ID: 1135773653

View in Genome Browser
Species Human (GRCh38)
Location 16:25236867-25236889
Sequence CTATGCTGCTTTTCAAAAAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 263}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135773648_1135773653 27 Left 1135773648 16:25236817-25236839 CCCCAGTTTCCAAAATGCCTTCG 0: 1
1: 0
2: 2
3: 19
4: 175
Right 1135773653 16:25236867-25236889 CTATGCTGCTTTTCAAAAACAGG 0: 1
1: 0
2: 0
3: 28
4: 263
1135773649_1135773653 26 Left 1135773649 16:25236818-25236840 CCCAGTTTCCAAAATGCCTTCGA 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1135773653 16:25236867-25236889 CTATGCTGCTTTTCAAAAACAGG 0: 1
1: 0
2: 0
3: 28
4: 263
1135773651_1135773653 18 Left 1135773651 16:25236826-25236848 CCAAAATGCCTTCGATAAGATGA 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1135773653 16:25236867-25236889 CTATGCTGCTTTTCAAAAACAGG 0: 1
1: 0
2: 0
3: 28
4: 263
1135773652_1135773653 10 Left 1135773652 16:25236834-25236856 CCTTCGATAAGATGATAGTGAAA 0: 1
1: 0
2: 1
3: 8
4: 72
Right 1135773653 16:25236867-25236889 CTATGCTGCTTTTCAAAAACAGG 0: 1
1: 0
2: 0
3: 28
4: 263
1135773650_1135773653 25 Left 1135773650 16:25236819-25236841 CCAGTTTCCAAAATGCCTTCGAT 0: 1
1: 0
2: 1
3: 16
4: 138
Right 1135773653 16:25236867-25236889 CTATGCTGCTTTTCAAAAACAGG 0: 1
1: 0
2: 0
3: 28
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135773653 Original CRISPR CTATGCTGCTTTTCAAAAAC AGG Exonic
900937053 1:5772971-5772993 CTATCTTTCTTTTGAAAAACAGG - Intergenic
902112398 1:14093250-14093272 CTATGAAGCTTTTCTAAAGCAGG - Intergenic
904085590 1:27905110-27905132 ATATGCTGCTTTGTAAAAATTGG + Intronic
908133216 1:61098300-61098322 CTTTGCTTCATTTCAAACACTGG - Intronic
908138476 1:61157601-61157623 CTATTCTGCTTTCCAAAAAAAGG - Intronic
908951433 1:69567606-69567628 ATAGGCTGCTTTTCGAGAACGGG - Intergenic
909794546 1:79717677-79717699 CTATGCTGTTATTCCAAAACAGG - Intergenic
910982454 1:92972683-92972705 TGATGGTGCTTTGCAAAAACAGG + Intergenic
912794744 1:112685929-112685951 CCATGCAGGTTTTCAAAAATAGG + Intronic
913355868 1:117921573-117921595 TTATTCTGCTTTTCCTAAACTGG - Intronic
913543856 1:119847447-119847469 CTATGTTGCTGTGCAAAAAGAGG + Intergenic
913568709 1:120099206-120099228 CAATAATGCTTTTGAAAAACAGG + Intergenic
914289524 1:146260227-146260249 CAATAATGCTTTTGAAAAACAGG + Intergenic
914550560 1:148710980-148711002 CAATAATGCTTTTGAAAAACAGG + Intergenic
917844667 1:179010762-179010784 CTATGTTGCTTTTAAAAGCCAGG + Intergenic
918420440 1:184359373-184359395 ATATGCTGCTTTTTAAAACATGG - Intergenic
918715007 1:187774858-187774880 ATATGCTAATTTTGAAAAACAGG + Intergenic
919213240 1:194516122-194516144 TGATACAGCTTTTCAAAAACTGG + Intergenic
919401726 1:197126777-197126799 GTAAACTGTTTTTCAAAAACCGG + Intronic
