ID: 1135801785

View in Genome Browser
Species Human (GRCh38)
Location 16:25504041-25504063
Sequence GCAAAACCTAAGATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135801785_1135801794 20 Left 1135801785 16:25504041-25504063 CCCAGCTCCATCTTAGGTTTTGC No data
Right 1135801794 16:25504084-25504106 ATATGGAGAATGGAATGAAGAGG No data
1135801785_1135801793 10 Left 1135801785 16:25504041-25504063 CCCAGCTCCATCTTAGGTTTTGC No data
Right 1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG No data
1135801785_1135801795 30 Left 1135801785 16:25504041-25504063 CCCAGCTCCATCTTAGGTTTTGC No data
Right 1135801795 16:25504094-25504116 TGGAATGAAGAGGTAAGCACTGG No data
1135801785_1135801788 -9 Left 1135801785 16:25504041-25504063 CCCAGCTCCATCTTAGGTTTTGC No data
Right 1135801788 16:25504055-25504077 AGGTTTTGCAGCAATCACCCTGG No data
1135801785_1135801789 -8 Left 1135801785 16:25504041-25504063 CCCAGCTCCATCTTAGGTTTTGC No data
Right 1135801789 16:25504056-25504078 GGTTTTGCAGCAATCACCCTGGG No data
1135801785_1135801790 3 Left 1135801785 16:25504041-25504063 CCCAGCTCCATCTTAGGTTTTGC No data
Right 1135801790 16:25504067-25504089 AATCACCCTGGGTACACATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135801785 Original CRISPR GCAAAACCTAAGATGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr