1068771043 10:60820925-60820947 CACTTTGATGTAGGGGAAAGAGG - Intergenic
1068987908 10:63123886-63123908 CACTTCAAGGGAGGGGCAAAAGG + Intergenic
1071294438 10:84209011-84209033 CAATCTGCAGGAGGGGCAGAGGG - Intronic
1071332021 10:84570328-84570350 CACTTGGAAGCAGAGGGAAAGGG + Intergenic
1071374895 10:84992332-84992354 CACTTATAAGGAGGGACAATCGG - Intergenic
1071449930 10:85784535-85784557 CACTTGGTAGAAGGGGGAAAGGG - Intronic
1076049074 10:127318363-127318385 CACACTGAAGGAGAGGCACACGG + Intronic
1076273968 10:129181105-129181127 CAATTTGAAGGAGGGGGCATCGG - Intergenic
1078074955 11:8150152-8150174 CACTTGGAGGGATGGGCAAAGGG - Intronic
1078107663 11:8368728-8368750 CACTTTGAAGCAGGGAAACAAGG - Intergenic
1078581061 11:12540035-12540057 AACTTTGATTTAGGGGCAAAGGG + Intergenic
1078628807 11:12983246-12983268 CACTTTGCAGGAATGGCAGAGGG - Intergenic
1080937866 11:36882493-36882515 CCCTTTGCAGGAGGGGCAGTGGG - Intergenic
1081179063 11:39965558-39965580 CCCTTTGAGAGAGGGGCAAAGGG - Intergenic
1081406251 11:42701878-42701900 TACTTGGAAGGAGGGTCAAGAGG + Intergenic
1081507277 11:43731699-43731721 TACTTCCAGGGAGGGGCAAAGGG + Intronic
1083626654 11:64075281-64075303 CACCTGGAGGGAGGGGCCAAGGG - Intronic
1083931667 11:65849702-65849724 CACTTTCCAGGAGGGGCTGAGGG - Intronic
1084024237 11:66437957-66437979 CAGTGAGATGGAGGGGCAAAGGG + Intronic
1085752832 11:79177221-79177243 CTCATTAAAGCAGGGGCAAAGGG + Intronic
1086642741 11:89179787-89179809 CATTCTGAATTAGGGGCAAATGG + Intronic
1088170142 11:106987308-106987330 CACTTTGAAGGATTAGCAATTGG - Intronic
1088194235 11:107257852-107257874 TACTCTGAGGGAGGGGCAAAGGG + Intergenic
1089199240 11:116713880-116713902 CACGTGGCAGAAGGGGCAAAGGG + Intergenic
1090541579 11:127711964-127711986 CACTTCGAGGGAGGAGCAAAGGG - Intergenic
1090906213 11:131076741-131076763 CACCTTGAAGGTGGTGGAAAGGG - Intergenic
1092548528 12:9472530-9472552 CACCTTGAAGGAAGGGAGAAAGG - Intergenic
1092569014 12:9701832-9701854 CTCTTTGCAGGAGTTGCAAAGGG + Intergenic
1093159001 12:15722760-15722782 CACATGGCAGAAGGGGCAAACGG + Intronic
1093175890 12:15912754-15912776 CACTTTTAAGGAGGGCGAAAAGG - Intronic
1093560118 12:20528412-20528434 CACTTTGAATCAGAGGCACAAGG + Intronic
1093709142 12:22309617-22309639 TACTTTGAGAGAGGGGCAAAGGG - Intronic
1093837099 12:23846010-23846032 CACCTTGAAGCAGAGGAAAATGG - Exonic
1094504476 12:31049919-31049941 CACCTTGAAGGAAGGGAGAAAGG + Intergenic
1094585326 12:31772437-31772459 CGCTTTGAAGAAGGAGAAAAGGG - Intergenic
1095395128 12:41754183-41754205 CATTTGGCAGAAGGGGCAAAAGG - Intergenic
1096988460 12:55778466-55778488 AACTTTGAGGGAGTGGTAAAAGG - Intronic
1097018853 12:56006088-56006110 CACTTGGCAGGAAAGGCAAAGGG + Intronic
1097346491 12:58499052-58499074 CAAATAGAAGGAGGGGCAAATGG + Intergenic
1097438338 12:59578104-59578126 GAGGTTGAAGGAGAGGCAAATGG + Intergenic
1097561629 12:61213890-61213912 CACATGGCAGAAGGGGCAAAGGG + Intergenic
1097968733 12:65609536-65609558 CATGTGGAAGGAGGGGCAAAAGG + Intergenic
1099271739 12:80519530-80519552 CACTTTGAAGGAGGAGGGATCGG + Intronic
1100134785 12:91542309-91542331 CTATTTGAAGAAGGGTCAAAGGG + Intergenic
