ID: 1135801786

View in Genome Browser
Species Human (GRCh38)
Location 16:25504042-25504064
Sequence TGCAAAACCTAAGATGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135801786_1135801795 29 Left 1135801786 16:25504042-25504064 CCAGCTCCATCTTAGGTTTTGCA No data
Right 1135801795 16:25504094-25504116 TGGAATGAAGAGGTAAGCACTGG No data
1135801786_1135801789 -9 Left 1135801786 16:25504042-25504064 CCAGCTCCATCTTAGGTTTTGCA No data
Right 1135801789 16:25504056-25504078 GGTTTTGCAGCAATCACCCTGGG No data
1135801786_1135801793 9 Left 1135801786 16:25504042-25504064 CCAGCTCCATCTTAGGTTTTGCA No data
Right 1135801793 16:25504074-25504096 CTGGGTACACATATGGAGAATGG No data
1135801786_1135801788 -10 Left 1135801786 16:25504042-25504064 CCAGCTCCATCTTAGGTTTTGCA No data
Right 1135801788 16:25504055-25504077 AGGTTTTGCAGCAATCACCCTGG No data
1135801786_1135801790 2 Left 1135801786 16:25504042-25504064 CCAGCTCCATCTTAGGTTTTGCA No data
Right 1135801790 16:25504067-25504089 AATCACCCTGGGTACACATATGG No data
1135801786_1135801794 19 Left 1135801786 16:25504042-25504064 CCAGCTCCATCTTAGGTTTTGCA No data
Right 1135801794 16:25504084-25504106 ATATGGAGAATGGAATGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135801786 Original CRISPR TGCAAAACCTAAGATGGAGC TGG (reversed) Intergenic
No off target data available for this crispr