ID: 1135765897

View in Genome Browser
Species Human (GRCh38)
Location 16:25177857-25177879
Sequence CCTCATTTTATGTAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 176}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135765888_1135765897 20 Left 1135765888 16:25177814-25177836 CCCATAAACACAGTCTTACCCAA 0: 1
1: 0
2: 1
3: 11
4: 167
Right 1135765897 16:25177857-25177879 CCTCATTTTATGTAGCAGGAGGG 0: 1
1: 0
2: 0
3: 18
4: 176
1135765890_1135765897 2 Left 1135765890 16:25177832-25177854 CCCAACCTTTTGTTTCCTTGCGA 0: 1
1: 0
2: 1
3: 12
4: 169
Right 1135765897 16:25177857-25177879 CCTCATTTTATGTAGCAGGAGGG 0: 1
1: 0
2: 0
3: 18
4: 176
1135765891_1135765897 1 Left 1135765891 16:25177833-25177855 CCAACCTTTTGTTTCCTTGCGAA 0: 1
1: 0
2: 0
3: 18
4: 170
Right 1135765897 16:25177857-25177879 CCTCATTTTATGTAGCAGGAGGG 0: 1
1: 0
2: 0
3: 18
4: 176
1135765889_1135765897 19 Left 1135765889 16:25177815-25177837 CCATAAACACAGTCTTACCCAAC 0: 1
1: 0
2: 0
3: 10
4: 170
Right 1135765897 16:25177857-25177879 CCTCATTTTATGTAGCAGGAGGG 0: 1
1: 0
2: 0
3: 18
4: 176
1135765887_1135765897 23 Left 1135765887 16:25177811-25177833 CCACCCATAAACACAGTCTTACC 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1135765897 16:25177857-25177879 CCTCATTTTATGTAGCAGGAGGG 0: 1
1: 0
2: 0
3: 18
4: 176
1135765892_1135765897 -3 Left 1135765892 16:25177837-25177859 CCTTTTGTTTCCTTGCGAAACCT 0: 1
1: 0
2: 1
3: 14
4: 170
Right 1135765897 16:25177857-25177879 CCTCATTTTATGTAGCAGGAGGG 0: 1
1: 0
2: 0
3: 18
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135765897 Original CRISPR CCTCATTTTATGTAGCAGGA GGG Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
902914034 1:19625099-19625121 CCTCATTTTATGGAGGAAAATGG - Intronic
903798990 1:25952503-25952525 CCTCATTTTGTAGATCAGGAAGG - Intergenic
906794087 1:48682868-48682890 CCTCATTTAATGGAGCTGGTGGG + Intronic
907808804 1:57847911-57847933 CCTCATTTAATGTTGGAGAAAGG + Intronic
907903738 1:58765233-58765255 CCACATTCTAGGCAGCAGGATGG + Intergenic
908151206 1:61304814-61304836 CCTCATTTTGTACATCAGGAAGG - Intronic
911491407 1:98572620-98572642 CATTCTTTTTTGTAGCAGGATGG - Intergenic
912810498 1:112790518-112790540 CCTCATCTTCTGTAAAAGGAAGG + Intergenic
913166697 1:116193960-116193982 CCTGATTATATATAGCAGCATGG - Intergenic
914241873 1:145858090-145858112 CCAAACTCTATGTAGCAGGAGGG + Intronic
916539694 1:165740840-165740862 CATCTTATGATGTAGCAGGAAGG + Intronic
916905841 1:169281957-169281979 CCTCATTTTATGAGTTAGGAAGG + Intronic
919555165 1:199043625-199043647 CAAACTTTTATGTAGCAGGATGG + Intergenic
920551276 1:206863297-206863319 CATCATTTTATCAAGCAGGAAGG + Intergenic
921688521 1:218119925-218119947 GCTCACTTTATTTAGTAGGAAGG + Intergenic
922345915 1:224696231-224696253 CCTCCTTTCAAGTAGCAGGATGG + Intronic
922383078 1:225052987-225053009 CCTCATTCCAGGCAGCAGGATGG + Intronic
923173852 1:231444722-231444744 TCACATTTTATGTGGGAGGAGGG + Intergenic
923225725 1:231937475-231937497 TTTCATTTTATGCAACAGGAGGG + Intronic
923544453 1:234914123-234914145 CCACATTTCAGGCAGCAGGAAGG - Intergenic