920297744 1:204969364-204969386 CTGTGCTGCTTTTTAAAACTGGG + Intronic
920813184 1:209306119-209306141 CCATGATGCTTTTCCTAAACTGG - Intergenic
923692185 1:236205429-236205451 CTATGGGGCTTTAAAAAAACCGG - Intronic
923932141 1:238713313-238713335 GGATACTGCTTTTCAAAAAGTGG - Intergenic
1062979863 10:1713074-1713096 CTATGCTTTTTTTCTCAAACTGG - Intronic
1064224555 10:13471350-13471372 CTTTGCTGCTTTTCAGATACTGG - Intronic
1064424001 10:15214080-15214102 CTGTCCTGCTTTTCAAATAAAGG + Exonic
1066090911 10:32018903-32018925 CTAGGCTGATTCTCAAACACTGG + Intronic
1066424040 10:35289571-35289593 GAATGTTGCTTTTAAAAAACTGG + Intronic
1067740168 10:48889521-48889543 CTATTCTGCTTTTGTATAACTGG + Intronic
1069259057 10:66371259-66371281 CTATGCAGGTTTTCAAAAAGGGG - Intronic
1071972767 10:90924877-90924899 CTTTTCTGCTTTTCAAATACAGG - Intergenic
1073854608 10:107660153-107660175 TCATGCTGCTTTTTGAAAACAGG - Intergenic
1073899094 10:108198388-108198410 CTTTGTTTCTTTTCAACAACTGG - Intergenic
1074454442 10:113585280-113585302 TTATTTTGCTTTTCATAAACAGG + Intronic
1074496164 10:113981809-113981831 ATATCCTCCTTTTCAAAACCTGG - Intergenic
1074641744 10:115391963-115391985 ATATGCTGGTTTTTAAAAACAGG + Intronic
1078149241 11:8744743-8744765 ATAGGCTTCTTTTCAAAAAGGGG - Intronic
1078277951 11:9869081-9869103 TTATCCTGCTTTTCTAATACAGG - Intronic
1079984214 11:27183464-27183486 CCATGCTCATGTTCAAAAACAGG + Intergenic
1080607136 11:33872620-33872642 GTTTCCTGCTTTTAAAAAACAGG - Intronic
1081551169 11:44113931-44113953 CTATGATGTGTTTCAAAAACTGG + Intronic
1082126989 11:48444752-48444774 CCTTGCTTATTTTCAAAAACAGG + Intergenic
1082560569 11:54615731-54615753 CCTTGCTTATTTTCAAAAACAGG + Intergenic
1083488339 11:62997234-62997256 CGAGGCTCCATTTCAAAAACAGG - Intronic
1085983243 11:81750300-81750322 CTATTTTGCTTTTCAGAATCTGG + Intergenic
1087073668 11:94107298-94107320 CTATGCTGCTTTTCAGAATTTGG + Intronic
1087949733 11:104206158-104206180 CTCTCCTGCTTTACAAAAGCAGG + Intergenic
1088271395 11:108038291-108038313 CTATGCTCCTTTTCTAAGTCAGG - Intronic
1089996814 11:122915938-122915960 CTATACTGCTGGTCAAGAACTGG + Intronic
1090726202 11:129529517-129529539 CTATGCTGCCTTTCATACACTGG + Intergenic
1094286877 12:28805021-28805043 CTCTGCTGCTTTTCAAAACATGG + Intergenic
1095073545 12:37889219-37889241 CTATTCAGATTTACAAAAACAGG + Intergenic
1095479164 12:42616443-42616465 CTATGATTCTTCTCAAAAAGTGG - Intergenic
1095562045 12:43576786-43576808 ATATGCTGTTTTCCAAGAACTGG - Intergenic
1097751324 12:63357012-63357034 TTACGCTGCTATTCAAAATCAGG + Intergenic
1098196121 12:68003987-68004009 CTTTGCTGACATTCAAAAACAGG + Intergenic
1099423141 12:82488966-82488988 CTCTACAGCTTTTCAAAAATTGG + Intergenic
