ID: 1135791594

View in Genome Browser
Species Human (GRCh38)
Location 16:25401549-25401571
Sequence TGGGGATGGGTCAATCTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135791586_1135791594 5 Left 1135791586 16:25401521-25401543 CCTGCAAGGGAAGCCTCTTAGGG No data
Right 1135791594 16:25401549-25401571 TGGGGATGGGTCAATCTTATTGG No data
1135791591_1135791594 -8 Left 1135791591 16:25401534-25401556 CCTCTTAGGGAAAGTTGGGGATG No data
Right 1135791594 16:25401549-25401571 TGGGGATGGGTCAATCTTATTGG No data
1135791583_1135791594 18 Left 1135791583 16:25401508-25401530 CCTTTCTCACACTCCTGCAAGGG No data
Right 1135791594 16:25401549-25401571 TGGGGATGGGTCAATCTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135791594 Original CRISPR TGGGGATGGGTCAATCTTAT TGG Intergenic
No off target data available for this crispr