924386939 1:243507817-243507839 CCTCTTTTTCTGTAAGAGGAAGG + Intronic
924619325 1:245647048-245647070 CCTCATTTTAGGAAGAATGAAGG - Intronic
1064455788 10:15486380-15486402 CCTCATTTTAGGGAGCATAATGG - Intergenic
1065135633 10:22666437-22666459 CAGCTTTTTATGCAGCAGGAAGG + Intronic
1066345734 10:34584245-34584267 CCTCATTTTAGGAAGCAGTAAGG - Intronic
1067251236 10:44588573-44588595 CCTCATTTTAGCAACCAGGATGG - Intergenic
1068018919 10:51555949-51555971 CCCCATTTTCTCAAGCAGGAAGG + Intronic
1070756414 10:78996170-78996192 CCTCACTCTGTGTAGCAGGAGGG - Intergenic
1071296264 10:84222282-84222304 CCTCATATTTTGTGCCAGGAAGG + Exonic
1071874654 10:89831837-89831859 CCTCATCTTTTGTAGAAGAAAGG - Intergenic
1072225949 10:93368833-93368855 CCTCATTTCTTGGAGCATGAAGG + Intronic
1072842472 10:98789700-98789722 CCTCATTTCTTATAGCTGGATGG + Intronic
1073817937 10:107228094-107228116 CCTCATCTTCTGTAGCTGAAGGG + Intergenic
1074034903 10:109728738-109728760 CCTTATGTTATGTAGCATGCAGG + Intergenic
1074035931 10:109738328-109738350 CCTTATGTTATGTAGCATGCAGG + Intergenic
1074861760 10:117515284-117515306 CCTTATTTTATCTAAAAGGAAGG - Intergenic
1076749283 10:132534219-132534241 CCTCATTCCATGTAGCAGCATGG + Intergenic
1078351101 11:10594187-10594209 CCCCATCTTCTGCAGCAGGAGGG + Exonic
1078871108 11:15345950-15345972 CCTCATTTTCTAAAGCAGGGTGG + Intergenic
1080326806 11:31084480-31084502 CTTCATTTTAGAAAGCAGGAAGG - Intronic
1080592488 11:33736167-33736189 CTTCATTTTATCTACGAGGAAGG - Intronic
1081795656 11:45817541-45817563 AATCATTTTATGTGGGAGGATGG - Intergenic
1085572924 11:77574953-77574975 CCTCATTTTTTGTAGCTTGCTGG - Intronic
1086429865 11:86726173-86726195 ACTCATCTTTAGTAGCAGGATGG - Intergenic
1087117573 11:94541975-94541997 CCTTATTTGATGTGGGAGGAGGG - Intergenic
1089434249 11:118450351-118450373 CCTCTTTTTCTGAAGCAGGGTGG + Intronic
1090640787 11:128727216-128727238 CCTCATTTTATAGTTCAGGAAGG - Intronic
1092158994 12:6305150-6305172 CCTCATTTTACATACAAGGATGG + Intergenic
1093392352 12:18637828-18637850 CTTGATTTAATGTAGCAGAAAGG - Intronic
1093445824 12:19257121-19257143 ATTCATTTTATATAGCAGGTAGG + Intronic
1095602882 12:44034200-44034222 TCTCTATGTATGTAGCAGGAGGG - Intronic
1097862820 12:64534989-64535011 CGTCATTTTATGTACCACTAAGG + Intergenic
1098103735 12:67046839-67046861 CCTCTTTTAAAGTAGGAGGAGGG - Intergenic
1098536852 12:71603045-71603067 TCACATTGTATTTAGCAGGAAGG - Intergenic
1101853703 12:108424790-108424812 CCTCATCTTCTGTAGCTGGAAGG - Intergenic
1102733530 12:115136513-115136535 CCTCATGTTATGGAGCAGTTGGG - Intergenic
1103969342 12:124660312-124660334 CCTCATTTTATGAATGAGGCTGG - Intergenic
1104183493 12:126405525-126405547 CCTCATTTTATCTTGCCAGAAGG - Intergenic
1106404947 13:29465297-29465319 CCTCATTTTATAGATAAGGACGG + Intronic
1106751425 13:32773440-32773462 CATCATTTTATCTACCAGGTTGG + Intronic
1107719246 13:43230597-43230619 CCTAATTTTATGCAGTATGAGGG + Intronic
1108135204 13:47349429-47349451 CATCATTTTCTGTAACAGAAGGG - Intergenic
1108144084 13:47458485-47458507 TCTTATTTTTTGTAGCAAGATGG + Intergenic