1099811953 12:87594274-87594296 ATATTCTGATTTTCAAAAATAGG + Intergenic
1100676157 12:96870380-96870402 CTACGCTGCTATTCAAACATAGG - Intronic
1103337735 12:120202324-120202346 CTCTGCTGCTTTTCCAGAGCAGG + Intergenic
1106661434 13:31804090-31804112 GGATGATGCTTTTCAAGAACGGG - Intergenic
1107234960 13:38157095-38157117 ATATGATGCTTTTCTAACACTGG - Intergenic
1107426451 13:40297995-40298017 CTTTGATCCTTTTCAAAAAGTGG - Intergenic
1107497083 13:40937228-40937250 CTAAGCTGCTTGTAAACAACTGG + Intronic
1107628955 13:42323473-42323495 ATATTCTACTTTGCAAAAACAGG - Intergenic
1109338874 13:61028848-61028870 CCTTGCTCCTTCTCAAAAACAGG + Intergenic
1109578728 13:64297223-64297245 CTAAGCTGATTTTAAGAAACTGG - Intergenic
1109756562 13:66768934-66768956 CTATGCTGATTTTCACATTCAGG + Intronic
1111610883 13:90604634-90604656 TTAAGCTGCTTTTCCAAAAATGG - Intergenic
1111993696 13:95141603-95141625 CTAAGGTTCTTTTCAAAAATGGG - Intronic
1112453644 13:99536756-99536778 CTTTGCTGCTTTTTAAAACATGG + Intronic
1114804644 14:25820833-25820855 CCATGCTGCTTGTCCAAGACTGG - Intergenic
1115152959 14:30306424-30306446 ATAATCTGCTTTTCAAAAAGAGG + Intergenic
1117266973 14:54099576-54099598 ATATGCCCCTTTACAAAAACAGG - Intergenic
1117542893 14:56765658-56765680 CTAAGATGCTTTTAAAAAAGAGG + Intergenic
1118243128 14:64081139-64081161 TTATGCTTCATTTTAAAAACTGG - Intronic
1118541246 14:66828069-66828091 AATTGCTTCTTTTCAAAAACAGG - Intronic
1118832962 14:69452267-69452289 ATCTGCTGCTTTTCAAATTCAGG - Intronic
1119444711 14:74653587-74653609 CTGTGCTGCCTTTGAAAAGCAGG + Intronic
1120891269 14:89493351-89493373 CTAGGCTGCTATTCAAAAGTAGG + Intronic
1122116796 14:99531693-99531715 CTCTCCTGCTTTTCACCAACAGG + Intronic
1122405077 14:101496015-101496037 CTTTGCTGCTTTACAAACAGTGG - Intergenic
1123454587 15:20408883-20408905 TTTTGCTGCTTTTCATAAATTGG - Intergenic
1123540441 15:21284452-21284474 CTTGGCTGCTTTTCAATAACAGG + Intergenic
1124140236 15:27071060-27071082 CTGTGTTGTTTTTCAAAATCTGG + Intronic
1125747941 15:42009942-42009964 CTATGCTGCTCTGCAACAACAGG + Intronic
1126374385 15:47980641-47980663 CTATGCTTTTTTTCAAAAGTAGG - Intergenic
1127066953 15:55250269-55250291 CTATTATGTTTTTTAAAAACTGG + Intronic
1127093851 15:55493434-55493456 CTCTCCTGCTGTTTAAAAACAGG + Intronic
1127457277 15:59166642-59166664 ATATGCTGCTTTTAGGAAACTGG + Intronic
1128086369 15:64889258-64889280 CCATGCTGGTTTGCAAACACAGG - Intronic
1129447772 15:75630872-75630894 CCAAGCTGGTTTTGAAAAACTGG + Intergenic
1132055412 15:98648034-98648056 CAATGAAGCTTTTCAAGAACCGG + Intergenic
1202948755 15_KI270727v1_random:11594-11616 CTTGGCTGCTTTTCAATAACAGG + Intergenic
1134844578 16:17429069-17429091 AAATGCTGCTTTTCAAAGACGGG - Intronic
1135773653 16:25236867-25236889 CTATGCTGCTTTTCAAAAACAGG + Exonic