1100440969 12:94616653-94616675 CACTTGGAAGGAGCTGCTAAGGG + Intronic
1100569969 12:95838099-95838121 CAATTTGACTGAGGGGCAGAAGG + Intergenic
1100936646 12:99677308-99677330 CAGTTTGGAGGAGGGGCAAGTGG - Intronic
1101462773 12:104913634-104913656 CACTTCAAAGGAGGGGAAAAAGG - Intronic
1102575527 12:113853897-113853919 CACTTTGGAGGAAGGCCAAGAGG - Intronic
1103078604 12:118005437-118005459 GACTTTGAAGGACGAGCACAGGG + Intergenic
1103123368 12:118399570-118399592 CACTTTGAGGGAGGGGAGGATGG + Intronic
1104387699 12:128365228-128365250 CATTTTGCAGTCGGGGCAAAGGG - Intronic
1104593370 12:130102570-130102592 CTGTTTGAAGGAGGGTCAATGGG - Intergenic
1105354193 13:19643589-19643611 TATTTTAAAGGAAGGGCAAAGGG - Intronic
1105829600 13:24152240-24152262 CACTTTGTGGGAGGGGCACGGGG + Intronic
1106207328 13:27612327-27612349 CACTTTGAGGGAGGGGGAGGAGG - Intronic
1107102650 13:36610751-36610773 CACTTCAAGGGAGGGGCAAATGG + Intergenic
1107599843 13:42002328-42002350 CACTTGGAAATAGGGGGAAAAGG - Intergenic
1109176830 13:59167467-59167489 GAATTTGACGGAGGGGCATAAGG + Intergenic
1109981409 13:69913187-69913209 CAGTTTGAAGGGGGAGCATAGGG - Intronic
1111798872 13:92958266-92958288 CAATTTGACTGAGGGGCATAAGG - Intergenic
1112490810 13:99861653-99861675 CCCTTTGAAGGGGGGGCAGTGGG + Intronic
1115239626 14:31241721-31241743 CACTTCAAGGGAGGGGCAGAGGG + Intergenic
1116502736 14:45639849-45639871 CACTTTGAGGGAGGGGCAAACGG - Intergenic
1116523311 14:45874773-45874795 TACTTTGAGGAAGAGGCAAAGGG - Intergenic
1116610364 14:47062525-47062547 CATTTTAAAGGAGAGGGAAATGG - Intronic
1116674009 14:47881410-47881432 CACTTCTAAAGAGGGACAAAGGG - Intergenic
1116993839 14:51302518-51302540 TACTTCAAGGGAGGGGCAAAGGG + Intergenic
1120101269 14:80448357-80448379 CATTTTGAAGATAGGGCAAAAGG - Intergenic
1120286750 14:82512109-82512131 CACTTTCAGGGAAGGGTAAAAGG - Intergenic
1120337860 14:83180950-83180972 CACTTGGTAGGAGGGGAAAAGGG - Intergenic
1121612562 14:95291605-95291627 CACTTTTAAGGAGGAGGACAGGG - Intronic
1122647367 14:103204168-103204190 CACTTCGAGGGAGGGGCAAAGGG - Intergenic
1123467753 15:20529012-20529034 CACTCTGCAGGAGGGGCAGCAGG + Intergenic
1123650360 15:22472030-22472052 CACTCTGCAGGAGGGGCAGCAGG - Intergenic
1123728066 15:23124221-23124243 CACTCTGCAGGAGGGGCAGCAGG + Intergenic
1123740768 15:23280872-23280894 CACTCTGCAGGAGGGGCAGCAGG - Intergenic
1123746230 15:23321686-23321708 CACTCTGCAGGAGGGGCAGCAGG + Intergenic
1124099635 15:26681493-26681515 CCCGTTGGAGGAGGGACAAAGGG - Intronic
1124100598 15:26689414-26689436 CACTTCCAGGAAGGGGCAAAAGG + Intronic
1124140565 15:27073388-27073410 CACTATGAAGCAGAAGCAAATGG - Intronic
1124278497 15:28345003-28345025 CACTCTGCAGGAGGGGCAGCAGG + Intergenic
1124304203 15:28566605-28566627 CACTCTGCAGGAGGGGCAGCAGG - Intergenic
1124496269 15:30189290-30189312 CAGGTGGAAGGAGTGGCAAAGGG - Intergenic
1124747305 15:32349357-32349379 CAGGTGGAAGGAGTGGCAAAGGG + Intergenic
1125855046 15:42940356-42940378 CATTCTGAGGGAGGAGCAAAGGG + Intergenic
1125875593 15:43141217-43141239 CATTCTGAGGGAGGAGCAAAGGG + Intronic
1126913243 15:53437063-53437085 CACATTGTAGGATGAGCAAATGG + Intergenic
