ID: 1135789143

View in Genome Browser
Species Human (GRCh38)
Location 16:25377414-25377436
Sequence ACTATTACACAGGAGAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135789143_1135789147 -1 Left 1135789143 16:25377414-25377436 CCCGGCCTCTCCTGTGTAATAGT No data
Right 1135789147 16:25377436-25377458 TATCATGCATCCATTTGTCATGG No data
1135789143_1135789151 11 Left 1135789143 16:25377414-25377436 CCCGGCCTCTCCTGTGTAATAGT No data
Right 1135789151 16:25377448-25377470 ATTTGTCATGGCCTCATGGTGGG No data
1135789143_1135789150 10 Left 1135789143 16:25377414-25377436 CCCGGCCTCTCCTGTGTAATAGT No data
Right 1135789150 16:25377447-25377469 CATTTGTCATGGCCTCATGGTGG No data
1135789143_1135789148 7 Left 1135789143 16:25377414-25377436 CCCGGCCTCTCCTGTGTAATAGT No data
Right 1135789148 16:25377444-25377466 ATCCATTTGTCATGGCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135789143 Original CRISPR ACTATTACACAGGAGAGGCC GGG (reversed) Intergenic
No off target data available for this crispr