1136711908 16:32245013-32245035 ATCTCCTGCTTTTAAAAAACTGG + Intergenic
1136756008 16:32684393-32684415 ATCTCCTGCTTTTAAAAAACTGG - Intergenic
1136812105 16:33185979-33186001 ATCTCCTGCTTTTAAAAAACTGG + Intergenic
1136818581 16:33296059-33296081 ATCTCCTGCTTTTAAAAAACTGG + Intronic
1136825145 16:33352592-33352614 ATCTCCTGCTTTTAAAAAACTGG + Intergenic
1136830211 16:33451363-33451385 ATCTCCTGCTTTTAAAAAACTGG + Intergenic
1137601184 16:49757522-49757544 CTATGGTGATTTTCAAATGCTGG - Intronic
1140797224 16:78450050-78450072 CTTTGCTGCTTTTAGAAAATAGG + Intronic
1140979602 16:80094226-80094248 ACATGATGCTTTCCAAAAACAGG - Intergenic
1202990683 16_KI270728v1_random:8949-8971 ATCTCCTGCTTTTAAAAAACTGG + Intergenic
1203058148 16_KI270728v1_random:944746-944768 ATCTCCTGCTTTTAAAAAACTGG - Intergenic
1143809303 17:9457880-9457902 CTATTCTCCTTGTCAAAAATTGG - Intronic
1144593400 17:16544129-16544151 CTTTGTTCCTTTTCAAAAAATGG + Intergenic
1145971719 17:28960239-28960261 CTTTTTTGCTTTTCAAAATCTGG + Intronic
1146821376 17:35985789-35985811 CTACTCTCCTTTTCAGAAACTGG - Exonic
1150459023 17:65331611-65331633 CCATACTGCTTTTCTAAAAGAGG + Intergenic
1151583263 17:74992201-74992223 CTAAGTTTCTTTTCAAAGACAGG + Intronic
1203161926 17_GL000205v2_random:60760-60782 GTTTTCTGCTTTTCAAAAGCTGG + Intergenic
1154033699 18:10777595-10777617 CTATGCAGCTTTTCAAAGTCAGG - Intronic
1154996181 18:21642292-21642314 GTATACTACTCTTCAAAAACAGG - Intergenic
1156415315 18:36881723-36881745 CTATGCTGAGTTTTAAAAACTGG - Intronic
1159915979 18:74188188-74188210 CTAGGCTGATTTTCAACTACTGG + Intergenic
1163879439 19:19904463-19904485 CTGAGCTGCTGTTTAAAAACTGG - Intronic
1167339203 19:48904862-48904884 CTTTGGTGATTTTCAAATACAGG - Intronic
925280997 2:2684454-2684476 ATATGTTGCTTGTCAAAAGCAGG - Intergenic
925406651 2:3609966-3609988 CTAATCTGATTTTTAAAAACTGG - Intronic
926024114 2:9524877-9524899 ATATTCTACTGTTCAAAAACTGG + Intronic
926209413 2:10858287-10858309 CAATTTTGCTTTTCATAAACAGG + Intergenic
926725782 2:15996623-15996645 CTATGTTGCTTTTCGGAATCAGG + Intergenic
927348061 2:22070290-22070312 CTCTTCTGCTTTTGAAAAGCAGG + Intergenic
928137413 2:28698282-28698304 CTTTTCTTCTTTTTAAAAACAGG + Intergenic
929376279 2:41290278-41290300 ATCTGCTGGTTTTGAAAAACGGG - Intergenic
935378497 2:102424510-102424532 GTATACAGCTTCTCAAAAACTGG + Intronic
935537437 2:104310471-104310493 CAAGGCTCCTTTTCAAACACTGG + Intergenic
935719595 2:105968275-105968297 CAATGCTGGTCTTCAAAAGCTGG - Intergenic
935894914 2:107725118-107725140 TGATGCTGCTTTTGATAAACAGG - Intergenic
937172268 2:119886425-119886447 CATTGCTGCCTTTGAAAAACTGG + Intronic
937426684 2:121805775-121805797 CTATTTTCCTTTTCAAAAAGTGG + Intergenic
937816993 2:126261751-126261773 CTAGGATGATTTTCAAAAAGTGG - Intergenic