1129988884 15:79944502-79944524 CATTCTGAGGGAGGAGCAAAGGG - Intergenic
1130581070 15:85137155-85137177 CACCTTGAAGGAGGGGCTACAGG + Intronic
1131618551 15:94042615-94042637 CACTTTGAGGGAGAGGCAATGGG - Intergenic
1132248029 15:100312313-100312335 GACTTTGAAGGAGGGGGAAGAGG + Intronic
1133160334 16:3907686-3907708 CAGTTTTAAGGAGGAGCCAAGGG + Intergenic
1134089404 16:11383644-11383666 CACTGTGGAGGAGGGGCCAGGGG + Exonic
1134750948 16:16624609-16624631 CACTTTAAAGCAGGGACCAAGGG + Intergenic
1134994506 16:18728982-18729004 CACTTTAAAGCAGGGACCAAGGG - Intergenic
1135762908 16:25151871-25151893 CACTTTGAAGGAGGGGCAAAAGG + Intronic
1135946145 16:26866697-26866719 CTCTTTGTCAGAGGGGCAAATGG - Intergenic
1138008441 16:53357698-53357720 CACTCTGCAGGAGGGGCAGCAGG + Intergenic
1141574285 16:84954171-84954193 CACTTTGCAGGTGGGGCAAGGGG + Intergenic
1141833659 16:86524011-86524033 CACTTTGAATGAAGAGCAGAAGG + Intergenic
1142507272 17:372525-372547 CACATGGCAGGAGGGGCCAACGG - Intronic
1144457010 17:15427000-15427022 CACATGGCAGAAGGGGCAAAAGG - Intergenic
1144462250 17:15467600-15467622 CACTTTGGGGCAGGGGCAAGAGG - Exonic
1146708102 17:35016944-35016966 CCCCTTAATGGAGGGGCAAACGG - Intronic
1147292266 17:39453264-39453286 AGCTTTGAAGGAGGCGCCAAAGG + Intergenic
1147723082 17:42550521-42550543 CACTGTCACAGAGGGGCAAAGGG - Exonic
1147724294 17:42556747-42556769 CACTGTCACAGAGGGGCAAAGGG - Intergenic
1148251646 17:46086515-46086537 CACTTTGAAGGATGGGTTAGGGG - Intronic
1148866358 17:50630797-50630819 CCCTTTGCAGGAGGGGCACCAGG - Intergenic
1148983196 17:51597410-51597432 CACTTTGAGGGAGGGGCAAAGGG + Intergenic
1150216650 17:63475238-63475260 GCCTCTGAAGGAGGGGCCAAGGG - Intergenic
1151079771 17:71315527-71315549 GACTATGAAGGAGGGCTAAAAGG - Intergenic
1151952719 17:77364055-77364077 CACTTCACAGGAGGGACAAATGG + Intronic
1152824689 17:82457326-82457348 CACTTCCAGGGAGGGGCAAAGGG + Intergenic
1153444403 18:5155469-5155491 CACTTTCGGGGAGGGGCACAGGG - Intronic
1153628066 18:7040588-7040610 CATTTTGAAGAAGTGTCAAAAGG - Intronic
1153716734 18:7857603-7857625 CCATTTGCAGGAAGGGCAAATGG - Intronic
1153964763 18:10169177-10169199 CACTTGGCAGGAGGGGCAGGTGG + Intergenic
1153993405 18:10419619-10419641 TACTCAGAGGGAGGGGCAAAGGG + Intergenic
1154250919 18:12744210-12744232 CACTCAGGAGGAGGGGCATAGGG - Intergenic
1154345385 18:13539543-13539565 CACCTTGAAAGAGGAGGAAAGGG - Intronic
1155696262 18:28690568-28690590 TACTTGGAGGGAAGGGCAAAGGG + Intergenic
1155940226 18:31795263-31795285 CACTTTGAGGGAGGGGGAAGGGG + Intergenic
1157793328 18:50552704-50552726 CACTTTGAGGGAGGGTAAGATGG - Intergenic
1158266315 18:55664494-55664516 CACTTTGAAGCAGGAGAATAGGG + Intronic
1158929645 18:62311023-62311045 CACTTTGAGGGAGGGGTAAAGGG - Intergenic
1159601545 18:70432915-70432937 CATTTTGAGGGAGGGGCAACAGG + Intergenic
1160140341 18:76315932-76315954 TACTTTGAAGGAGATGTAAATGG - Intergenic
1160542869 18:79634651-79634673 GACTTTGGGGGAGGGGCACATGG - Intergenic
1161565294 19:4998536-4998558 CACACTGAAGGAGAGGTAAAGGG - Intronic
1162466908 19:10847890-10847912 CTCTTAGAAGGAGAGACAAAAGG + Intronic