1109347758 13:61136457-61136479 CCACATTTCAGGTAGGAGGAAGG + Intergenic
1109785103 13:67163555-67163577 TCTCATTTTATCTTGTAGGAAGG + Intronic
1113140676 13:107145888-107145910 CCTCATTTTAGGCAACAGAAGGG - Intergenic
1116149570 14:41122792-41122814 CCTCATTTTATGTTACAGTCAGG - Intergenic
1119932111 14:78557381-78557403 CCTCATTCAATTAAGCAGGAGGG - Intronic
1121313159 14:92946005-92946027 CCTCGATTTAAGGAGCAGGAAGG - Intronic
1122251937 14:100445979-100446001 CCTCTTTTCATCTACCAGGATGG - Intronic
1123769247 15:23512125-23512147 TGTCATGTTATGTAGCAAGAAGG - Intergenic
1125375808 15:39028201-39028223 CCTCAGCTTCTGTAGCAGGTAGG - Intergenic
1126501003 15:49344853-49344875 AGTCACTTGATGTAGCAGGAGGG - Intronic
1132140001 15:99384474-99384496 CCTTATTTTATGAAGCTGCAAGG - Intronic
1135611953 16:23875999-23876021 CCTCATTTTATGTGACTGGCCGG + Intronic
1135671556 16:24379923-24379945 TCACATTTTATGTATCAAGAGGG + Intergenic
1135765897 16:25177857-25177879 CCTCATTTTATGTAGCAGGAGGG + Intronic
1138372269 16:56536555-56536577 CCTTAGTTAATGGAGCAGGAAGG + Intergenic
1138920655 16:61524445-61524467 CCACATTTTATATAGGATGAAGG + Intergenic
1139919684 16:70451421-70451443 CCTGCTTTAATGGAGCAGGATGG + Intergenic
1141790523 16:86231215-86231237 CCTCATTTTGTGGAGGAGGAAGG + Intergenic
1142970051 17:3605206-3605228 CCTCATTTAATCTAGAAGGTGGG - Intergenic
1143258242 17:5579683-5579705 CCACATTTTCTTTAGCAGTATGG - Intronic
1147956134 17:44136052-44136074 CATCATTTTATGTGGCTGCATGG + Intergenic
1148049894 17:44764715-44764737 CCCCATTTTATGAATGAGGAAGG - Intronic
1148438207 17:47698246-47698268 CCCCATTTTATGGATCAGGTGGG + Intronic
1149446125 17:56714636-56714658 CCTCATTTTATAGATGAGGAGGG - Intergenic
1153062445 18:1007927-1007949 CCTCATAGGATGTTGCAGGAAGG + Intergenic
1153428482 18:4990878-4990900 CCTCCATCTATGAAGCAGGAGGG + Intergenic
1153739603 18:8110065-8110087 ACACATTCTATGTACCAGGAGGG - Intronic
1153951717 18:10063082-10063104 ACTCATTAAATGTAGGAGGAAGG - Intergenic
1154037070 18:10813519-10813541 TCTTATTTTACGTAGCATGATGG + Intronic
1156623535 18:38881693-38881715 CTTCATTTTATTTAGCATGATGG + Intergenic
1158694039 18:59687444-59687466 CATCATTTGATGTAATAGGAAGG - Intronic
1166740313 19:45110723-45110745 CCTCTTGTTATGAAGGAGGAAGG + Intronic
925517123 2:4695322-4695344 TCTCAGTTTATGTAGCTGTAAGG + Intergenic
925836140 2:7949027-7949049 GCTCATTTTATAGAACAGGAAGG - Intergenic
926974471 2:18499976-18499998 ACACATTTCAGGTAGCAGGAAGG - Intergenic
927323237 2:21772577-21772599 TCTAATATTATGTATCAGGATGG - Intergenic
930725896 2:54681037-54681059 CCTCATATTCTGCAGAAGGAAGG + Intergenic
932822145 2:74910800-74910822 CCTCATTTCATAGAACAGGATGG - Intergenic
934561639 2:95316584-95316606 CCTCATTTCAGGCAACAGGAAGG + Intronic
936049470 2:109212242-109212264 CCTCATTTCATGGAGTTGGAGGG - Intronic
936541783 2:113358118-113358140 CTTTATTTTATAGAGCAGGAGGG + Intergenic
937009163 2:118546236-118546258 CCTCATTTTCTCTACCAGAAAGG + Intergenic
937421396 2:121759269-121759291 CATTATTTTATGTACCAGTAGGG + Intronic