939341110 2:140896979-140897001 ATTTGCTGCTTTTCTAAAAGGGG + Intronic
940889622 2:159022730-159022752 TTATGTTATTTTTCAAAAACAGG - Intronic
941397646 2:164992961-164992983 CTTGGCTGCTTTTCAATAACAGG + Intergenic
941775309 2:169387050-169387072 CTGTGCTGCTTTGCCAAAGCTGG + Intergenic
941933769 2:170967444-170967466 ATAAGCTTCTTTTCAAAAAATGG - Intergenic
942109799 2:172669353-172669375 CTATTCAGCTTTTAAAAATCAGG - Intergenic
942741937 2:179191235-179191257 CTATGCAGCTGTAAAAAAACAGG + Intronic
942955672 2:181770241-181770263 CTATGCTGGTCTTTAATAACTGG + Intergenic
943199701 2:184804412-184804434 TTATGCTGCTACTCAAAATCTGG + Intronic
943791815 2:191941676-191941698 CTTTGCTGCTTCTGGAAAACTGG + Intergenic
945497358 2:210525328-210525350 CTATGCTGTCTTTTAAGAACAGG + Intronic
947262582 2:228240494-228240516 CTATACAGCCTTTCAAAAACAGG - Intergenic
948073521 2:235146869-235146891 CTATATTACTTTTCAAAACCAGG - Intergenic
1169255282 20:4092089-4092111 CTAGGCTGCTTGTCCAAAAGCGG + Intergenic
1170275825 20:14585760-14585782 CAAAGCTGTTTTTCAAATACAGG + Intronic
1170701336 20:18706343-18706365 CAATGATGCTTTTCATAAAAAGG - Intronic
1172543283 20:35738836-35738858 CTTTGCTGCTTTTAGAAAATTGG - Intronic
1172748570 20:37232801-37232823 ATATGCAGCTTTTCAAAGAATGG + Intronic
1173238479 20:41270703-41270725 CTATGCTGCTGTTCATAGTCAGG + Intronic
1175450498 20:59061804-59061826 CCATGCTTCTTCTCAAATACAGG - Intergenic
1176674931 21:9768772-9768794 GAATGCTGCTTTTAATAAACAGG + Intergenic
1176989162 21:15473530-15473552 CTTATCTGCTATTCAAAAACGGG + Intergenic
1177032623 21:16000981-16001003 ATATGCTGCTTCTCAAATAATGG - Intergenic
1177645233 21:23892633-23892655 ATATTCTACTTTTCAAAAAGTGG - Intergenic
1177903756 21:26949922-26949944 CTCTGCAGCTTTTCAAAATATGG + Intronic
1177931559 21:27291305-27291327 CTATGCTATGTTTCAAAAAAAGG + Intergenic
1178714673 21:34953253-34953275 CTATTCTTCCTTTCAAAAAGTGG + Intronic
1179945959 21:44676217-44676239 CTTTTATGCTGTTCAAAAACTGG - Intronic
1180970640 22:19813268-19813290 TTATGCTGTTCTCCAAAAACAGG + Intronic
949494214 3:4616472-4616494 CTCTTATCCTTTTCAAAAACAGG + Intronic
949534438 3:4985011-4985033 TTATTCTTCTCTTCAAAAACAGG - Exonic
949550555 3:5109242-5109264 TTATTTTGCTTTTCAGAAACAGG - Intergenic
951100195 3:18678538-18678560 CTATCCTCCTTTTAAAAAAGAGG + Intergenic
951280358 3:20741363-20741385 CAGATCTGCTTTTCAAAAACTGG + Intergenic
951815874 3:26754079-26754101 CTATTCAGCCTTTCAAAAAAAGG + Intergenic
952752828 3:36839316-36839338 GAAAGCTGCTTTTCTAAAACAGG + Intronic
953128771 3:40117229-40117251 CTATCCTGCTTTTACATAACCGG - Intronic
957369148 3:79268832-79268854 CTATTCTGATTTTAAAAATCTGG + Intronic
957386855 3:79507143-79507165 CTCTCCTGCTTTTAATAAACCGG - Intronic