1164561509 19:29295502-29295524 CACTTTCAGGGAGGGGCAAAGGG - Intergenic
1164655084 19:29915099-29915121 CACTTCAAGGGAGGAGCAAAGGG + Intergenic
1164780659 19:30889130-30889152 CCCTTTGAAGCAGGGACAGAAGG - Intergenic
1166535872 19:43574529-43574551 CACTTTAAAGAAGGGGAAACTGG - Intronic
1166773259 19:45297460-45297482 CAGTTTGAAGGAGGGGTAATAGG + Intronic
925251318 2:2441285-2441307 GGCTTTGAAGGAGGAGTAAATGG - Intergenic
925312970 2:2900428-2900450 CACTAGGAGGCAGGGGCAAAGGG - Intergenic
926180978 2:10642747-10642769 GACTTTGAAGGAGGGACCGAAGG - Intronic
926814867 2:16790293-16790315 CACTTCAAAGGAGGGGCAAAGGG - Intergenic
928378619 2:30799489-30799511 CACTTTGCAGAAGGGGAAAGTGG + Intronic
929085172 2:38160733-38160755 CATTTGGGAGGAGGGGCAGAAGG + Intergenic
929816817 2:45238984-45239006 CTCTTTCTGGGAGGGGCAAAGGG - Intergenic
930110764 2:47676728-47676750 CACTTTAAGGGAGGGGTAAAGGG - Intergenic
930207422 2:48602074-48602096 CACATGGCAGGAGGGGCAAAAGG + Intronic
931289369 2:60858853-60858875 GACTTTTAAGGAGGGGAAAGAGG - Intergenic
931805633 2:65801134-65801156 CATTTTGAAGGAAAGGGAAAAGG - Intergenic
931990694 2:67787165-67787187 CACTTGGAGGGAGAGGGAAAGGG + Intergenic
932466907 2:71929947-71929969 CCCTGTGGAGGAGGGGCTAAAGG + Intergenic
932870223 2:75390943-75390965 CAATTTGACTGAGGGGCATAAGG + Intergenic
933321358 2:80779440-80779462 CATTTTGAAGAGGGGGGAAATGG - Intergenic
934539346 2:95161048-95161070 CACATGGCAGGAGGAGCAAAGGG - Intronic
936591591 2:113809587-113809609 CATTTTGAGGGAGTGGCAAAAGG - Intergenic
936626260 2:114152622-114152644 CACTTTGAGGGAGAGACAAAGGG + Intergenic
937562083 2:123238534-123238556 TACTTTGAGGGAAGGGCAAAAGG - Intergenic
937871862 2:126791960-126791982 CACTTCGAGGGAGGTGCATAAGG + Intergenic
939005495 2:136781866-136781888 CACTTTGAAGGAAAGGGTAATGG - Intronic
940919522 2:159291470-159291492 CACTTTGGTGGGGGGGCCAAGGG - Intergenic
941404427 2:165070980-165071002 CACTTAGAGGGAGGGACAAAGGG + Intergenic
942093062 2:172512832-172512854 TACTTTGAGGGAGGGGCAAAGGG - Intergenic
942428905 2:175888630-175888652 AAATTTGGAGAAGGGGCAAAGGG + Intergenic
942449389 2:176099637-176099659 TACTCTGAAGGGGGGGAAAACGG + Intergenic
942643193 2:178082529-178082551 CACTTTGAGGGAAGGGCAAAGGG + Intronic
944429386 2:199616888-199616910 AATTCTAAAGGAGGGGCAAAGGG + Intergenic
944917576 2:204376960-204376982 GACCCTGAAAGAGGGGCAAAGGG - Intergenic
945503866 2:210613656-210613678 CACTTTGAAGGAGATGAAAAAGG + Intronic
945768834 2:214014949-214014971 TACTTCGAGGGAGGAGCAAAGGG + Intronic
945863417 2:215149633-215149655 CACTTTGAAGGAGGAGGAGTTGG + Intergenic
946286542 2:218707963-218707985 TACTTTGAGGGAGGGATAAAGGG + Intergenic
947701724 2:232240052-232240074 CCCTTTGTAGCAGGAGCAAAGGG - Intronic
1168831176 20:846001-846023 CACTGTGAGTGAGGGGCCAAGGG + Exonic
1169262743 20:4149633-4149655 CACTTTGTGGGAGGGGCTGAGGG + Intronic
1169494649 20:6103070-6103092 CACATTTAAAAAGGGGCAAAAGG + Intronic
1170382343 20:15775078-15775100 CACTTTGAGGGAGGGGCAAAGGG + Intronic
1170445151 20:16418851-16418873 CACATTGAGGGAGGGGGAAAGGG - Intronic