940112049 2:150165812-150165834 ACTCATATTAAGCAGCAGGAAGG + Intergenic
940239997 2:151552215-151552237 CCCCATTTTATGCATCAGAATGG + Intronic
940501631 2:154501259-154501281 CCTGCTTTTATGCAGCCGGAGGG + Intergenic
940561514 2:155302830-155302852 TCTCATTTTCTGTAGCTAGAAGG - Intergenic
942823225 2:180141443-180141465 CCTCATTCTAGCCAGCAGGAAGG + Intergenic
942947894 2:181689476-181689498 CCTCATTTGATATGGCAGGAGGG - Intergenic
946576460 2:221081338-221081360 TCTCAGTTTATTCAGCAGGAGGG - Intergenic
948811377 2:240480208-240480230 CCCCATTTTATGGAGGGGGAAGG + Intronic
1169997026 20:11570077-11570099 CCTGCTTTTATCTAGCAAGAAGG - Intergenic
1173209460 20:41020861-41020883 CCTCATTGAGTGTTGCAGGAAGG + Intergenic
1174034521 20:47660171-47660193 CCTCATTTTATGGAGGAGTAAGG - Intronic
1177049637 21:16216509-16216531 CCTCTTTTTATGTGGTAGGGTGG - Intergenic
1183668437 22:39258056-39258078 CCTGAGTCTATGCAGCAGGAGGG + Intergenic
952019725 3:29003309-29003331 CTTCATTTTATGTGTCATGAGGG - Intergenic
953064653 3:39457860-39457882 CCCAAGTTTAGGTAGCAGGAGGG - Intergenic
954116130 3:48467737-48467759 CCTCACTTTCCCTAGCAGGATGG + Intergenic
956307411 3:67841085-67841107 CCTCTTTTTATGGAGCAGTAAGG + Intergenic
958196631 3:90249122-90249144 ACGAATTTTATGTAGCAGCATGG - Intergenic
959962362 3:112313030-112313052 CCTTATCTTATGTAGATGGAAGG - Intergenic
960304250 3:116041850-116041872 CATCATTTTATATAGCAGCCAGG + Intronic
961552684 3:127678095-127678117 CCTCAGCTTCTCTAGCAGGAGGG + Intronic
963587813 3:147215167-147215189 CCCCATATTTTGTAGCAGGCTGG + Intergenic
967330455 3:188284570-188284592 CTTCATTTCACCTAGCAGGATGG - Intronic
971514818 4:27472838-27472860 CCTCAGTATATGTACCAGAAAGG - Intergenic
972512459 4:39782178-39782200 CCTGATTATATATAGCAGCATGG - Exonic
972720894 4:41697008-41697030 CCACACTTCAAGTAGCAGGATGG + Intronic
974707212 4:65535283-65535305 CCCCATTGTCTGTGGCAGGATGG + Intronic
977337414 4:95716428-95716450 CCTCTTTTTTGGTTGCAGGAGGG + Intergenic
978871609 4:113584738-113584760 CCTCATTATATGTAGCCTGCTGG - Intronic
982835225 4:160114380-160114402 CCTCATTTAATGTTGCAGCTTGG + Intergenic
984858795 4:184218792-184218814 TTTAATTTTATGTAGCATGACGG - Intronic
985403040 4:189611096-189611118 CCTTCTTTTATGTGGCAGGCAGG - Intergenic
988616652 5:32781526-32781548 CCTCTTTGTATGTATCAGGTTGG + Intronic
989635704 5:43530697-43530719 CCTGTCTTTTTGTAGCAGGAAGG - Intronic
990019386 5:51106586-51106608 CTTCATAGTATGTAGCAGAATGG - Intergenic
990346108 5:54873328-54873350 TCTCATCTTCTATAGCAGGAGGG + Intergenic
990647194 5:57858058-57858080 TCTAATTTTCTGCAGCAGGAGGG - Intergenic
991256689 5:64622052-64622074 CCTCATCTTCTGTAGCTGGAGGG - Intergenic
992097554 5:73377028-73377050 CCTCAGTTTATGGAACAAGAGGG + Intergenic
992750450 5:79856465-79856487 GCTCATTTTAGGAAGCAAGATGG + Intergenic
993222750 5:85122883-85122905 CATAATTCTATGTAGCAGTAGGG - Intergenic
999216480 5:149939841-149939863 CCTCATTTTATAGAGGAGGAGGG + Intronic
1001110161 5:168889114-168889136 CTTTATTTTATACAGCAGGAGGG + Intronic
1002874597 6:1200210-1200232 CCTCCTTTGATGTAGCATTAAGG - Intergenic