957533688 3:81473508-81473530 CTATGCTGCATTTGAAATCCAGG - Intergenic
957567387 3:81902673-81902695 ATATACTGCTTTTCAAATGCTGG - Intergenic
958084008 3:88782288-88782310 CTATGCACCTTTTTAAAAATGGG - Intergenic
959201068 3:103248375-103248397 CTTAGTTGTTTTTCAAAAACCGG - Intergenic
959232134 3:103667961-103667983 CTATCATGCTTTTCAAAATTTGG + Intergenic
959384008 3:105678825-105678847 CAATGCTGCTTTTTATAAAAAGG - Intronic
959855951 3:111158904-111158926 ATATGCTCATTTTAAAAAACTGG - Intronic
961384044 3:126514574-126514596 CTATGCAGCCATTCAAAGACAGG + Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962438800 3:135392952-135392974 CTTTTCTGTTTTTCAAAAACTGG + Intergenic
964695119 3:159499031-159499053 ATATGCTGCTTTTCTAACCCAGG + Intronic
965332623 3:167395422-167395444 CTAGGCTGCTTTTCTAACTCTGG - Intergenic
965774231 3:172211482-172211504 CTATGCCCCTTTGCAAAATCAGG - Intronic
966846666 3:184135686-184135708 CTATGCTGTTATCCTAAAACCGG + Intronic
967015612 3:185479024-185479046 CTAAGCTGCTTATAAACAACGGG + Intronic
967206210 3:187124653-187124675 CTATGCTGAATATCAAAAATTGG + Intronic
968196051 3:196707416-196707438 CCATGTTACTTTTCAAAACCAGG - Exonic
971689529 4:29815001-29815023 CTATGTTGCTTGTCTCAAACAGG - Intergenic
971719233 4:30223598-30223620 ATATACTGCTTTTCAGAAAATGG + Intergenic
972052802 4:34760922-34760944 CAATGCTTCTTTTAAAAAAATGG + Intergenic
973191556 4:47391407-47391429 CTCTGCTGCTCTTCAGAAGCGGG + Intronic
977769524 4:100841191-100841213 CTGTGCTGTTTTTTTAAAACAGG - Intronic
977803572 4:101268841-101268863 CTATGCTGTGTTCCTAAAACTGG + Intronic
978128703 4:105167783-105167805 CTATCTTGCTGTTCAATAACAGG + Intronic
979905069 4:126278653-126278675 CTATGTTGATTTTCTAAAACTGG + Intergenic
980204774 4:129703335-129703357 GTATGTAGCTTTTAAAAAACAGG + Intergenic
980831598 4:138135603-138135625 CTATGATGCTTTTTATGAACTGG + Intergenic
981568749 4:146130279-146130301 CTTTACTGCTCTTTAAAAACTGG + Intergenic
981935117 4:150230923-150230945 CTATGCTTCTTTTAATGAACAGG - Intronic
982359803 4:154507224-154507246 TGATACTGCTTTGCAAAAACAGG + Intergenic
982564428 4:156971096-156971118 CTTTGATCCTTTTCAAAAACTGG - Exonic
983843931 4:172492865-172492887 CTATGCTGGATTTCAGACACTGG - Intronic
984181767 4:176491722-176491744 CCAGGCTGCCTTTCAAAAACTGG + Intergenic
985400624 4:189589923-189589945 GAATGCTGCTTTTAATAAACAGG - Intergenic
986055382 5:4131113-4131135 TTATGCTGGTTTTCAAAGACGGG - Intergenic
986782007 5:11075183-11075205 ATCTGCTGCTTCTCAAACACAGG - Intronic
987396593 5:17430471-17430493 CTAGGCTGCTTTTCTGGAACTGG + Intergenic
988125786 5:27033847-27033869 ATATACTGCTTTTATAAAACTGG - Intronic
990192707 5:53278258-53278280 CTATGCTACTTTTCTCAAATGGG - Intergenic
990708957 5:58562363-58562385 CATTGCTTCTTTTGAAAAACCGG + Intergenic