1172930677 20:38584177-38584199 CAAGTCGAAGGAGGAGCAAATGG + Intronic
1173412377 20:42824496-42824518 CACTTTTAATGAGGGGAGAAAGG + Intronic
1173884819 20:46447868-46447890 GACTTTGAATCAGGGGCTAAAGG - Intergenic
1174762338 20:53218064-53218086 TCCTTTGAAGGAGCCGCAAATGG + Intronic
1174925156 20:54751040-54751062 GACTTTGAGGGAGGGACAAAGGG - Intergenic
1175598973 20:60257383-60257405 CAGTTTGGAGGAGGGGAAGATGG - Intergenic
1176219631 20:63963843-63963865 CACGTTGCAGGTGGGGCAGACGG + Exonic
1177276512 21:18919149-18919171 CACTTTGAAGGAGGAGGCATTGG - Intergenic
1177384217 21:20388315-20388337 CATTCTGAGGGAGGAGCAAAGGG - Intergenic
1177397861 21:20561221-20561243 AAGTTTCAAGCAGGGGCAAAAGG + Intergenic
1177867417 21:26528695-26528717 CACTTAAAATGAGGGGAAAAGGG + Intronic
1178123087 21:29489256-29489278 GAATTTGAATGAGGGGCAGAAGG - Intronic
1178766495 21:35457747-35457769 CACTTTACAGGATGGGCACATGG - Intronic
1178896725 21:36564867-36564889 CACTTTGAAGGTGGAGAAAGGGG + Intronic
1179044396 21:37831733-37831755 CACCCTGCAGGAGGGGCACACGG + Intronic
1179539437 21:42074578-42074600 CACGTTGATGGAGGGGCGATGGG + Intronic
1181390186 22:22574691-22574713 CACTTGAAAGCAGAGGCAAATGG + Intergenic
1181866873 22:25865194-25865216 CACTTTGCAGGTGGGGAAGAGGG + Intronic
949128442 3:473168-473190 CACTTTGAGGCAGGGGCAAAAGG + Intergenic
949328008 3:2888890-2888912 CACTTCCAAGGAGGAGCAAAGGG - Intronic
949689188 3:6614917-6614939 CTCTTTGGAGGAGGTACAAAAGG + Intergenic
949920616 3:8997309-8997331 CACTCTGAAGGAGTCGCTAATGG - Intronic
950206669 3:11086107-11086129 CAGTTTGAGGGAAGGGTAAAGGG - Intergenic
950381145 3:12616327-12616349 CACTTTGAAGAAGCACCAAATGG + Intronic
951570830 3:24061381-24061403 CACTTTGAAGCAGGAGGATATGG + Intergenic
951960852 3:28318591-28318613 CACGTTGTAGGACGAGCAAAAGG - Intronic
952086398 3:29826977-29826999 AGCCTTGAAAGAGGGGCAAAGGG + Intronic
952150016 3:30579000-30579022 CACTTTGAGGGAGGGGTAAAGGG - Intergenic
952862736 3:37828037-37828059 CCCTTTAAAGGAGTGACAAATGG - Intergenic
953010659 3:39022342-39022364 CACTTCAAGGGAGGGGCAAAGGG - Intergenic
954393189 3:50278231-50278253 CACTGGGAAGGAAGGGCACAGGG + Intergenic
955319999 3:57967631-57967653 GAATTTGACTGAGGGGCAAAAGG + Intergenic
955405911 3:58625674-58625696 CACTTTGAGGAAGAGGCAAAGGG - Intronic
955518683 3:59753082-59753104 CACCTTGAAGGAGGGGATTATGG - Intronic
957893449 3:86388983-86389005 CACTTCGACGGAGCAGCAAAAGG - Intergenic
958572793 3:95910554-95910576 CACTTTGAGGGATAGGCAAAGGG + Intergenic
959396618 3:105847636-105847658 CAGTGTGTAGGAGGGGAAAATGG + Intronic
959416838 3:106086267-106086289 CACTTCAAGGGAGGGGTAAAGGG + Intergenic
959649532 3:108738129-108738151 GAATTTGACGGAGGGGCATAAGG - Intergenic
961870037 3:129980767-129980789 CACTTCGAGGGAGGGGAAAAGGG + Intergenic
963877301 3:150490799-150490821 CACTTCTAGGGAGGGGCAAAAGG - Intergenic
964312887 3:155413242-155413264 CACTTCAAAGGAGGGGCAAAGGG - Intronic
965699259 3:171442831-171442853 CATTTTGGGGGAGGGGGAAAGGG - Intronic
965964132 3:174466487-174466509 TACTGTGAAGCAGGGGAAAATGG + Intronic
967334078 3:188322966-188322988 CACTTTAGAGGTGGGGGAAAAGG + Intronic