1003734434 6:8862420-8862442 CTAAATTTTATGTAGCAGAAGGG - Intergenic
1007267669 6:40609629-40609651 TCTCATTTTGTGAAGCAGGAGGG - Intergenic
1011562393 6:88633820-88633842 CCTAATTTTATGTGGCAGCATGG - Intronic
1014302133 6:119694815-119694837 CCTCATTTTATAGATGAGGAAGG - Intergenic
1014701605 6:124695895-124695917 CAAAATTTTATGTAGCATGATGG + Intronic
1017535389 6:155341790-155341812 CCTCATTTCATGTATCATGTAGG + Intergenic
1018710061 6:166492564-166492586 TCTCATTTCATGTAGCCAGAAGG - Intronic
1019230487 6:170557078-170557100 CCTCAGGTAATATAGCAGGAGGG + Exonic
1020984246 7:15112459-15112481 CCTCTTTTTAAGTGGTAGGAGGG + Intergenic
1023132456 7:37016353-37016375 CCTCATTTTATATATGAGAAAGG + Intronic
1023485044 7:40677264-40677286 CCTCATTTTTTGAACCAAGAAGG - Intronic
1023540100 7:41255667-41255689 CATCATTTTCTTTAGGAGGAAGG + Intergenic
1024513053 7:50218285-50218307 CCTCATTTTATTTAGAAGTAAGG + Intergenic
1025533198 7:61915974-61915996 CTTTTTTTTATTTAGCAGGAGGG + Intergenic
1026480588 7:70775805-70775827 CCTCCTTTTAAGGTGCAGGAAGG + Intronic
1026654359 7:72244016-72244038 CCTCATTCCATTCAGCAGGATGG - Intronic
1027852668 7:83468496-83468518 CCTCATTCTCTGTAGCAGCTGGG - Intronic
1028110404 7:86933975-86933997 CCTCATTTTATGTAAGAAGTGGG + Intronic
1029067490 7:97866370-97866392 CGTCATTTTATCTATCAGTAAGG - Intronic
1033402963 7:141044582-141044604 GCTCATTTGATGGAGAAGGAAGG - Intergenic
1036589000 8:10150894-10150916 TCTCATTTTATATATCAGTAAGG + Intronic
1037310006 8:17545246-17545268 CCTCATTTTATGTACGAGTGAGG - Intronic
1038642024 8:29336714-29336736 CCTCATTTTTTTAAGCAGTAAGG - Exonic
1039215847 8:35269894-35269916 CAGGATTTTATGTAGCAGAATGG - Intronic
1040128320 8:43764448-43764470 TATCTTTTTATGTAGCAGGTTGG + Intergenic
1041179306 8:55231037-55231059 CTTCATTTTAAAGAGCAGGAAGG - Intronic
1042583974 8:70314886-70314908 ATTCATTTTATCTAGCAGGAAGG + Intronic
1043797486 8:84562675-84562697 CCACATTTTGTATAGCAAGAAGG - Intronic
1048932478 8:139326091-139326113 TCTCATCTTCTGCAGCAGGAGGG + Intergenic
1049994030 9:1017739-1017761 CCTGATTTTCTGTGGCAGAAGGG + Intergenic
1050180435 9:2916960-2916982 GCTCAATTTATGGAGCAGGTTGG + Intergenic
1050355705 9:4780970-4780992 CCTCACCTTAAGTAGAAGGAAGG - Intergenic
1051342507 9:16124680-16124702 CCTCATTTTATTTATCAGAGTGG + Intergenic
1055144167 9:72912742-72912764 GCTCATTTAATGAAGCAGGATGG - Intronic
1057464573 9:95300995-95301017 GCTCTTTCTATGTAGAAGGAAGG + Intronic
1060476406 9:123990099-123990121 CCTCATTTTTTGTAGAGGCAGGG + Intergenic
1060951961 9:127609709-127609731 TCTTATTTTCTGTAGAAGGAAGG - Intergenic
1186893980 X:13987795-13987817 AATCATTTTATATAGCAAGAAGG + Intergenic
1189012748 X:37063035-37063057 ACTGATTTTAGGTAGCAAGATGG - Intergenic
1193240674 X:79165580-79165602 CCTTATTTTAAGAAGAAGGAAGG - Intergenic
1193708049 X:84846756-84846778 CCTGATTATATATAGCAGCATGG - Intergenic
1193711182 X:84882244-84882266 CCTGATTATATATAGCAGCATGG + Intergenic
1197709675 X:129656418-129656440 CCTAAATTCAGGTAGCAGGAAGG + Intergenic
1199032188 X:143013613-143013635 CCTCCCTTTATGCAGAAGGAAGG - Intergenic