990965552 5:61443178-61443200 CTTTGCTTCTTCTCAAAAAGTGG - Intronic
990975756 5:61560161-61560183 CTCTGCCTCTTTTCAAACACAGG + Intergenic
993472387 5:88321927-88321949 CTGTGCTGTTTATCACAAACTGG - Intergenic
993714115 5:91257334-91257356 CTATGCTTCTTTTGAAAGCCTGG + Intergenic
993888976 5:93449708-93449730 CTCTGCTGGATTTGAAAAACAGG - Intergenic
994406275 5:99349463-99349485 CTATTTTGCTTTTCATAGACTGG - Intergenic
994502626 5:100599411-100599433 TTATGCTGTTTTTCAACAAGGGG - Intergenic
996507372 5:124283177-124283199 CTATGCTCCTCTGCAAACACTGG - Intergenic
996693331 5:126365463-126365485 GAATGCTGCTTTTTAAAATCTGG + Intronic
997657506 5:135566468-135566490 CCATGTAACTTTTCAAAAACAGG + Intergenic
998089763 5:139358075-139358097 CCATGCTGGTTTTCAACAGCTGG + Intronic
998970405 5:147585065-147585087 CTAATCTACTTTTGAAAAACAGG - Intergenic
999587044 5:153101164-153101186 CTATTTTAGTTTTCAAAAACTGG + Intergenic
1000259335 5:159571692-159571714 CATAGCTGCTTTGCAAAAACTGG - Intergenic
1002493212 5:179594456-179594478 AGATGCTGTTTTTCAAAATCTGG - Intronic
1003858289 6:10298007-10298029 CTAGACTGCATTTCACAAACAGG + Intergenic
1004729735 6:18345984-18346006 GTAAGATGCTTTTCAATAACAGG - Intergenic
1005734880 6:28736317-28736339 CTATGCTCGTTTTAAAAATCAGG - Intergenic
1007055125 6:38875399-38875421 CCATGCTGCCTGTCTAAAACAGG + Intronic
1009676947 6:66837697-66837719 TTAACCTGCTTTTTAAAAACTGG - Intergenic
1010759151 6:79702275-79702297 CTTTGGTACTTTTCAATAACGGG - Exonic
1011542803 6:88450661-88450683 CTATTTTGGTTTTCAAAAATAGG + Intergenic
1012408745 6:98931634-98931656 CCTTGCTTATTTTCAAAAACAGG - Intronic
1012452475 6:99367349-99367371 CTTTCCTGGTTTTCAAAAATAGG + Intergenic
1013812462 6:114060311-114060333 CTAGACAGCTTTTAAAAAACAGG + Intronic
1015155670 6:130092814-130092836 GTAGGCTGGTGTTCAAAAACAGG + Exonic
1015656626 6:135525722-135525744 CTATTCTGCTTTTCAGAGACTGG + Intergenic
1016562831 6:145416225-145416247 CTATGCATCTTTTTCAAAACAGG + Intergenic
1016983168 6:149871876-149871898 AAAACCTGCTTTTCAAAAACTGG - Intergenic
1019047279 6:169158888-169158910 CTCTGCAGGTTTTCAAACACAGG - Intergenic
1019348397 7:541646-541668 GTTTGCCGCTTTTCCAAAACTGG + Intergenic
1020594079 7:10182452-10182474 CTATGCAGTTTGTTAAAAACTGG + Intergenic
1021294069 7:18882039-18882061 CTGTGCCGTGTTTCAAAAACTGG + Intronic
1021618080 7:22523020-22523042 CTATGCTGATCTTCAAACAATGG + Intronic
1021854552 7:24841426-24841448 CTATACTTCTTTTCAAGTACAGG - Intronic
1022927676 7:35072498-35072520 CTATGCTGATCTTCAAACAATGG + Intergenic
1023328553 7:39087412-39087434 CATTGCTGCTTTTCAAAGAAGGG - Intronic
1026311866 7:69192917-69192939 CTATTCTGCTTTTTAGAGACAGG - Intergenic
1027462763 7:78476029-78476051 CTATACTGCTCTTTGAAAACTGG + Intronic