967420044 3:189262615-189262637 CACTTTGAAGGAGAGTTATATGG + Intronic
968963097 4:3755370-3755392 CATTTTGAGGGAGGGGCAAAGGG - Intergenic
970825779 4:20272328-20272350 GATTTTGGAGGAGGAGCAAAGGG - Intronic
973288785 4:48449104-48449126 CACTTGGAGGGAGGAACAAATGG - Intergenic
973925251 4:55730269-55730291 CTCTTTGAGGGAGGAGCAAAGGG - Intergenic
974476032 4:62381666-62381688 CACTTATTAGGATGGGCAAAAGG + Intergenic
975037644 4:69704418-69704440 TAACTTAAAGGAGGGGCAAATGG - Intergenic
975072439 4:70158580-70158602 AACCTTGAAGGAGGGACAAACGG - Exonic
975207497 4:71662017-71662039 CACTTCAACGGAGGGGCAAAGGG + Intergenic
975397636 4:73895533-73895555 TAATTTGACGGAGGGGCATAAGG - Intergenic
977530515 4:98195271-98195293 CACTTGGAGGGAGGGGAAAAGGG - Intergenic
977569624 4:98615834-98615856 CACTTACAATGAGGGGCAACAGG + Intronic
978223355 4:106304099-106304121 TACTTTGAGGGAGGGGCAAAGGG - Intronic
978781787 4:112563846-112563868 CACTTTGCAGATGGTGCAAAGGG + Intronic
978854822 4:113382324-113382346 CACTCTGAGGGAGGGGAGAAGGG + Exonic
979094183 4:116523881-116523903 CACTATGAGGGAGAGACAAAAGG - Intergenic
979228340 4:118317539-118317561 TCATTTGAAGGAGGGGAAAATGG + Intronic
980402862 4:132315552-132315574 CACTTCAAGAGAGGGGCAAAGGG + Intergenic
980677645 4:136109781-136109803 CACTTTGGAGGCGAGGCAAGAGG - Intergenic
981339767 4:143607970-143607992 CACTTTGAAGCTGGAGGAAAGGG - Intronic
983661359 4:170133381-170133403 CACTTTAAAGGCGGGTCCAAGGG + Intergenic
983778997 4:171644556-171644578 CGCTTCAAGGGAGGGGCAAAGGG + Intergenic
986066615 5:4240618-4240640 TAATTTGACGGAGGGGCAGAAGG - Intergenic
986106180 5:4661630-4661652 CACTTTGAAAGGGGGGAGAAAGG + Intergenic
986807885 5:11326128-11326150 CACTTCAAGGGAGGGGTAAAAGG - Intronic
987675796 5:21071045-21071067 CACTATGAGGGAGGAGCAAAGGG - Intergenic
987807919 5:22794185-22794207 CAGGTGGAAGGAGTGGCAAATGG - Intronic
988002157 5:25362735-25362757 AACTATGATGGAGGGGTAAATGG + Intergenic
990891197 5:60652054-60652076 CACTTTGAGGGAGGGGTAAAGGG + Intronic
991964067 5:72073787-72073809 CTCTATAAAGGAGGGGCAAAGGG + Intergenic
992091168 5:73318401-73318423 CACTTTGAAGATGGAGGAAAGGG - Intergenic
992115409 5:73534342-73534364 CACTTTGAGGGAGGGGCAAAGGG + Intergenic
992438673 5:76779461-76779483 AAATTAGAAGGAGGGGCAATGGG + Intergenic
992468391 5:77029947-77029969 CACTTGGAAGGAAGGACAAAGGG - Intronic
993177255 5:84502726-84502748 CAATTTGACTGAGGGGCAGAAGG + Intergenic
993353281 5:86876156-86876178 CACTTTGAGGGAGGGGCAAAAGG + Intergenic
995130053 5:108620568-108620590 GAATTTGACGGAGGGGCATAAGG + Intergenic
995350286 5:111167166-111167188 CACATGGCAGAAGGGGCAAACGG - Intergenic
996563213 5:124852686-124852708 TTCTTTGGAGGAGGTGCAAAAGG + Intergenic
997196524 5:131983959-131983981 CACTTTGAAGGCAGGTCCAAAGG + Intronic
998391599 5:141790348-141790370 CACTTTGGAGGGGCTGCAAAAGG + Intergenic
999539601 5:152557143-152557165 CACTTTGACGCTGGGGCAGAAGG - Intergenic
999620519 5:153468125-153468147 TATTTTGAAGGAAGAGCAAATGG - Intergenic
999709308 5:154302391-154302413 CACTTGGCAGGAGGTGCAGAGGG - Intronic
999830300 5:155312627-155312649 CCCTTCAAGGGAGGGGCAAATGG + Intergenic
