ID: 1135794938

View in Genome Browser
Species Human (GRCh38)
Location 16:25432720-25432742
Sequence CATTTAGACTGGTTTGCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135794933_1135794938 15 Left 1135794933 16:25432682-25432704 CCTGGTAACAGGTACCACTTAGA No data
Right 1135794938 16:25432720-25432742 CATTTAGACTGGTTTGCTTTGGG No data
1135794934_1135794938 1 Left 1135794934 16:25432696-25432718 CCACTTAGAAATCCATCTTATAA No data
Right 1135794938 16:25432720-25432742 CATTTAGACTGGTTTGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135794938 Original CRISPR CATTTAGACTGGTTTGCTTT GGG Intergenic