1027467070 7:78528584-78528606 ATATTCTACTTTTCTAAAACTGG + Intronic
1027899955 7:84100000-84100022 GTTTACTGCTTTTCAAAAAAAGG - Intronic
1028335531 7:89649442-89649464 CTATTCAGCCTTTTAAAAACAGG - Intergenic
1028374594 7:90133087-90133109 CTATGCTGATCTTCAAACAATGG - Intergenic
1029208061 7:98881072-98881094 CTATGCTTCTTTTCATAGGCTGG + Exonic
1030787326 7:113678356-113678378 CAATTCTGCTTTCCAAAAACAGG - Intergenic
1030884851 7:114923598-114923620 TTATGCTTGTTTTCAATAACTGG + Intronic
1031319352 7:120303444-120303466 CTATACAGTTTTTCAAAGACAGG - Intronic
1034077464 7:148246004-148246026 CATTGCTGCTTTCCATAAACTGG + Intronic
1037656892 8:20891891-20891913 CTATTCTCCTTTTAAGAAACAGG + Intergenic
1037871924 8:22506132-22506154 TCATGCTGCTTTTTAAAAGCAGG - Intronic
1039766508 8:40633880-40633902 CTAAGCTGCTTTCCGAAAACGGG - Intronic
1041522023 8:58767509-58767531 ACATGCTGCTTTTAAACAACGGG + Intergenic
1042213544 8:66405414-66405436 TTATTCTGTTTTTCAAACACAGG + Intergenic
1042901606 8:73734083-73734105 ATATGTTACTTTTTAAAAACTGG - Intronic
1045045541 8:98272583-98272605 CTATGATGCTTTTTCTAAACTGG - Intronic
1046724508 8:117659775-117659797 TTATGCTCCTTTTCTAAAAGTGG + Intergenic
1047391170 8:124452463-124452485 CCATGCTGCTTCTCCCAAACAGG - Exonic
1047826029 8:128576542-128576564 GTATGCTAATTTTCAAATACAGG - Intergenic
1049186663 8:141258590-141258612 CCATGCTGTCTTTGAAAAACGGG - Intronic
1052863170 9:33449174-33449196 CTATGCTGCTTTTAATAACAAGG + Intergenic
1053188328 9:36037383-36037405 CTCTGCTGCTTGTCAGAAAAGGG + Intronic
1053425124 9:38005328-38005350 CTGTGGTCCTTTTCCAAAACAGG - Intronic
1056841909 9:90004593-90004615 CTATGCTGCTTTTTAGTTACAGG + Intergenic
1057118369 9:92546930-92546952 TTATGCTGGTCTTAAAAAACTGG - Intronic
1057144633 9:92749585-92749607 CTAAGCTGCTTTTAGAAAACTGG + Intronic
1057626541 9:96682849-96682871 CTCTGCTGGTTCTCAAAAATAGG - Intergenic
1058154877 9:101503857-101503879 CTGTTCTGCTTTTAAAAAATTGG + Intronic
1186307623 X:8280045-8280067 GTATGCTGTTTTTCAAATCCAGG - Intergenic
1186546306 X:10453520-10453542 GTATGCTGCTATTCACAAAAGGG - Intronic
1190653419 X:52590022-52590044 CTATCCTGCTTCTCACACACTGG + Intergenic
1195364138 X:104111448-104111470 TTATGTTGCTTTTATAAAACAGG + Intronic
1196126142 X:112101559-112101581 CTATGGGTCATTTCAAAAACTGG - Intergenic
1196932554 X:120696051-120696073 CCAGGCTGCTTTTTAAAAGCAGG + Intergenic
1197580192 X:128273239-128273261 CAATGCTGCTTTTAAGATACTGG + Intergenic
1198139147 X:133785275-133785297 GTATACTGCTTTTCACAAACAGG - Intronic
1198379634 X:136071771-136071793 CAATATTGCCTTTCAAAAACAGG + Intergenic
1198407982 X:136334396-136334418 TTATTCTTCTTTTCAAAAATTGG + Intronic
1198673937 X:139111686-139111708 CGCTGCTGCTTCTCATAAACGGG + Intronic