1000367068 5:160501540-160501562 TACTCTGAGGGTGGGGCAAATGG + Intergenic
1002948423 6:1784703-1784725 CACTGTGAAGCATGGGAAAATGG - Intronic
1003703652 6:8498764-8498786 CACTTTGAGGGAGGGGAAATGGG - Intergenic
1004431961 6:15553271-15553293 CACTTTGAGGGAGGGGCAGAGGG + Intronic
1004432096 6:15554595-15554617 CACTTTGAGGGAGGGGCAGAGGG + Intronic
1004709063 6:18153146-18153168 CACTTCCAGGGAGGGGCAAAGGG - Intronic
1006368296 6:33628882-33628904 CACTGTGCAGGAAGGGCTAATGG - Intronic
1008334880 6:50290705-50290727 GATTTTGAAAAAGGGGCAAAGGG - Intergenic
1008701787 6:54109606-54109628 CACTTAGAAGAACGGGGAAAGGG - Intronic
1011126488 6:84013133-84013155 CTCTTTAAAGAAGGGGCAGATGG + Intergenic
1011809416 6:91113235-91113257 CACTTTGAGAGGGGCGCAAAGGG - Intergenic
1012658833 6:101860317-101860339 TACTTTGAGGGAGGGGCAAAAGG + Intronic
1015822285 6:137277044-137277066 TACTTTGAAAGAGGTGGAAAAGG + Intergenic
1016126707 6:140412397-140412419 GACTTTGATTGAGGGGCATAAGG - Intergenic
1016455201 6:144223430-144223452 CACTTTGAGGAAGGGGCAAAGGG - Intergenic
1016546681 6:145231984-145232006 GACTTTGAAGGTGGGGTAGATGG + Intergenic
1017316329 6:153035784-153035806 CACCCTGAAGGAGGAGCATATGG + Intronic
1017975091 6:159350063-159350085 TGCTTCGAGGGAGGGGCAAAAGG + Intergenic
1018863695 6:167731663-167731685 TAATTCGAAGGAGGGGCATAAGG - Intergenic
1019710248 7:2515114-2515136 CAGTTAGATGGAGGGGCAGATGG - Intronic
1021732318 7:23607961-23607983 CACTTGGAGAGAGGGACAAAGGG + Intronic
1022074398 7:26953341-26953363 CACTTTGAAGATGGGGGAAGGGG - Intronic
1023310066 7:38877323-38877345 CACAGAGAAGGAGGGGTAAAAGG + Intronic
1026513596 7:71047985-71048007 TACTTTGAGGGAGGGGAAATAGG - Intergenic
1027262011 7:76471472-76471494 CATTCTGAGGGAGGAGCAAAGGG + Intronic
1027313394 7:76969567-76969589 CATTCTGAGGGAGGAGCAAAGGG + Intergenic
1028683388 7:93564851-93564873 AATTTTGAAGTAGGGACAAAGGG + Intronic
1029608926 7:101616258-101616280 CACTTTGAAGGCGTGGAGAATGG + Exonic
1030472631 7:109985643-109985665 CACATAGTAGAAGGGGCAAAGGG - Intergenic
1030659399 7:112204566-112204588 CACTTTGAAGGAGGGAAAGCTGG + Intronic
1031128707 7:117806077-117806099 CACTTTCAAGCAGGGGCCGAGGG + Intronic
1031819850 7:126486457-126486479 CACTTTGAGGGAGGGGAGAGTGG - Intronic
1032866410 7:135929738-135929760 TGTTTTGGAGGAGGGGCAAAAGG - Exonic
1032988402 7:137363660-137363682 AATATTGAAGGAGGGGCAGAGGG + Intergenic
1033262585 7:139856524-139856546 TATTTTGATGGAGGGGAAAAGGG + Intronic
1036785995 8:11687435-11687457 CAGTTTGAAGCAGGGCCAAGAGG - Intronic
1037420046 8:18692498-18692520 CCCTCTGACGGAGGGGTAAAAGG + Intronic
1037506668 8:19537531-19537553 CACTTTGAGTGAGGGGTAAAGGG - Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038113138 8:24522798-24522820 CACCTCAAGGGAGGGGCAAAGGG + Intronic
1038173345 8:25159092-25159114 CACTTTGAAGATGGAGGAAAAGG + Intergenic
1038708007 8:29913753-29913775 CTCTTTGTAGCAGTGGCAAATGG - Intergenic
1038988710 8:32842351-32842373 CACTTTGAAGTAGTAGCTAATGG - Intergenic
1039888873 8:41671253-41671275 CCCTTTGAAGGAGGGGCTGGTGG - Intronic
1040464089 8:47678591-47678613 CACTTTGGAGGGGGTGCAGAGGG + Intronic
1041731652 8:61068937-61068959 CACTGTGGAAGAGGGACAAATGG - Intronic
1042002848 8:64145720-64145742 CACTTTGAAGGAGGGGCAAATGG + Intergenic
1042453073 8:68972384-68972406 CACATTTTAGGAGGGGCAGATGG - Intergenic
1042809788 8:72811754-72811776 CACTTCAAGGGAGGGACAAAGGG + Intronic
1043134818 8:76507991-76508013 CACATGGTAGAAGGGGCAAAGGG + Intergenic
1045425405 8:102061066-102061088 CACTTTTAGGGAGGGGAGAAAGG - Intronic
1047152944 8:122285021-122285043 GAATTTGACGGAGGGGCATAAGG - Intergenic
1047261884 8:123270290-123270312 GACTTTTAAGAAGGGGAAAAAGG + Intronic
1048771861 8:137903708-137903730 CACTTTGAAGGAGGGGAAAGGGG + Intergenic
1049025112 8:139983135-139983157 CACATGGTGGGAGGGGCAAAGGG - Intronic
1051685334 9:19652505-19652527 CACTTTGAAGATGGGGGAATGGG + Intronic
1052934914 9:34085061-34085083 CAAACTGAGGGAGGGGCAAAGGG - Intergenic
1054420081 9:64920023-64920045 CCATCTGAAGGAGGGACAAAGGG + Intergenic
1054767738 9:69056275-69056297 CACTTCCAAGAAGGGGCAAAGGG + Intronic
1055199694 9:73645659-73645681 GAATTTGATGGAGGGGCATAAGG + Intergenic
1056096456 9:83259458-83259480 TACTTTGAATAAGGGGAAAATGG - Intronic
1056981434 9:91315445-91315467 CACTTGGAAGGTGGGGTAAAGGG - Intronic
1057000052 9:91500298-91500320 CACTTTGAAGGAGGAGAAGTTGG + Intergenic
1057081778 9:92178932-92178954 TATTTTGAAGGAGGAGCCAAAGG + Intergenic
1058162026 9:101580182-101580204 CACTTCAAGGGAGGGGTAAAAGG - Intronic
1058175953 9:101737430-101737452 CACTTTGCAGGAAGGAGAAAGGG + Exonic
1059748414 9:117225337-117225359 CACTCTGAAGGACGGGTGAATGG + Intronic
1062544423 9:137055140-137055162 CACTTTGCAGCAGGCGCAAAGGG - Intergenic
1185922421 X:4108201-4108223 GACTTTGAAGGTGGGGGAATGGG + Intergenic
1186178125 X:6946378-6946400 CACTTCGAGGGAGGGGCAAAGGG - Intergenic
1187175074 X:16888852-16888874 CACTTGGAAGGAAAGGCTAATGG - Intergenic
1187474896 X:19602071-19602093 CACTTTCAGGGTGGGGCAGATGG - Intronic
1188505971 X:30885512-30885534 CACTATGAAGGAGGGCAAAAAGG + Intronic
1189776864 X:44477420-44477442 CATTCTGAGGGAGGAGCAAAGGG + Intergenic
1190247398 X:48699703-48699725 TATTTTGAAGGTGGGGCCAACGG + Intronic
1190916667 X:54816305-54816327 CACTTTGAAGGAGAGGCTTGAGG + Intergenic
1191006302 X:55714717-55714739 TGGTTTGAAGGAGGGGGAAAAGG + Intergenic
1191049609 X:56177500-56177522 CACACTGAAGTAGGGGCAGATGG - Intergenic
1193654315 X:84181157-84181179 CACTTTACAGGAGAGGCAGAGGG + Intronic
1193753590 X:85378870-85378892 TGCTTTGCAGTAGGGGCAAAGGG + Intronic
1194761150 X:97797567-97797589 CACTTTGAGAGAGGGGCAAAGGG - Intergenic
1195282505 X:103349385-103349407 CATTTTGAAGATGGGGGAAATGG + Intergenic
1195381493 X:104275229-104275251 CACTTTGAAGGTGGAGTAAGGGG - Intergenic
1195549880 X:106156170-106156192 CACATGGCAGAAGGGGCAAAAGG + Intergenic
1196486334 X:116213975-116213997 CTCTCAGAAGGAGGTGCAAAAGG + Intergenic
1197039626 X:121920966-121920988 CACTTTTATGGAGAGGCAAAAGG - Intergenic
1199525218 X:148784408-148784430 CATTTTGAAGGAGAGACAAGAGG + Intronic
1199751733 X:150826098-150826120 CACATGGCAGAAGGGGCAAAAGG - Intronic
1201321116 Y:12699477-12699499 TACCTGGAAGGAGGGGAAAACGG + Intergenic